4 t cell patrol and specificity of t cell infiltrates

Chapter 4: Getting Images into and out of Photoshop

Chapter 4: Getting Images into and out of Photoshop

... toward the right to reset the current adjustment to the default settings ߜ Delete adjustment layer: Click the Trash icon to the far right at the bottom of the Adjustment panel to delete the current ... adjustment layer through the menu at the bottom of the Layers panel (click the fourth button from the left) and then move the cursor to the type of adjustment layer that you want to add (to the right ... selection and need to deselect part of it, use the third button Say, for example, that you make a round selection and want to chop out the middle to make a donut shape Click the third button and then...

Ngày tải lên: 27/08/2012, 14:35

42 596 1
Sputum smear negative pulmonary tuberculosis: sensitivity and specificity of diagnostic algorithm docx

Sputum smear negative pulmonary tuberculosis: sensitivity and specificity of diagnostic algorithm docx

... order to identify a better diagnostic tool for diagnosis of AFB negative PTB In an attempt to improve on the diagnostic algorithm, the study looked at the clinical presentation of the patients to ... Treatment given Culture +ve (n = 127) Culture -ve (n = 286) Table Sensitivity and specificity of the diagnostic procedure of patients with smear negative TB treatment Disease status Total Culture ... prevent the unnecessary cost of treating individuals who not have TB and at the same time it will prevent the further spread of TB This emphasizes the need of culture and the need of further research...

Ngày tải lên: 15/03/2014, 03:20

6 560 0
Chapter 4   results  discussions design and development of tissue engineering scafflods using rapid prototyping technology

Chapter 4 results discussions design and development of tissue engineering scafflods using rapid prototyping technology

... due to the orientation of water-attracting groups outwards when the substrate is crystallized in contact with water The water contact angle is an indicator of free surface energy and depicts the ... significantly decrease the porosity and ultimately interrupt the interconnectivity of the pores Unlike to the pore width, the FD did not influence the pore height in z direction In addition, the variation ... properties due to change of filament distance can be attributed to the fact that the filament junctions irrespective of material nature, mainly resist 131 Chapter Four: Results and Discussions the...

Ngày tải lên: 14/09/2015, 10:23

106 292 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...

Ngày tải lên: 16/02/2014, 09:20

20 692 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...

Ngày tải lên: 07/03/2014, 16:20

9 485 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

... averaged, and the negative control subtracted The short half-life of 32P necessitated determination of the specific radioactivity of the phosphate at the time of the assay from the Ôtotal radioactivityÕ ... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... phosphorylation of His-cTCRf tyrosine 1N with time of incubation with Lck The levels of fragment (containing tyrosine 1N) detected with and without phosphate, after 0, and 30 of incubation with Lck...

Ngày tải lên: 08/03/2014, 02:20

8 573 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc

Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc

... stimulation was also investigated This was the tyrosine phosphorylation of STAT3/STAT5, monitored through binding of anti-(phospho-tyr-STAT3/STAT5) Ig As Fig 5B shows, stimulation of the Kit225K6 ... orientation of IL-2R subunits seems essential to docking and activation of STATs, we investigated here whether raft integrity is a necessary condition to a proper transduction of cytokine-stimulated ... These antibodies detect nonphosphorylated and phosphorylated Tyr moieties on STAT3/STAT5, respectively, without appreciable cross-reaction with other Tyr-phosphorylated STATs After washing, cells...

Ngày tải lên: 17/03/2014, 23:20

10 500 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

... strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells or, alternatively, with homologous boosting ... Robust, optimal co-stimulation Substantial exposure to antigen Co-stimulation facultative => Yielding high avidity T cells, with excellent memory recall features, restricted migration and refractory ... upon boosting Please note the inverse relationship between functional avidity and the amount of antigen The table (bottom) depicts the major, synergistic features of priming and boosting vectors/regimens,...

Ngày tải lên: 18/06/2014, 16:20

11 513 0
Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

... gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ccc ... K1 through K7 don 't represent the order of the experiments The respective viruses and cell types for each cell culture are indicated in the boxes lane 3) Our results demonstrate that the CEM cells ... indicator of virus production This study, in addition to our previous reports, supports the notion that HCV infects multiple hematopoietic cell types, viz monocytes-macrophages, B-cells, and T- cells...

Ngày tải lên: 18/06/2014, 18:20

8 414 0
Báo cáo y học: " An association between the acute phase response and patterns of antigen induced T cell proliferation in juvenile idiopathic arthritis" ppt

Báo cáo y học: " An association between the acute phase response and patterns of antigen induced T cell proliferation in juvenile idiopathic arthritis" ppt

... total of 10 samples (22% of total samples) from 10 patients did not fit into either of these two patterns In these patients, proliferative responses to both streptolysin O and tetanus toxoid ... streptolysin O and tetanus toxoid were often higher in the PBMCs than in the SFMCs We defined two distinct patterns of proliferation according to the pattern of response to these antigens (Figs and ... recruitment of memory T cells into inflammatory sites [23] It is interesting that the antigens that induced vigorous SFMC proliferation in patients exhibiting a ‘restricted pattern’ were those...

Ngày tải lên: 09/08/2014, 01:23

8 361 0
Báo cáo y học: "T-cell senescence and contraction of T-cell repertoire diversity – catalysts of autoimmunity and chronic inflammation" pdf

Báo cáo y học: "T-cell senescence and contraction of T-cell repertoire diversity – catalysts of autoimmunity and chronic inflammation" pdf

... T -cell compartment, which is the primary contributor to TCR diversity, was affected in addition to the memory T cells Contraction of diversity in the naive T -cell compartment could not be attributed ... Irrespective of the primary defect, these data suggest that patients with RA have a history of increased homeostatic proliferation of naive T cells that predated their disease, The immune system ... replicative history of more than 20 generations In contrast, the telomeric lengths of naive T cells from patients with RA are only slightly longer than those of their own memory cells, and these telomeres...

Ngày tải lên: 09/08/2014, 01:23

10 416 0
Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx

Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx

... of childhood in the World Health Organization classification of tumors of hematopoietic and lymphoid tissues [5] This entity is a rare clonal proliferation of EBV-infected T cells with an activated ... made Our patient was initially treated with two sequential doses of VP16 with moderate improvement of his clinical and laboratory data In particular, the fever transiently improved, hepatosplenomegaly ... genetically determined defects in T cell responses to EBV in certain populations Our review of Western cases showed that four of those 14 patients developed a T cell LPD after CAEBV infection...

Ngày tải lên: 10/08/2014, 23:21

5 379 0
Báo cáo y học: " FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development" ppt

Báo cáo y học: " FoxP3 and Bcl-xL cooperatively promote regulatory T cell persistence and prevention of arthritis development" ppt

... use of Tregs in the treatment of arthritis and their results indicate that adoptive cell transfer of Tregs can be used therapeutically in arthritis, such as CIA [24,32,40,41] A single transfer of ... for the treatment of established autoimmune disease Conclusions The results of the present study demonstrate that FoxP3 and Bcl-xL can cooperatively promote the differentiation and persistence of ... long-term survival of Tregs Adoptive cell transfer of FoxP3 plus Bcl-xL-transduced Tregs prevents the development of collagen-induced arthritis To demonstrate that the gene transduction of FoxP3 and...

Ngày tải lên: 12/08/2014, 12:20

11 236 0
Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

Báo cáo y học: "Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cell" potx

... gift from the National Institutes of Health (NIH) Reagents Repository) and supernatants collected at day 1, and poststimulation In both latently infected CCL19-treated cells and in the ACH2 cell ... was restricted, and to identify activation strategies that induce virus production from these latently infected CD4+ T- cells Our results demonstrated that there was no production of infectious ... infection and restimulation of CCL19-treated resting CD4+ T- cells Resting CD4+ T- cells were cultured for days with CCL19 and infected with NL4.8 and then restimulated with different activation agents...

Ngày tải lên: 13/08/2014, 01:21

31 268 0
Báo cáo y học: "Mechanisms of HIV non-progression; robust and sustained CD4+ T-cell proliferative responses to p24 antigen correlate with control of viraemia and lack of disease progression after long-term transfusion-acquired HIV-1 infection" pdf

Báo cáo y học: "Mechanisms of HIV non-progression; robust and sustained CD4+ T-cell proliferative responses to p24 antigen correlate with control of viraemia and lack of disease progression after long-term transfusion-acquired HIV-1 infection" pdf

... detected at this epitope, it is likely that the decline in the p24-specific proliferative response was the key event that contributed to the failure of CTL to control viraemia, as it is understood ... suggest that effective helper T cell function involves proliferation followed by maturation into both effector and costimulatory cells that provide "help" for other lymphocyte functions Thus, antigen-specific ... patients led to the identification of the Sydney Blood Bank Cohort (SBBC) of long-term survivors [8], and that an attenuated nef-deleted strain of HIV-1, transmitted from a single donor resulted...

Ngày tải lên: 13/08/2014, 05:21

14 254 0
Báo cáo y học: "Association between regulatory T cell activity and sepsis and outcome of severely burned patients: a prospective, observational study" doc

Báo cáo y học: "Association between regulatory T cell activity and sepsis and outcome of severely burned patients: a prospective, observational study" doc

... related to their ability to interact with components of the innate and adaptive immune response, and to their potentiality to be activated nonspecifically by bacterial products and/ or cytokines, ... sepsis and mortality of burned patients • This suggested that Treg might have a potential for suppressing the proliferation and cytokine production of T cells in vivo It also suggested that the ... can contribute to the development of sepsis and outcome of the patients The studies presented here described that the expressions of activation markers of Tregs and cytokines produced by Tregs...

Ngày tải lên: 13/08/2014, 20:21

10 350 0
Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

... with allergic asthma These findings suggest that spleen DCs and Foxp3+Tregs prevents the generation and activation of Th2 effector cells as a novel pathway of regulation of type immunity in asthma ... autologous CD4+ and CD8+ T cells were stimulated with the targeted DCs, the Wang et al Genetic Vaccines and Therapy 2010, 8:2 http://www.gvt-journal.com/content/8/1/2 Page of proliferation and cytokine ... significantly prevented by the vaccination with OVA-Fc-pcDNA3.1 Our pilot study showed that targeted DCs stimulated the proliferation of peripheral CD4+ T and CD8+ T cells in a concentration-dependent...

Ngày tải lên: 14/08/2014, 19:22

8 259 0
Immunodominance and immunoprotection of anti viral specific CD8+ t cell response during HBV infection

Immunodominance and immunoprotection of anti viral specific CD8+ t cell response during HBV infection

... suggestion that the ability of the innate immunity to produce large amounts of IFN-γ or Th1 cytokines might influence the activation of the adaptive immunity and determine the eventual likelihood of ... 54-56 The influence that virus heterogeneity and the distinct HLA-profile of the infected subjects have on the repertoire and hierarchy of T cell responses is difficult to predict The existence of ... present different sets of peptides 68, 69 is another important contributor of the distinct epitopes targeted in HBV patients expressing different HLA-A2 subtypes In addition to the alterations...

Ngày tải lên: 10/09/2015, 08:26

108 337 0
Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx

Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx

... envelopes, to students in their class, with the request that they take them home to be filled out by their parents Surveys were returned to the school with the child, and then returned to the researchers ... school Theme #2: Quality of teaching Some parents mentioned the teaching methods used for SHE and the importance of the quality of teaching They indicated that they want their children to have ... information about how to talk to a child in a way that is age-appropriate and makes the child comfortable The results of this study must be considered in light of its limitations First, although there...

Ngày tải lên: 14/02/2014, 14:20

13 474 0
w