2 part of phase 1 your opt in page
Báo cáo khoa học: Retrocyclin RC-101 overcomes cationic mutations on the heptad repeat 2 region of HIV-1 gp41 ppt
... having a direct interaction with RC -10 1 [ 12 , 14 ] The molecular docking program autodock [28 ,29 ] was used to determine the affinity of RC -10 1 for HR1, HR2 and the dimer (HR1 + HR2) Previous docking ... mutations in HIV -1 gp 41 A B The change in free energy upon binding of RC -10 1 to HR2 is consistently higher than the energy of binding to HR1 While charge interaction plays an important role in RC -10 1 ... supported by recent in vitro studies [ 12 , 14 ] RC -10 1 binds to the HR1-binding regions of HR2 Figure 4A shows backbone renderings of five RC -10 1 molecules docked to HR2, representing the five most energetically...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Cloning of type 1 cannabinoid receptor in Rana esculenta reveals differences between genomic sequence and cDNA pot
... 62. 6 76.6 81. 9 74 .2 73 73.4 73 .2 72. 2 72. 6 72. 5 66.6 70.8 12 7 2 1 428 14 07 14 13 1 422 14 13 1 422 14 19 1 422 1 422 14 19 14 19 14 18 12 3 6 1 320 21 .5 70.7 73.9 61. 9 82. 9 88 .1 84.4 82. 2 83.3 83.3 82. 4 82. 4 ... GGCCACGCGTCGACTAGTAC(T) 17 95 94 58 72 72 95 94 50 72 94 45 72 72 95 94 50 72 94 54 72 72 95 94 52 72 94 48 72 72 95 94 62 72 72 alignment of known CNR1 proteins is reported in Fig 1; interestingly, the lowest amino ... (20 05) Anandamide acts as FEBS Journal 27 4 (20 07) 29 09 29 20 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 29 19 Cloning of cnr1 in frog 26 27 28 29 30 31 32 33 34 R Meccariello et al an intracellular...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo hóa học: "Expression of Msx-1 is suppressed in bisphosphonate associated osteonecrosis related jaw tissue-etiopathology considerations respecting jaw developmental biology-related unique features" docx
... Identification of a TAAT-containing motif required for high level expression of the COL1A1 promoter in differentiated osteoblasts of transgenic mice JBiolChem 19 96, 27 1: 16 422 -16 429 24 Marx RE, Sawatari ... remodeling Arch Biochem Biophys 20 08, 473 (2) :13 9-46 20 Groetz KA, Al-Nawas B: Persisting alveolar sockets-a radiologic symptom of BP-ONJ? J Oral Maxillofac Surg 20 06, 64 :15 71- 15 72 21 Lekic P, Rubbino ... treatment of solid tumours and myeloma Curr Pharm Des 16 : 12 7 2- 12 8 3 Wehrhan et al Journal of Translational Medicine 20 10 , 8:96 http://www.translational-medicine.com/content/8 /1/ 96 Page of 32 Lezot...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice" ppt
... Aβx- 42 Aβx-40 Aβx- 42 A 1- total LT(R192G) Aβ40/ 42 A 1 15 dA 1 15 8 .1 ± 1. 8 6.0 ± 1. 8 9.4 ± 1. 6 5.8 ± 1. 9 12 . 3 ± 1. 1 10 .1 ± 3.0 13 .3 ± 1. 9 7.8 ± 2. 5 485.8 ± 12 3 .0 17 8 .1 ± 49.8 3 31. 7 ± 71 .2 224 .1 ± ... 26 5 ± 89 23 8 ± 10 5 14 8 ± 48 45 ± 27 71 ± 47 77 ± 49 75 ± 59 50 ± 48 25 7 ± 13 0 7 42 ± 17 8 21 4 ± 99 23 4 ± 10 3 68 ± 22 86 ± 21 10 6 ± 15 76 ± 21 11 6 ± 35 12 2 ± 30 46 ± 11 66 ± 17 ^ number of mice with ... disease abeta vaccine reduces central nervous system abeta levels in a non-human primate, the Caribbean vervet Am J Pathol 20 04, 16 5 :28 3 -29 7 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 Lemere...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Substitutions in the Reverse Transcriptase and Protease Genes of HIV-1 Subtype B in Untreated Individuals and Patients Treated With Antiretroviral Drugs" potx
... (25 .4) K 219 E (11 .7) E44D (0) K 219 Q (7.8) Q151M (3.9) T 215 F (11 .7) T 215 Y (33.3) RT (NNRTI) (n = 12 ) V108I (25 ) Y181C (33.3) G190S (0) P236L (0) Y188C (0) V106A (0) K103N (9.6) Y188H/L (16 .6) M230L ... 51) D67N (19 .6) K65R (0) A62V (0) V75I (5.9) K70R ( 31. 3) T 215 F (11 .7) V 118 I (25 ) M184V (76.4) G333A (NA) F77L (0) M41L ( 21 .5) Q151M (3.9) L74V (3.9) E44A/D (5.8) T 215 Y (33.3) V75I (0) L 210 W (25 .4) ... G73S (0) V32I (2. 90) I54V (14 .7) M36I (29 .4) I84V (11 .7) M46I (11 .7) PR (n = 34) AG N88D/S (8.8) F 116 Y (1. 9) M41L ( 21 .5) F77G (1. 9) I54L (2. 9) A71T (8.8) G73S (11 .7) V77I (8.8) V82T (5.8) RT...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" Immunological response to highly active antiretroviral therapy following treatment for prevention of mother to child transmission of HIV-1: a study in Côte d’Ivoire" pdf
... Perinatal HIV Prevention Trial Group: Intrapartum exposure to Ekouevi et al Journal of the International AIDS Society 20 10 , 13 :28 http://www.jiasociety.org/content /13 /1 /28 10 11 12 13 Page of ... Maternal 12 - month response to antiretroviral therapy following prevention of mother-to-child transmission of HIV type 1, Ivory Coast, 20 03 -20 06 Clin Infect Dis 20 08, 46(4): 611 - 6 21 Jourdain G, Ngo-Giang-Huong ... mutations in women and infants receiving nevirapine to prevent HIV -1 vertical transmission (HIVNET 0 12 ) AIDS 20 01, 15 (15 ) :19 51- 1957 Pujades-Rodriguez M, O’Brien D, Humblet P, Calmy A: Second-line antiretroviral...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot
... tneicifed -1- niloevaC PM itnasiL ,GP knarF ,MT smailliW ,SG nassaH 711 1 -11 11 , 91 ,10 02 locnO nilC J 7059 lairT puorG ygolocnO 313 yparehT noitaidaR fo stluser :emrofitlum amotsalboilg rof noitaidar lainarc ... ,KJ niJ ,H miK ,T nihS 61 51- 01 ,3 32 ,60 02 tteL recnaC amoleym elpitlum ni tegrat cituepareht wen laitnetop a sa 1- niloevaC CK nosrednA ,K radoP 51 22 45- 914 5 ,3 72 ,89 91 mehC loiB J enarbmem amsalp ... senilediug HIN eht ni dnuof sa ,erac dna esu lamina yrotarobal rof selpicnirp detpecca yllanoitanretni eht htiw ecnadrocca ni detcudnoc saw hcraeser ehT Co 32 ta elcyc krad h - 21 :thgil h - 21 a no deniatniam...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: "The active metabolite of leflunomide, A77 1726, increases the production of IL-1 receptor antagonist in human synovial fibroblasts and articular chondrocytes" ppsx
... Anti-inflammatory effects of leflunomide on cultured synovial 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 macrophages from patients with rheumatoid arthritis Ann Rheum Dis 20 03, 62: 297-3 02 ... Biochem 20 03, 27 0: 12 5 7 12 6 8 Correspondence Pierre-André Guerne, MD, Division of Rheumatology, University Hospital, 26 avenue de Beau-Séjour, 12 1 1 Geneva 14 , Switzerland Tel: + 41 22 38 23 676; fax: + 41 ... enhancing effect of A77 1 726 on IL -1 -induced IL-1Ra production was due to inhibition of COX -2 activity, then the effect of indomethacin on IL-1Ra production should be comparable to that of A77 1 726 ...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo khoa học: " Gastrointestinal toxicity of vorinostat: reanalysis of phase 1 study results with emphasis on dosevolume effects of pelvic radiotherapy" potx
... 36.7 27 7 15 16 31 14 11 400 62 male 11 4 324 21 80 19 400 77 male 15 3 650 19 72 18 3 300 45 female 58 .1 175 21 63 16 400 82 male 75.5 330 29 46 15 1 300 77 85 female female 16 4 60 .1 625 18 0 19 01 12 5 6 2 ... 41 37 22 19 18 15 300 20 0 49 female 89.5 323 12 9 1 43 38 33 25 11 20 0 47 female 19 8 414 24 40 42 37 34 30 14 300 83 female 19 7 549 11 14 41 29 24 19 400 55 male 87.7 867 18 11 34 23 18 16 400 75 ... V18 (%) V24 (%) V30 (%) Vorinostat dose (mg) DLT grade adverse event 87 81 66 female 28 5 648 823 .8 79 74 70 67 40 300 anorexia, fatigue female female 72. 2 17 1 380 483 990.9 22 92 63 45 41 37 22 ...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Prognostic significance of IDH-1 and MGMT in patients with glioblastoma: One step forward, and one step back" pot
... Science 20 08; 3 21 :18 07- 12 21 Watanabe T, Nobusawa S, Kleihues P, Ohgaki H IDH1 mutations are early events in the development of astrocytomas and oligodendrogliomas Am J Pathol 20 09 ;17 4 :11 49-53 22 Yan ... Anti-seizure medication – no (%) yes no 66 ( 41) 94 (59) Sex – number (%) 11 5 ( 72) 45 (28 ) 43 (27 ) 51 ( 32) 66 ( 41) 33 ( 21 ) 90 (56) 37 (23 ) 24 7-98 11 3 ( 71) 47 (29 ) 75 (47) 85 (53) Figure Figure Figure ... diffusely infiltrating gliomas of the WHO grades II and III and in secondary GBM but only in around % of primary GBM (11 ;18 -22 ) In our series we identified in of 14 0 patients (3 %) IDH -1 mutations...
Ngày tải lên: 09/08/2014, 09:21
Báo cáo y học: " Management of HIV-1 associated hepatitis in patients with acquired immunodeficiency syndrome: role of a successful control of viral replication" ppsx
... 20 09 March 20 08 Jan 20 07 March 20 07 Dec 20 06 Jun 20 05 Sep 20 06 Dec 20 04 Aug 20 04 March 20 04 Jun 20 03 Dec 20 03 Jan 20 03 May 20 03 Oct 20 02 Figure Trend of HIV -1 RNA and ALT/AST levels Aminotransferase ... histopathology in the acquired immunodeficiency syndrome Semin Liver Dis 19 92, 12 : 205 - 21 2 Amarapurkar AD, Sangle NA: Histological spectrum of liver in HIV-autopsy study Ann Hepatol 20 05, 4:47- 51 Dinh MH, ... Hepatotoxicity in an HIV-Infected Individual J Infect Dis 20 08, 19 7:9 32- 933 doi :10 .11 86 /17 42- 6405-8-9 Cite this article as: Esposito et al.: Management of HIV -1 associated hepatitis in patients...
Ngày tải lên: 10/08/2014, 05:22
Báo cáo khoa học: " Phylogenetic studies reveal existence of multiple lineages of a single genotype of DENV-1 (genotype III) in India during 1956–2007" pdf
... 20 06 20 06 20 06 20 06 20 06 20 06 20 06 20 07 20 07 EU 626 489 AY59 3 21 1 AY59 3 21 2 AY59 3 21 4 AY59 3 21 5 AY59 3 21 7 AY5845 91 AY584594 EU84 623 2 EU84 623 3 EU 626 490 EU 626 4 91 EF064776 EF064774 EF 222 443 EF 222 444 EU1 811 94 ... 70 318 0 /19 70/delhi India 82 826 8 91/ 19 82/ delhi India 97 1 0 21 /19 97/delhi India 98 14 12 / 19 98/delhi India 01 D1/1CprM/Del 01 India 01 D1/2CprM/Del 01 India 02 GWL14 India 04 GWL19 India 05 del/05 /14 74/D1 ... http://www.virologyj.com/content/6 /1/ 1 Consensus India 01 D1/1CprM/Del 01 India 01 D1/2CprM/Del 01 India 02 GWL14 India 06 07 /1/ del2006 India 06 08 /1/ del2006 India 06 09 /1/ del2006 India 06 10 /1/ del2006 India 06 11 /1/ del2006 India...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "The evolution of HIV-1 reverse transcriptase in route to acquisition of Q151M multi-drug resistance is complex and involves mutations in multiple domains" ppt
... 58 .1 ± 14 .2 0.3 21 8.9 ± 13 .3 10 0.9 37-RT 21 9.7 ± 7.5 25 .8 5 12 0 .9 ± 515 .6 30.4 23 0.9 ± 10 .2 10 6.4 37-Pol 21 7.8 ± 18 .1 25 .6 20 25.3 ± 14 4 .2 12 . 0 23 1. 5 ± 17 .1 106.7 16 8 .1 ± 6.4 77.5 22 8.8 ± 6.7 10 5.5 ... d4T IC50, μM 30 90I 13 8A 18 1I 13 8A 18 1I 22 1Y 17 -RT 62V 69N 75I 18 4V C 31L 13 5T 20 2I D 17 -Cn-Rh 13 8A 18 1I 22 1Y 37-RT 62V 69N 75I 15 1M 18 4V 21 0F 517 I W 4- T R 4- T P 17 ol 17 RT -P 37 ol 37 RT ...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Distinct expression profiles of TGF-β1 signaling mediators in pathogenic SIVmac and non-pathogenic SIVagm infections" pot
... ifn-γ γ γ γ 21 28 13 21 16 21 tnf-α α α α 13 /16 A 13 10 4 10 10 3 10 1 02 8 10 10 t-bet 6 13 /16 10 1 10 -1 * 10 -2 BI 10 -3 10 4 10 3 1 02 10 1 10 -1 10 -2 10 -3 10 4 10 3 1 02 10 1 10 -1 10 -2 10 -3 BI 10 4 BI Relative ... http://www.retrovirology.com/content/3 /1/ 37 smad4 smad3 smad7 10 4 * 10 1 10 -1 21 28 28 16 21 13 1 10 BI BI 28 28 21 21 13 16 10 BI BI 28 28 21 21 13 16 10 10 -3 10 -2 BI 10 4 10 3 1 02 AGM Relative expression 1 02 MAC 10 3 * 10 1 10 -1 10 -2 ... Retrovirology 20 06, 3:37 http://www.retrovirology.com/content/3 /1/ 37 16 21 28 28 BI BI 1 3 28 6 1 3 8 10 10 * 13 /16 21 13 13 13 /16 16 21 21 28 28 BI 3 28 6 AGM MAC il -10 BI 16 21 28 10 10 6 8 BI...
Ngày tải lên: 13/08/2014, 09:20
Investigation of suppressor of overexpression of constans 1 (SOC1) function in flowering time control of arabidopsis thaliana
... thaliana 2. 7 AGL24 and SVP 2. 7 .1 AGL24 22 22 2. 7 .1. 1 AGL24 is an activator of flowering 22 2. 7 .1 .2 AGL24 regulates floral meristem formation 23 2. 7 .2 SVP 24 2. 8 MADS-domain proteins 25 CHAPTER ... (LFY) 2. 2 .2 FLOWERING LOCUS T (FT) 10 2. 2.3 SUPPRESSOR OF CO OVEREXPRESSION (SOC1) 12 2.3 Interaction between floral integrators 12 ii 2. 3 .1 LFY and FT 12 2.3 .2 LFY and SOC1 13 2. 3.3 FT and SOC1 13 ... controlling floral transition in Arabidopsis thaliana 2. 1. 1 Photoperiod pathway 2. 1 .2 Autonomous pathway 2. 1. 3 Vernalization pathway 2. 1. 4 Gibberellin (GA) pathway 2. 2 Floral integrators 2. 2 .1 LEAFY...
Ngày tải lên: 08/11/2015, 17:01
basic part 4 toeic buid skill for rc (quyển 2) bigstep 2 part 7 (phần 1)
Ngày tải lên: 07/06/2017, 16:20
Motion Control Theory Needed In The Implementation Of Practical Robotic Systems 2 Part 1 pot
... 64 Figure 8 .1 A typical autonomous vehicle system 66 Figure 10 .1 The Mexican Hat 71 Figure 10 .2 The Shark Fin 72 Figure 10 .3 A map of obstacles and line segments ... compensator 16 Figure 3.7 Two different points of view of ideal velocity response 18 Figure 3.8 S-curves profiles resulting in the same velocity 19 Figure 3.9 S-curve profiles that reach ... CHAPTER THE STATE OF THE MOTION CONTROL INDUSTRY Velocity Controllers 12 Position Controllers 15 S-curves 17 The No S-curve 21 The Partial S-curve...
Ngày tải lên: 10/08/2014, 05:20
New masters of poster design volume 2 part 1
... N ★ 21 0 01 -25 6 029 27.indd 21 21 029 27_C2.indd Text Job: 029 27 Title: New Master of Poster Design #2 (Rockport) Page : 21 8/ 31/ 11 4:57 PM 9 /24 /11 9:57 AM MARK BROOKS BARCELONA, SPAIN DISINTEGRATING ... Page :24 9 /1/ 11 10:06 AM 8/ 31/ 11 4:58 PM M A R K B R O O K S ★ 25 0 01 -25 6 029 27_C2.indd 25 029 27.indd 25 Text Job: 029 27 Title: New Master of Poster Design #2 (Rockport) Page :25 9 /24 /11 10 :07 PM 8/ 31/ 11 ... 0 01 -25 6 029 27.indd 22 Text Job: 029 27 Title: New Master of Poster Design #2 (Rockport) Page :22 8/ 31/ 11 4:58 PM M A R K B R O O K S ★ 23 0 01 -25 6 029 27.indd 23 Text Job: 029 27 Title: New Master of...
Ngày tải lên: 11/03/2014, 20:23
Báo cáo khoa học: Enzymes of mannitol metabolism in the human pathogenic fungusAspergillus fumigatus– kinetic properties of mannitol-1-phosphate 5-dehydrogenase and mannitol 2-dehydrogenase, and their physiological implications pot
... ± 0 .2 41 ± 14 ± 2 1 NA 300 · 10 )10 · 10 )10 [24 ] 14 .2 ± 0.3 11 ± 1. 3 ± 0 .2 0 .11 ± 0. 02 2.0 ± 0.4 94 ± 40 ± 20 2 1 15 ± NA 1. 4 ± 0.9 20 · 10 )9 · 10 )9 [23 ] a The dimensionless app Keq at pH 7 .1 was ... plots of initial-rate data obtained for AfM1PDH (A, B) and AfM2DH (C, D) at pH 7 .1 and 25 °C FEBS Journal 27 8 (20 11 ) 12 6 4– 12 7 6 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 12 6 7 Enzymes of ... activity of AfM1PDH would not be affected by changes in the levels of ATP, ADP and AMP, suggesting that flux FEBS Journal 27 8 (20 11 ) 12 6 4– 12 7 6 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 12 6 5...
Ngày tải lên: 14/03/2014, 23:20
báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx
... 00 01 11 03 46.8 None PD 00 02 21 01 23 .7 None PD 00 02 21 02 17 .0 ALP NOS increased Amylase increased Lipase increased Liver function tests NOS increased PD 0003– 310 1 54.0 None PD 0003– 31 02 45 .1 Ureteric ... 0004– 410 1 M 40 10 0 + 1 32 M1a Skin IFNα2b No 0004– 41 02 M 36 90 + 333 M1c Lymph nodes, spleen, liver IFNα2b Yes 0004– 410 3 F 54 90 - 94 M1c Skin, liver IFNα2b No 0004– 410 4 M 76 90 - 28 2 M1c Skin, ... HLA-A2 LDH Stage IV Sites of Metastasis Prior Cytokine Therapy Prior Chemotherapy 00 01 11 03 M 49 80 + 16 9 M1b Abdominal wall, thorax IL2 Yes 00 02 21 01 M 30 90 + 13 0 M1b Lung IL2 No 00 02 21 02 F...
Ngày tải lên: 18/06/2014, 15:20