21  extract the server and share from a unc path

Báo cáo y học: "The infectivity and pathogenicity of a foot-and-mouth disease virus persistent infection strain from oesophageal-pharyngeal fluid of a Chinese cattle in 2010" potx

Báo cáo y học: "The infectivity and pathogenicity of a foot-and-mouth disease virus persistent infection strain from oesophageal-pharyngeal fluid of a Chinese cattle in 2010" potx

... Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. The infectivity and pathogenicity of a foot-and-mouth ... following the manufacturer’s instructions. RNA was reverse transcribed into cDNA and amplified using one step RT-PCR kit(TaKaRa).Two primers 1D2(5′-GCG CTG GCA AAG ACT TTG A- 3′) and 1D5(5′-GAC ATG ... China Abstract Background Foot-and mouth disease (FMD) is an acute, febrile, and contagious vesicular disease affecting cloven-hoofed animals. Some animals may become persistent infected carriers

Ngày tải lên: 11/08/2014, 21:22

11 324 0
The unique transcriptional response produced by concurrent estrogen and progesterone treatment in breast cancer cells results in upregulation of growth factor pathways and switching from a

The unique transcriptional response produced by concurrent estrogen and progesterone treatment in breast cancer cells results in upregulation of growth factor pathways and switching from a

... dataset and those of Ballare and Graham reveals significant enrichment of a canonical HRE in these sites c Comparison of the reads per peak between sites shared between all 3 data sets and the ... CA), calnexin (CANX, Thermo Scientific, VIC, Australia), and anti-tubulin alpha (TUBA, Millipore, VIC, Australia) and detected as previously described [31] Microarray, RNA extraction and RT-qPCR ... upregulation of growth factor pathways and switching from a Luminal A to a Basal-like subtype Eleanor F Need1*, Luke A Selth2,3, Andrew P Trotta1,4, Damien A Leach1, Lauren Giorgio1, Melissa A O ’Loughlin1

Ngày tải lên: 23/09/2020, 00:12

17 32 0
Kinetics study and influence of water-soluble polymer on the electrodeposition of iron from a citrate-chloride electrolyte on the basis of Fe(III)

Kinetics study and influence of water-soluble polymer on the electrodeposition of iron from a citrate-chloride electrolyte on the basis of Fe(III)

... counterbalance the accelerating action of the electric field and give rise to the plateau in the polarization curve Such argumentation17,18 was used earlier to explain the reasons for appearance of limiting ... phenomena, one should take into account that the HER occurs at the cathode simultaneously with the metal electrodeposition The acceleration of the HER with increasing cathodic polarization leads to an ... concentration on the Fe deposition rate in the potentials range of the current plateau can be associated with the influence of PHMG upon the aggregative stability of the sol formed in the cathode layer

Ngày tải lên: 12/01/2022, 23:37

10 15 0
ROAR! Get heard in the sales and marketing jungle: A business fable

ROAR! Get heard in the sales and marketing jungle: A business fable

... most parts of the city and in many nearby suburbs Ryan was accustomed to their long black coats, long hair and beards, and of course their trademark broad - brimmed black fedoras He had often wondered ... stopped There it was, as effi cient and compel-ling as the plaque itself The whole conversation took less than a minute and she had clearly communicated the entire value proposition in a clear and attractive ... And—it’s a great airplane read.” —Gary Moon Managing Director, Ridgecrest Capital Partners “A fun, easy to read, and brilliant business book I’ve passed along copies of ROAR! for our management team

Ngày tải lên: 07/04/2014, 11:11

225 374 0
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

... Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun Tam for his implementing the hardware interfaces, and Mr Pierre Duez for programming the stimulus ... edited the manuscript All authors read and approved the final version of the manuscript. Acknowledgements This work was supported in part by an Ontario Graduate Scholarship, Natural Sciences and ... designed the perfor-mance tests, performed data collection, analyzed the data, and drafted the manuscript TC conceived the study, advised on the design and coordination of the experiments, and edited

Ngày tải lên: 19/06/2014, 08:20

10 501 0
Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot

Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot

... Kraft (Duisburg, Germany) and J.T. Baker (Deventer, The Netherlands). For chemical analysis, standard stock solutions of the analytes and the internal standards were prepared both in methanol and ... and data evaluation were done on a GC/MSD ChemStation (Agilent, Waldbronn, Germany). The determination of the pharmaceuticals (diclofenac and carbamazepine) in fraction 2 was achieved on a Faber ... http://www.enveurope.com/content/24/1/2 Page 5 of 13 and biological analyses. Therefore, toxicity of total was- tewater (liquid and particulate phases) might be higher than that reported in this paper. Pharmaceuticals and PAHs The

Ngày tải lên: 20/06/2014, 20:20

13 589 0
báo cáo hóa học:" Research Article The Permanence and Extinction of a Discrete Predator-Prey System with Time Delay and Feedback Controls" ppt

báo cáo hóa học:" Research Article The Permanence and Extinction of a Discrete Predator-Prey System with Time Delay and Feedback Controls" ppt

... In the language of control variables, we call the disturbance functions as control variables In 1993, Gopalsamy and Weng 13 introduced a control variable into the delay logistic model and discussed ... the comparison theorem, we have From this, we further have lim sup Trang 6Then, we obtain that for any constant ε > 0, there exists a constant n1> n0such thatAccording to the first equation ... assumptionsH1–H3 and Lemma2.2, we obtain that un is globally asymptotically stable and converges to u∗10n uniformly for n → ∞ Further, from Lemma 2.3, we obtain that, for any given ε1 > 0 and a positive

Ngày tải lên: 21/06/2014, 11:20

20 442 0
Báo cáo y học: "The instantaneous helical axis of the subtalar and talocrural joints: a non-invasive in vivo dynamic study" ppsx

Báo cáo y học: "The instantaneous helical axis of the subtalar and talocrural joints: a non-invasive in vivo dynamic study" ppsx

... appreciate the small translation of the IHA and the small translation along the IHA for both the talocrural and cal- caneal-tibial joints. These small translations indicate that the IHA is excellent ... variability in the subtalar IHA resulted in the calca- neal-tibial joint having a smaller average angular velocity, relative to the talocrural joint: The translation along all IHAs was small and tended ... injuries and quantifying gait abnormalities. The majority of kinematic data available have been acquired through static cadaver work or passive in vivo studies. The applicability of these data to

Ngày tải lên: 10/08/2014, 21:24

10 359 0
Báo cáo y học: " Baseline factors predictive of serious suicidality at follow-up: findings focussing on age and gender from a community-based study" pdf

Báo cáo y học: " Baseline factors predictive of serious suicidality at follow-up: findings focussing on age and gender from a community-based study" pdf

... and a grant from the Australian Rotary Health Research Fund. Associate Profes- sor Kaarin Anstey was supported by National Health and Medical Research Council Fellowship Grant (366756). At the ... Funding was provided by National Health and Medical Research Council Grants 179805 and 79839, a grant from the Alcohol- Related Medical Research Grant Scheme of the Australian Brewers' Foundation ... interests. Authors' contributions All authors have read and approved the final manuscript. AKF-S conceived the study, performed the majority of the statistical analysis and drafted the manu- script.

Ngày tải lên: 11/08/2014, 16:22

10 270 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... Cc_(artichoke)_HCT, hydroxycinnamoyl CoA quinate transferase from Cynara cardunculus var scolymus (AAZ80046); Cc_(cardoon)_HCT, hydroxycinnamoyl CoA quinate transferase from Cynara cardunculus var

Ngày tải lên: 12/08/2014, 03:20

13 652 0
Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx

Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx

... duplication rate in yeast that is two orders of magnitude lower than that estimated by Lynch and Conery [3] Because Gao and Innan used a phylogeny-based method to obtain the data, they claimed that the ... files The following additional data are available with the online version of this paper Additional data file 1 provides the human ALL gene set Additional data file 2 provides the mouse ALL gene ... genes as a function of Ks. Table 1 Parameter estimates for the linear functions (y = mx + b) in Figures 3 and 4 aPearson correlation coefficient TAG, tandemly arrayed gene Trang 5means that in

Ngày tải lên: 14/08/2014, 08:20

11 359 0
Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx

Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx

... Institute for Health and Social Science Research Vandelanotte was supported by a National Health and Medical Research Council of Australia (#519778) and National Heart Foundation of Australia (#PH 07B ... Department of Health and Aged Care (DHAC): National Physical Activity Guidelines for Australians Commonwealth Department of Health and Ageing Canberra: Department of Health and Ageing; 1999 Vandelanotte ... physical and mental health and social capital) As such this study was able to benefit from the trained CATI interviewers and the well-established and reliable protocols of a state-wide study that

Ngày tải lên: 14/08/2014, 08:20

11 428 0
Báo cáo y học: "The validity and reliability of a home environment preschool-age physical activity questionnaire (Pre-PAQ)" potx

Báo cáo y học: "The validity and reliability of a home environment preschool-age physical activity questionnaire (Pre-PAQ)" potx

... middle-aged Australian women [33] and in a general adult Australian population [34] The adult activity questions in PrePAQ were drawn from the AAS and the comparative results between this study and those ... questionnaire and participated in the design of the study JKP assisted with the design of the questionnaire and the study, and advised on the statistical analysis LAB assisted with the design of the ... numbers of participants in the validity and reliability analyses (see Figure 1) The mean accelerometer wearing time was 9.2 hours.day-1 (SD 0.79) Physical activity data from Pre-PAQ and the accelerometer

Ngày tải lên: 14/08/2014, 08:20

13 359 0
Ahn and cheung the intraday patterns of the spread and depth in a market without market makers

Ahn and cheung the intraday patterns of the spread and depth in a market without market makers

... standard errors. The average quoted spread across all stocks, all time intervals, and all days is 12 The increases in spreads and volume around the lunch break are consistent with the W-shaped ... market microstructure Cope- land and Galai, 1983; Glosten and Milgrom, 1985; Easley and O’Hara, 1987; . Foster and Viswanathan, 1990, among others . These models predict that greater information ... respectively. The average dollar quoted spreads across different price levels are about two times larger than the corresponding tick sizes. The average and median percentage Table 4 The average quoted and

Ngày tải lên: 31/10/2014, 10:17

18 247 0
  the horse and jockey from artemision a bronze equestrian monument of the hellenistic period jul 2004

the horse and jockey from artemision a bronze equestrian monument of the hellenistic period jul 2004

... home, and his body was embalmed and carried in a magnificent carriage all the way to Alexandria, where he was buried The death of Alexander the Great marks the traditional beginning of the Hellenistic ... especially thank the Metropolitan Museum of Art for a Theodore Rousseau Memorial Travel Grant to complete the final revisions of the text and a grant from the James Haller and Mary Hyde Ottaway Fund ... Library and the Gennadius Library of the American School of Classical Studies, the Art and Archaeology Library of Bryn Mawr College, the Fine Arts and Widener Libraries of Harvard University, and...

Ngày tải lên: 11/06/2014, 14:28

249 416 0
Báo cáo y học: " Immunoglobulin G galactosylation and sialylation are associated with pregnancy-induced improvement of rheumatoid arthritis and the postpartum flare: results from a large prospective cohort study" pot

Báo cáo y học: " Immunoglobulin G galactosylation and sialylation are associated with pregnancy-induced improvement of rheumatoid arthritis and the postpartum flare: results from a large prospective cohort study" pot

... outer arms of the N-glycan chain (1 Gal on Gal1 and Gal on Gal-2) divided by the total number of available antenna positions for galactosylation on the outer arms of the N-glycan (two available antenna ... access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis FG, MW, MS, AD, MH and RD designed the study FG, MW, MS and YM ... Medical Center Rotterdam, The Netherlands) and Dr C de Groot (Department of Obstetrics and Gynaecology, Medical Center Haaglanden, The Hague, The Netherlands) for their valuable advice This research...

Ngày tải lên: 12/08/2014, 11:22

10 356 0
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database ... the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is reserved ... file back sequentially, then writes 100 Mbytes randomly to the existing file, then reads 100 Mbytes randomly from the file, and finally reads the file sequentially again The bandwidth of each of the...

Ngày tải lên: 12/09/2012, 15:05

15 1,4K 0
the meaning and structure of a narrative a systemic functional analysis

the meaning and structure of a narrative a systemic functional analysis

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis ... further analyzed into Subject and Finite In the textual metafunction, a clause is analyzed into Theme and Rheme 2.4.1 The Ideational Metafunction The ideational metafunction is the means of representing...

Ngày tải lên: 07/09/2013, 13:48

39 827 2
Sockets and Services from a Security Point of View

Sockets and Services from a Security Point of View

... The mail service, on the other hand, is a large, complex piece of software that accepts data (mail) from and returns data to the client, as well as reads and stores data and configuration ... with SPOP These utilities are basically the same except that they perform secure authentication and stream encryption rather than sending passwords and data in the clear If you don't have the option ... reasons: the authentication protocol may be weak, and users tend to use the same account names and passwords across multiple services POP is one example of weak authentication The username and...

Ngày tải lên: 29/09/2013, 13:20

21 590 0
w