4 proliferation and differentiation of specific t cells

báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells ... putative TAAgs A few studies have concluded that hTERT p540 is not expressed or is cryptic on the surface of tumour cells and that immunization of cancer patients with hTERT p540 leads to the ... in the study were promiscuous Ex Vivo Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination...

Ngày tải lên: 18/06/2014, 15:20

23 439 0
Báo cáo y học: " GDF-15 is abundantly expressed in plexiform lesions in patients with pulmonary arterial hypertension and affects proliferation and apoptosis of pulmonary endothelial cells" ppsx

Báo cáo y học: " GDF-15 is abundantly expressed in plexiform lesions in patients with pulmonary arterial hypertension and affects proliferation and apoptosis of pulmonary endothelial cells" ppsx

... substantial contributions to the analysis and interpretation of the data TW and MMH participated in the design of the study MG critically read and corrected the manuscript All authors read and ... instance, TGF-b1 exerts bi-functional effects on endothelial cells, regarding activation, proliferation and migration At low concentrations TGFb1 has a stimulating effect, whereas higher concentrations ... Kempf T, Horn-Wichmann R, Brabant G, Peter T, Allhoff T, Klein G, et al: Circulating concentrations of growth -differentiation factor 15 in apparently healthy elderly individuals and patients with...

Ngày tải lên: 12/08/2014, 13:22

11 310 0
Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

... autologous CD4+ and CD8+ T cells were stimulated with the targeted DCs, the Wang et al Genetic Vaccines and Therapy 2010, 8:2 http://www.gvt-journal.com/content/8/1/2 Page of proliferation and cytokine ... significantly prevented by the vaccination with OVA-Fc-pcDNA3.1 Our pilot study showed that targeted DCs stimulated the proliferation of peripheral CD4+ T and CD8+ T cells in a concentration-dependent ... asthma These findings suggest that spleen DCs and Foxp3+Tregs prevents the generation and activation of Th2 effector cells as a novel pathway of regulation of type immunity in asthma Competing...

Ngày tải lên: 14/08/2014, 19:22

8 259 0
Augmentation and differentiation of hematopoietic progenitor cells by CD137

Augmentation and differentiation of hematopoietic progenitor cells by CD137

... hematopoietic stem cells (HSC) This breathtaking ability to reconstitute the hematopoietic system makes transplantation of HSPCs after ablative chemotherapy the gold standard of care for treatment of leukaemia ... IL-12p70 and IFN-, and the differentiation to potent Th1 effectors (Lippert et al., 2008) This implies that CD137L signaling induces the maturation, activation and migration of immature DCs The 23 ... peroxidase Hematopoietic stem cells Hematopoietic stem / progenitor cells Immunocytochemistry Interferon Immunohistochemstry Interleukin Induced by lymphocyte activation Intra-peritoneal Institutional...

Ngày tải lên: 11/09/2015, 14:34

210 400 0
Báo cáo y học: " CD39+ Regulatory T cells suppress generation and differentiation of Th17 cells in human malignant pleural effusion via a LAP-dependent mechanism" pps

Báo cáo y học: " CD39+ Regulatory T cells suppress generation and differentiation of Th17 cells in human malignant pleural effusion via a LAP-dependent mechanism" pps

... generation and differentiation of Th17 cells It was quite well documented that various cytokines contribute to the generation and differentiation of Tregs or Th17 cells In the present study, ... negative, indicating that these T cells were Tregs The most important finding in the present study was that CD39+Tregs could be able to inhibit the generation and differentiation of Th17 cells ... (Figure 3), suggesting that these proinflammatory cytokines might affect the generation and differentiation of Tregs or /and Th17 cells in MPE To evaluate the contribution of cytokines to the numbers...

Ngày tải lên: 12/08/2014, 13:22

10 444 0
The role of CD8 t cells in the differentiation of TNF iNOS producing dendritic cells and TH1 responses

The role of CD8 t cells in the differentiation of TNF iNOS producing dendritic cells and TH1 responses

... promote the activation of DCs for anti-tumor effects (Fernandez et al., 1999) and viral immunity (Andrews et al., 2003) Activated NK cells produce TNF-α and IFN-γ that promotes DC maturation and Th1 ... development of Th1 cells (Szabo et al., 2000) T- bet potently activates the transcription of the IFN-γ gene, and its expression is correlated with IFN-γ production by Th1 and NK cells IL-12 and IFN-γ triggers ... suggesting that CD8 T cells were vital for the polarization of Th1 cells This was also supported by studies demonstrating the involvement of CD8 T cells in the generation of protective CD4 Th1...

Ngày tải lên: 09/09/2015, 18:58

279 371 0
Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 4

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 4

... the stem cells proliferation, what it functioned as: did it function as an extracellular mediator to bind with its receptors and promote cells proliferation? Or it penetrated into the cells and ... into the cell culture media, part of it will bind with its receptors on the cell surface and trigger downstream signaling pathways; and part of it will penetrate into the cells and directly act ... their differentiation potentials Due to the limited number of the stem cells, only Alizarin Red S Staining was used to quantify the osteogenic differentiation Cells were first seeded in T2 5 culture...

Ngày tải lên: 11/09/2015, 16:06

31 247 0
Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx

Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx

... 5¢-CTCGAGCTGCTATGGGGCTGAGATCC-3¢ Oligonucleotides used for mutagenesis and EMSAb )151 to )129 5¢-CCCGTCGTGGGCGTGGTCTGGGC-3¢ )151 to )129 5¢-CCCGTCGTGGTATTGGTCTGGGC-3¢ )89 to )64 5¢-CGCGTCTCGGGGGAGTAGTCTGTACC-3¢ )89 to ... the Materials and methods The different mutants are shown on the left, the GC box mutated being indicated by a cross The luciferase activity of the mutant constructs is expressed relative to that ... 2), starting at nucleotides )135, )72, and )45 relative to the start of transcription Examination of GC boxes by in vitro mutagenesis and transfection To define the contribution of these three...

Ngày tải lên: 23/03/2014, 17:21

8 450 0
Báo cáo khoa học: "In vitro neuronal and osteogenic differentiation of mesenchymal stem cells from human umbilical cord blood" ppt

Báo cáo khoa học: "In vitro neuronal and osteogenic differentiation of mesenchymal stem cells from human umbilical cord blood" ppt

... gnirud stsalcoetso dna sCSM eht neewteb dehcated emoceb ot ecnereffid emit eht si ereht esuaceb stsalcoetso morf sCSM eht etalosi ot deirt ew ,sCSM yfirup ot redro ni ,eroferehT )llec tsalcoetso ... )rotpecer nitcenortiv eht( 16/15DC negitna detaler-tsalcoetsO SAP rof evitagen erew yeht tub ,ytivitca PA rof evitisop erew sllec ekil-tsalcoetsO giF worram enob morf devired serutluc dehcirne-tsalboetso ... emit eht taht thguoht saw tI ]72,22[ srotinegorp citeiopotameah rof esac eht sa emas eht ,srotinegorp lamyhcnesem ni hcir eb thgim doolb droc taht tseggus stluser ruo ,srehcraeser rehto yb nwohs...

Ngày tải lên: 07/08/2014, 18:21

6 411 0
Báo cáo y học: "Use of HLA-B27 tetramers to identify low-frequency antigen-specific T cells in Chlamydia-triggered reactive arthritis" docx

Báo cáo y học: "Use of HLA-B27 tetramers to identify low-frequency antigen-specific T cells in Chlamydia-triggered reactive arthritis" docx

... - CD8+ T cells from the synovial fluid of three HLA-B27+ patients with enterobacteria-triggered reactive arthritis (patient nos 10–12), three patients with rheumatoid arthritis (patient nos 13–15) ... CD8+ T cells after antigen-specific stimulation These results show clearly that HLA-B27 tetramers have the advantage of detecting antigen-specific T cells independently of their cytokine-secreting ... monomers bind to streptavidin if added (lanes and 4) (d) Antigen-specific T cells could be detected with both tetramers, although HLA-A2 tetramers stained with greater intensity (log 0.8 more) than HLA-B27...

Ngày tải lên: 09/08/2014, 01:24

14 344 0
Báo cáo y học: "Regulating the immune system: the induction of regulatory T cells in the periphery Jane H Buckner1 and Steven F Ziegler2" pot

Báo cáo y học: "Regulating the immune system: the induction of regulatory T cells in the periphery Jane H Buckner1 and Steven F Ziegler2" pot

... autoreactive cells that escape negative selection must be restrained in the periphery, and it is thought that CD4+CD25+ TR cells generated in the thymus perform that role In addition to regulation ... death, TR cells lead to the induction of T regulator (Tr1) cells and Th3 cells, which feed back to inhibit inflammation, and the TR cells inhibit proliferation of antigen-specific and bystander ... and nerve injury [49] have suggested that the TR responses are specific for selfantigens It is thought that TR cells in mice represent those thymocytes with the highest affinity for self-peptide...

Ngày tải lên: 09/08/2014, 01:24

8 479 0
Báo cáo y học: "Use of soluble MHC class II/peptide multimers to detect antigen-specific T cells in human disease." pps

Báo cáo y học: "Use of soluble MHC class II/peptide multimers to detect antigen-specific T cells in human disease." pps

... CD4+ T cells) However, there was no staining above background in the peripheral blood of these patients or in three additional patients These investigators went on to demonstrate that sorted multimer-positive ... 2001) These studies and others [20] suggest that peptide/MHC class II multimers are capable of detecting the great majority of the T cells that can respond to peptide in vitro new construct in each ... [15,16] The term ‘multimer’ is therefore preferred The extent of multimerization that allows for optimal binding to TCR but maintains specificity is unknown Staining T cells with MHC class II/peptide...

Ngày tải lên: 09/08/2014, 03:24

5 460 0
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc

Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc

... of Treg cells [37] With this in mind, it could be interesting to investigate whether the accumulated Treg cells in patients with arthritis function properly in vivo and whether these patients ... foreign antigen mBSA clearly demonstrates that their suppressive effect is not strictly limited to autoreactive T cells Taking into consideration that Treg cells are also critically involved in the ... http://arthritis-research.com/content/7/2/R291 anti-αEβ7-biotin and streptavidin-PE The stained cells were enriched with anti-FITC and anti-PE MicroBeads, using the AutoMACS separation unit (Miltenyi Biotech) Thereafter, the...

Ngày tải lên: 09/08/2014, 06:22

11 444 0
Báo cáo y học: "Proliferation and differentiation potential of chondrocytes from osteoarthritic patients" ppt

Báo cáo y học: "Proliferation and differentiation potential of chondrocytes from osteoarthritic patients" ppt

... large defects This can be done by delivering the cells to the patient Further, it is of great importance that the scaffold, when implanted into the joint, has the ability to integrate with the surrounding ... seeded with the higher density of cells could indicate that the cells had redifferentiated too far and that the implant would therefore be less integrative In contrast, in the treatment of large ... 106 cells/ cm3), indicating that the cell density is important for the restoration of the chondrogenic phenotype The cell density and redifferentiation could also be important for matrix production,...

Ngày tải lên: 09/08/2014, 06:22

9 417 0
Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx

Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx

... treatment decreases the infiltrate in joints Furthermore, RA patients relapse shortly after withdrawal of anti-TNF-α [19] and thus, despite the dampening of joint inflammation and the reinstatement ... active RA before treatment with anti-TNF-α were unable to suppress proinflammatory cytokine secretion from activated T cells and monocytes After anti-TNF-α treatment the ‘hibernated’ peripheral ... for RA and other autoimmune diseases in the future Competing interests The author(s) declare that they have no competing interests References However, a recent study has proposed that anti-tumour...

Ngày tải lên: 09/08/2014, 06:23

3 337 0
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps

Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps

... study contributes to our understanding of recruitment of T cells to the joint in inflammatory arthritis and suggests that in the microenvironment of the joint, dysregulation of functional patterns ... However, the exact sequence of phenotypic changes in this differentiation pathway, and whether these differ between antiviral cytotoxic T lymphocytes (CTL) and cells in chronic inflammatory situations, ... synovial T cells, and that this can be rapidly released without new protein synthesis on stimulation We have also demonstrated that several of the features of this inflammatory T cell population within...

Ngày tải lên: 09/08/2014, 07:20

11 509 0
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures, and ... with CHO/EGFP cells (C) Representative FACS scatter plots of apoptotic CD3 +T cells 72 h after co-culture with CHO cells transfected with IDO (D) Representative FACS scatter plots of apoptotic ... was used to identify the product of interest (pMD19IDO) Materials and methods To investigate IDO gene integration into CHO cells, total RNA was isolated from CHO cells transfected with pIRES2-EGFP-IDO...

Ngày tải lên: 10/08/2014, 10:21

10 304 0
Báo cáo y học: "Japanese Encephalitis Virus wild strain infection suppresses dendritic cells maturation and function, and causes the expansion of regulatory T cells" doc

Báo cáo y học: "Japanese Encephalitis Virus wild strain infection suppresses dendritic cells maturation and function, and causes the expansion of regulatory T cells" doc

... replication DCs infected with P3 attenuated allostimulatory activities to T cells To test whether P3 infection will impair the ability of DCs to activate allogeneic naïve T cells, the direct effect ... and activate T lymphocytes through up-regulating the expression of costimulatory and antigen presentation-associtated molecules at the mature stage [17] To examine whether the characteristics ... modulating secretion of crucial cytokines, suppressing activation of T cells, and stimulating differentiation of regulatory T cells, which indicates that the functional impairment of viral infected...

Ngày tải lên: 11/08/2014, 21:21

11 252 0
Báo cáo y học: " Early detection of Varicella-Zoster Virus (VZV)-specific T-cells before seroconversion in primary varicella infection: case report" potx

Báo cáo y học: " Early detection of Varicella-Zoster Virus (VZV)-specific T-cells before seroconversion in primary varicella infection: case report" potx

... IFNg+ T- cell titers were highest at day two p.r.o and before the occurrence of seroconversion At this time, titers of up to 1% of total CD4+ T- cells were detected Such elevated CD4+ T- cell titers ... with VZV-IgG titers of 2.2 IU/l and VZV-IgM titers of 1:160 VZV-specific CD4+ T- cells titers decreased to 0.19% when stimulating with VZV lysate, and 0.17% when stimulating with recombinant gE ... VZV-specific T cells JE collected the patient samples MGVP, K-IP and AP participated in the production of recombinant glycoprotein E for the ex vivo T cell stimulation LD provided protocol and reagents...

Ngày tải lên: 12/08/2014, 04:20

3 354 0
Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx

Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx

... Authors’ contributions RTP helped to design the experiments and interpret the data, contributed to the writing of the manuscript, and helped to perform the experiments and generate the datasets ... datasets TML contributed to the interpretation of the datasets and the writing of the manuscript DML oversaw the immunohistochemistry studies along with presentation and interpretation of the immunohistochemistry ... helped to design the experiments and interpret the data and contributed to the writing of the manuscript AC, MM, EAS, QW, OS, CR, and PPH helped to perform the experiments and generate the datasets...

Ngày tải lên: 12/08/2014, 11:23

15 413 0
w