2— developing a maintenance program 2 1— the project maintenance manual

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

... offered a personal day structure program made by the nursing staff in collaboration with the recreational therapist Exercise and music therapy can be part of this day program Psycho-education is also ... after the diagnosis, the day structure program and behavioral management strategy should be incorporated in regular care The psychologist supervises the recreational therapist and nursing staff ... supervising the nursing staff and recreational therapist more intensively in their execution of the day structure program and behavioral management strategy This support takes place in a regular staff...

Ngày tải lên: 11/08/2014, 15:22

7 485 0
Developing a Franchise Business in Vietnam - The case of Pho 24

Developing a Franchise Business in Vietnam - The case of Pho 24

... Indonesia, Malaysia, New Zealand, Pakistan, Sri Lanca and Singapore; and found new legal person: Europcar Asia Pacific This agreement makes Europcar Asia Pacific monopoly business Europcar brand in 20 ... the thesis is given the theoretical basis of the franchise, analyze the reality franchise in Vietnam recent year; Using the tools and knowledge gathered to analyze evaluate, the case of Pho 24 ... implementation plan, although state registrations may delay a company's ability to sell in certain states for another three to four months Altogether, a new franchisor can anticipate that the franchise...

Ngày tải lên: 26/03/2015, 08:43

92 975 2
Dynaform  DF5 9 2 1 die simulation training manual

Dynaform DF5 9 2 1 die simulation training manual

... eta/DYNAFORM Training Manual DATABASE MANIPULATION DATABASE MANIPULATION I Creating an eta/Dynaform Database and Analysis Setup Start eta/DYNAFORM 5.9 .2. 1 For workstation/Linux users, enter the ... following table eta/DYNAFORM Training Manual DIE SIMULATION SETUP Bead ID 10 11 12 13 14 15 16 17 18 19 20 21 22 Percentage 32 32 22 22 35 35 25 25 25 25 25 25 33 33 22 33 22 35 35 33 25 25 Click Exit ... Training Manual DIE SIMULATION SETUP User can change Element Size to 16 After you have entered the variable, press OK, and the program will automatically save the created blank mesh as another...

Ngày tải lên: 22/02/2017, 09:40

39 445 0
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps

Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps

... ዟዥይደዝዳዟደዣየየዬድዤዯዥየደደ̕ 22 5 -22 7 23 1 -23 2 22 5 -23 2 C) 60 Tax1 Transformation (Number) 80 40 Tax300 * Tax1 (23 1 -23 2) * Tax1 (22 5 -22 7) * Tax1 (22 5 -23 2) 100 B) Tax 20 Tax1 Tax1 Tax1 Tax1 Tax300 (22 5 -23 2) (22 5 -22 7) (23 1 -23 2) ... Tax2B ̕̕ዟዥይደዝዳዟደዣየየዬድዤዯዥየደደ̕ ̕̕ዟዥይደዝዳዟደዣየየዬድዤዯዥየደደ ዟዥይደዝዳዟደዣየየዬድዤዯዥየደደ̕ 22 5 -22 7 23 1 -23 2 Tax300 23 1 -23 2 22 5 -22 7 22 5 -23 2 Control Tax1 Tax300 22 5 -22 7 23 1 -23 2 C) 22 5 -23 2 Control Tax1 Tax300 23 1 -23 2 ... 20 09, 6:83 C) 100 * * 80 80 Transformation (Number) 60 40 20 40 20 Tax 22 4 Tax 23 2 Tax Tax 300 Tax2B Tax2B Tax 20 7 Tax300 D) Tax 154 Tax2 32 Tax1 Tax 224 Tax 20 7 Tax207 Tax 184 Tax184 Tax154 Tax1...

Ngày tải lên: 12/08/2014, 23:22

11 548 0
Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' M3-F: 5' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3' M3-R: 5' CGAAGACAACAGCTTCTGCAGTTTCCTTCAAACAAGTAATG 3' 2. 4 Recombinant DNA methods ... mutate the first glutamic acid in each motif to alanine: E13 2A: 5′ GTTCGGCAAAGCATACTTGGAAAACGTTTTGGATATCCC 3′ 5′ GGGATATCCAAAACGTTTTCCAAGTATGCTTTGCCGAAC 3′ E23 0A: 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC ... mutate each of the aspartic acids to alanine in “DXD2 82- 284” motif of CaMnn5p: D28 2A: 5′ CGTCTTGTACTTAGCATCTGACAATTTCCCAACTAG 3′ 5′ CTAGTTGGGAAATTGTCAGATGCTAAGTACAAGACG 3′ D28 4A: 5′ CGTCTTGTACTTAGATTCTGCAAATTTCCCAACTAG...

Ngày tải lên: 16/09/2015, 08:30

124 400 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

... according to the usual criteria [25 ] Acute coronary syndrome, unstable angina and myocardial infarction were defined according to the ACC/AHA criteria [26 ,27 ] Statistical analyses MedCalc™ v 9.6 .2. 0 (MedCalc ... in the analysis of results and writing the manuscript All the authors read and approved the final version Acknowledgements The authors are very grateful to Edita Lukić, Goran Madžarac and Alen ... (MedCalc Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are presented as absolute and relative frequencies, continuous variables as median...

Ngày tải lên: 25/10/2012, 10:02

8 658 1
Gauss đã giải bài toán 1+2+... như thế nào

Gauss đã giải bài toán 1+2+... như thế nào

... không hợp lệ file bị x a (violet.vn/uploads/resources/51/3 423 1//Gaussgiibiton1 %20 2 %20 nhthno.doc) Quay trở http://violet.vn ...

Ngày tải lên: 03/07/2013, 21:51

2 561 0
kiem tra 15  ( a,b,c) u 1-2 lop 12

kiem tra 15 ( a,b,c) u 1-2 lop 12

... To Americans, it is impolite to ask someone about age, and salary A marry B married C marriage D marrying The boys broke the window when they _ football A played B were playing C had played ... To Americans, it is impolite to ask someone about age, and salary A marry B married C marriage D marrying 12 The boys broke the window when they _ football A played B were playing C had ... had played D are playing 13 “No parking” It means: A There is no park here B You can’t go to the park here C You are not allowed to park your car here D You are not allowed parking your car here...

Ngày tải lên: 17/09/2013, 18:10

3 461 0
Developing a Simple Windows Application phần 2

Developing a Simple Windows Application phần 2

... Member accessible only within the class, a derived class, or class in the same program (or assembly) Member accessible only within the class or class in the same program (or assembly) Member accessible ... available outside the class You can also use an access modifier to specify the degree to which the class itself is available Table 6.1 shows the access modifiers in decreasing order of availability: ... Because the myLabel and myButton objects are private, this means that they are accessible only in the Form1 class Access modifiers enable you to specify the degree to which a class member is available...

Ngày tải lên: 20/10/2013, 10:15

7 306 0
LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE -2-1

LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE -2-1

... 'you can see for yourself that the League has a vacancy, and there is the address where you should apply for particulars As far as I can make out, the League was founded by an American millionaire, ... brassy Albert chain, and a square pierced bit of metal dangling down as an ornament A frayed top-hat and a faded brown overcoat with a wrinkled velvet collar lay upon a chair beside him Altogether, ... in the office but a couple of wooden chairs and a deal table, behind which sat a small man with a head that was even redder than mine He said a few words to each candidate as he came up, and then...

Ngày tải lên: 08/11/2013, 02:15

16 532 1
Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

... Tools Data Access Data Storage Security After completing the above steps, you will discuss your responses with the class The instructor will write the class consensus on a flipchart THIS PAGE INTENTIONALLY ... Determining the Impact of Technology on a Windows DNA Design 51 Write your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems ... completing the above steps, you will discuss your responses with the class The instructor will write the class consensus on a flip chart Use the space below for brainstorming Activity 7 .2: Determining...

Ngày tải lên: 21/12/2013, 06:16

4 632 0
Tài liệu Activity 2.1: Reviewing the Process docx

Tài liệu Activity 2.1: Reviewing the Process docx

... use a process advocated by a particular company or resource? If so, what was it? • What were the stages of the process? • What was involved in each stage? • What were the advantages and disadvantages ... to gathering and analyzing information to make an informed decision Reflect on the gathering, analyzing, and presenting process you used in the project Then discuss the answers to the following ... in the past The project does not need to be a software development project if you have never been involved in one You only need to pick a project that involved some activities related to gathering...

Ngày tải lên: 24/01/2014, 10:20

2 206 0
Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt

Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt

... problem What are the known information about this programming assignemnt? There are ten dollars in a quarter roll There are five dollars in a dime roll There are two dollars in a nickel roll And there ... indicates the beginning of the main int dollar, quarterR, dimeR, nickelR, pennyR, remainder; Variables that are used in the main are declared There are six variables of type integer These variable names ... of the program line by line int main() Every program must have a main function A program begins executing with the main function Main returns an integer value to DOS { The left bracket indicates...

Ngày tải lên: 20/02/2014, 08:20

13 358 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... [1 ,25 ] This DNAalkylating reagent binds to the minor groove of doublestranded DNA and then alkylates guanines at position N2 [26 ], favouring guanines flanked by purines [27 29 ] The covalent attachment ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... h and then cut with ClaI (C and D) DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C) The DNA was then electrotransferred...

Ngày tải lên: 20/02/2014, 11:20

10 640 0
Báo cáo "Eliminating on the divergences of the photon self - energy diagram in (2+1) dimensional quantum electrodynamics " pot

Báo cáo "Eliminating on the divergences of the photon self - energy diagram in (2+1) dimensional quantum electrodynamics " pot

... × 3 /2 − p2 )2 (2 ) (ai (22 ) co c1 c2 dxx(1 − x) + 1 /2 + 1 /2 , )1 /2 (ao (a1 ) (a2 ) where a2 = m2 − x(1 − x)k ; a2 = λ1 m2 − x(1 − x)k ; a2 = 2 m2 − x(1 − x)k o 1 2 (23 ) 26 N.S Han, N.N Xuan ... =4ie2 ci i=0 ΠM (k ) = − nf ΠM (k ) = 2ie2 2ie2 m nf i=0 dx d3 p × , − p2 )2 (2 )3 /2 (ai d3 p , × 3 /2 − p2 )2 (2 ) (ai d3 p +2 (2 )3 /2 (a2 − p2 )2 i dx i=0 ci Mi ci x(1 − x)dx dx d3 p P2 3 /2 (2 ) ... =2ie2 µ dx =2ie2 µ dx + dn p n (2 ) 2pµ pν gµν − 2 − a2 )2 (p (p − a2 ) 2x(1 − x)(k gµν − kµ kν ) im µνα k α − − a2 )2 (p (p − a2 )2 (5) 24 N.S Han, N.N Xuan / VNU Journal of Science, Mathematics...

Ngày tải lên: 28/03/2014, 13:20

6 331 0
www.daykemquynhon.ucoz.com Trung tâm bồi dưỡng kiến thức văn hóa cho học sinh cấp 3TRƯỜNG THPT NGÔ SỸ LIÊN TP BẮC GIANG Mã đề thi: 121Đ T I T ỬT Á GL N1 Ề H H HN ẦN M Ọ 2 1 -2 1 Ă H C 01 02 MÔN : HÓA HỌC - 12(Thời gian làm bài 90 phút không kể thời ppt

www.daykemquynhon.ucoz.com Trung tâm bồi dưỡng kiến thức văn hóa cho học sinh cấp 3TRƯỜNG THPT NGÔ SỸ LIÊN TP BẮC GIANG Mã đề thi: 121Đ T I T ỬT Á GL N1 Ề H H HN ẦN M Ọ 2 1 -2 1 Ă H C 01 02 MÔN : HÓA HỌC - 12(Thời gian làm bài 90 phút không kể thời ppt

... kết luận sai là: A B C D Câu 22 Cho nguyên tố có cấu hình electron hạt vi mô sau: X : [Ne] 3s2 3p1 Y2+ : 1s2 2s2 2p6 Z : [Ar] 3d5 4s2 M2-: 1s2 2s2 2p6 3s2 3p6 T2+ : 1s2 2s2 2p6 3s2 3p6 Những nguyên ... gam hỗn hợp hai muối axit 4, 025 gam ancol Khối lượng este có khối lượng phân tử nhỏ có hỗn hợp A A 4, 625 gam B 5,55 gam C 1 ,27 5 gam D 2, 20 gam Câu 42 Cho dung dịch Ba(HCO3 )2 vào dung dịch: CaCl2, ... NaOH 1M Tên gọi este A Etylaxetat propyl fomat B Metylaxetat metylfomat C Butylfomat etyl propyonat D Etyl fomat metyl axetat Câu 21 Có kết luận sau đây: (1) Tất axit cacboxilic không tham gia...

Ngày tải lên: 30/03/2014, 10:20

4 1,4K 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... H92AMY2, T94AMY2, A9 5AMY2, Y130AMY2, A1 45AMY2, F180AMY2, K182AMY2, W206AMY2, S208AMY2, Y211AMY2, H288AMY2, Q294AMY2, M296AMY2 and Q35TAA, H 122 TAA, R204TAA, K209TAA, H210TAA, G234TAA, D340TAA, ... catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 and Y82TAA are at subsite )1 as are H92AMY2 and H 122 TAA; M52AMY2 (M53AMY1) and W83TAA ... dark blue The catalytic acids (see A above) are colored in yellow M52AMY2 (M53AMY1) and W83TAA are in red (indicated by arrow) Y51AMY2 and Y82TAA are in orange Other binding residues (W9AMY2,...

Ngày tải lên: 31/03/2014, 08:20

14 558 0
w