4  requesting data from a web server

... ORDERS_ORDERDETAILS_RELATION = "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet ... [WebMethod] public bool UpdateOrders(DataSet ds) { // Create the DataAdapters for order and order details tables SqlDataAdapter daOrders = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); ... ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.FillSchema(orderDetailTable, SchemaType.Source); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable);...

Ngày tải lên: 24/12/2013, 05:15

... information contained in the parallel data and effectively uses it to pinpoint the location holding more parallel data This approach is based on our observation that parallel pages share similar ... documents Parallel hyperlinks are used to pinpoint new parallel data, and make parallel data mining a recursive process Parallel text chunks are fed into sentence aligner to extract parallel sentences ... 130 Table Quality of Mined Parallel Sentences As we know, the absolute value of mining system recall is hard to estimate because it is impractical to evaluate all the parallel data held by a bilingual...

Ngày tải lên: 08/03/2014, 02:21

... 5(4):557-572 42 Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura Y, Abe T, Inazawa J: Gains, losses, and amplifications of genomic materials in ... Stanford Microarray Database accommodates additional microarray platforms and data formats Nucleic Acids Res 2005, , 33 Database: D580-D582 Parkinson H, Sarkans U, Kolesnikov N, Abeygunawardena ... FISH Oracle uses the MySQL relational database to store its source data In particular, two different kinds of data are stored in two separate databases: genome annotation data (as available in...

Ngày tải lên: 10/08/2014, 09:22

... CultureInfo.CurrentCulture.NativeName; } // Sample data that might come from a database // displayed according to culture set by user dateLabel.Text = DateTime.Now.ToString("D"); shortDateLabel.Text = DateTime.Now.ToString("d"); ... information for a user You can store it persistently on the client in a cookie Or you can store it in a database on the server and store it to a session variable when the client logs in or on an ad-hoc ... System.Globalization namespace contains classes that specify culture-related information These classes are useful in writing globalized applications Within this namespace, the CultureInfo class represents...

Ngày tải lên: 28/10/2013, 18:15

... XML data packet can be any XML document, or a part of a document For example, the XML data packet could contain data from any of the following sources: ! An XML data island at the client ! A stand-alone ... Retrieving data from XML data islands and documents In addition to creating new content from user input, XML data packets can also contain a copy of the existing data held in XML data islands and/or ... from a data source, for example, a catalog of books in a bookstore database The Web server builds an XML document from this data and sends the XML to the client The client builds an XML data packet,...

Ngày tải lên: 10/12/2013, 16:16

... your Web site to a database A site that enables users to search, retrieve, and update data in a database is a data- driven Web site As a result of the enhanced functionality that data- driven Web ... in ASP, in order to create a data- driven Web site Module 1: Displaying Data from a Database Database Architecture Slide Objective To provide an overview of database architecture Lead-in A database ... database from within a FrontPage-based application, you need to connect to a database using the Database Results Wizard Module 1: Displaying Data from a Database Demonstration: Importing a Database...

Ngày tải lên: 11/12/2013, 14:15

... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... { // Create a DataSet of the added, modified, and deleted records DataSet dsDelta = dsSource.GetChanges(DataRowState.Added | DataRowState.Modified | DataRowState.Deleted); if (dsDelta != null)...

Ngày tải lên: 21/01/2014, 11:20

... Typically, when a user gains access to a Web server by using Web folders, that access occurs by using WebDAV Note WebDAV capability is enabled by default Controlling WebDAV access is essentially ... Integrated Windows authentication is also enabled, IIS prompts for appropriate access credentials rather than denying access Run the WhoAmI.asp script again and note any changes in authentication a ... steps Log on as Administrator with a password of password a Log on as Administrator with a password of password Run the batch file Mod5_LabA_setup located at C:\MOC\229 5A\ Labs\Mod 5\Setup a Open Windows...

Ngày tải lên: 24/01/2014, 10:20

... the database Supply IIS with the database name and table name If the database requires a user name and password for access, specify them as well To configure the name of the database and table ... logging: Create a database containing a table with the appropriate fields for the logging data IIS 5.0 includes an SQL template file, which can be run in an SQL database to create a table that accepts ... Graphics Available network bandwidth Web applications CPU time Streaming multimedia Available network bandwidth Database lookups CPU time, memory, hard disk, available network bandwidth To maximize...

Ngày tải lên: 24/01/2014, 10:20

... CONSTRAINT_CATALOG nvarchar(128) Constraint name CONSTRAINT_SCHEMA nvarchar(128) Constraint owner CONSTRAINT_NAME sysname TABLE_CATALOG nvarchar(128) Database name TABLE_SCHEMA nvarchar(128) Table ... current database Table 6-10 REFERENTIAL_CONSTRAINTS information schema view Column name Data type Description CONSTRAINT_CATALOG nvarchar(128) Database name CONSTRAINT_SCHEMA nvarchar(128) Constraint ... System.EventArgs e) { // Create the DataAdapter to retrieve schema information SqlDataAdapter da = null; if (primaryKeyRadioButton.Checked) da = new SqlDataAdapter(GETPRIMARYKEYCONSTRAINTS, ConfigurationSettings.AppSettings["Sql_ConnectString"]);...

Ngày tải lên: 26/01/2014, 10:20

... if(!Page.IsPostBack) { dataList.DataSource = CreateDataSource( ); dataList.DataKeyField = "Id"; dataList.DataBind( ); } } private DataTable CreateDataSource( ) { DataTable dt = new DataTable(TABLENAME); ... UpdateDataSource(DataTable dt) { // Create a DataAdapter for the update SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME + " ORDER BY Id", ConfigurationSettings.AppSettings["DataConnectString"]); ... DataList Web Forms control displays tabular data from a data source and controls the formatting using templates and styles The DataList must be bound to a data source such as a DataReader, DataSet,...

Ngày tải lên: 26/01/2014, 10:20

... DataTable CreateDataSource( ) { DataTable dt = new DataTable( ); // Create a DataAdapter and fill the Orders table with it SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); ... data source such as a DataReader, DataSet, DataTable, or DataView Any class that implements the IEnumerable interface can be bound The easiest way to create a DataGrid control is to drag the DataList ... Update the current page for the data grid dataGrid.CurrentPageIndex = e.NewPageIndex; // Bind the data view to the data grid dataGrid.DataSource = dv; dataGrid.DataBind( ); } private void dataGrid_SortCommand(object...

Ngày tải lên: 26/01/2014, 10:20

... if(!Page.IsPostBack) { dataGrid.DataSource = CreateDataSource( ); dataGrid.DataKeyField = "Id"; dataGrid.DataBind( ); } private DataTable CreateDataSource( ) { DataTable dt = new DataTable(TABLENAME); ... fills a DataTable with the TBL0705 table and stores the DataTable to a Session variable to cache the data source for the DataGrid UpdateDataSource( ) This method creates a DataAdapter and uses ... UpdateDataSource(DataTable dt) { // Create a DataAdapter for the update SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME + " ORDER BY Id", ConfigurationSettings.AppSettings["DataConnectString"]);...

Ngày tải lên: 26/01/2014, 10:20

... unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three-latent class ... Table compares estimates for Se, Spe and prevalence obtained by bivariate analysis with culture and composite reference standard and by the LCA approach Most values are similar, only the prevalence ... standards Both a latent class and a composite reference standard approach suggested that the prevalence of TB in this group of patients was approximately 44%, and thus a relative 16% higher than...

Ngày tải lên: 22/03/2014, 18:20

... Milliken et al (2007) age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and those ... US data are limited in several ways First, although the data relate to the same Iraq deployment, they were collected in different ways The PDHRA data was collected cross-sectionally in 20056 and ... the final response rate was 76% Analysis All statistical analyses were undertaken using the statistical software package STATA (version 10.0) [22] Weighted and unweighted (not shown) prevalence...

Ngày tải lên: 11/08/2014, 17:20

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...

Ngày tải lên: 12/08/2014, 03:20

... raw data sets and takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda ... 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics and degree of remodeling in coronary atherosclerotic ... antioxidant defense in humans against oxidant- and radical-caused aging and cancer: a hypothesis Proc Natl Acad Sci USA 1981, 78:6858-6862 Gagliardi AC, Miname MH, Santos RD: Uric acid: a marker...

Ngày tải lên: 12/08/2014, 15:23

... the data, performing the data analyses and writing the article LS also collected data ISB, LS and HM participated in the planning of the study and discussions during data analyses, read the manuscript ... replaced according to the SF-36 manual [47] When an item was missing on the HADS and IES, missing data were replaced with the patients’ mean value for each subscale Data on categorical variables ... trauma patients who did not require intensive-care treatment • Identify predictors of health-related quality of life after trauma and hospital stay among demographic Page of 12 data, trauma characteristics,...

Ngày tải lên: 13/08/2014, 23:20