2— design of bearing wall by empirical design method 14 5

Báo cáo khoa học: "Project for production of closed-caption TV programs for the hearing impaired" docx

Báo cáo khoa học: "Project for production of closed-caption TV programs for the hearing impaired" docx

... logarithm of the likelihood which is between zero and one, thus it becomes less than zero Threshold Detection rate -I0 -20 -30 -40 -50 -60 -70 -80 -90 -I00 - 150 -200 - 250 -300 34 .56 44.12 54 .41 60.29 ... 34 .56 44.12 54 .41 60.29 64.71 69.12 69. 85 71.32 78.68 82. 35 91.18 94. 85 95. 59 99.26 (%) False Alarm Rate (FA/KW/Hour) 0 0 0.06 0.06 0.06 0.12 0.18 0.18 0 .54 1.21 1.81 2.41 Table Synchronisation ... key words of the text We tested high-frequency key word method (Luhn 1 957 , Edumundson 1969) and a TF-IDF-based (Text frequency, Inverse Document Frequency) method We evaluated the two methods using...

Ngày tải lên: 08/03/2014, 06:20

5 447 0
Giáo trình thực hành BCMSN   Chương 7 – Planning for Implementation of Voice in a Campus

Giáo trình thực hành BCMSN Chương 7 – Planning for Implementation of Voice in a Campus

... ^CSwitch 2 950 ^C SW2 950 _02 (config)#line console SW2 950 _02 (config-line)# logging synchronous SW2 950 _02 (config-line)# password cisco SW2 950 _02 (config-line)# login SW2 950 _02 (config)#line vty SW2 950 _02 ... ^CSwitch 356 0^C SW 356 0_01 (config)#line console SW 356 0_01 (config-line)# logging synchronous SW 356 0_01 (config-line)# password cisco SW 356 0_01 (config-line)# login SW 356 0_01 (config)#line vty SW 356 0_01 ... hình VLAN SW2 950 _01 SW2 950 _01 (config-vlan)#name VLAN20 SW2 950 _01 (config-vlan)#vlan 40 SW2 950 _01 (config-vlan)#name VLAN40 SW2 950 _01 (config-vlan)#end Cấu hình VLAN SW2 950 _02 SW2 950 _02 (config-vlan)#name...

Ngày tải lên: 08/05/2014, 13:41

12 457 0
The UWA05 method for prediction of axial capacity of driven piles in  sand

The UWA05 method for prediction of axial capacity of driven piles in sand

... UWA- 05 and ICP 05 have the same COV for Qc/Qm) (iii) The COV of 0.19 for Qc/Qm of the UWA- 05 method for open-ended piles in compression is significantly lower than the corresponding COV of 0. 25 of ... X 2005a Evaluation of design methods for displacement piles in sand UWA Report, GEO: 053 41.1 Lehane, B.M., Schneider, J.A., and Xu, X 2005b CPT based design of driven piles in sand for offshore ... 28 UWA- 05 recommendation tan  < 0 .55 26 24 22 20 0.01 0.1 10 Median Grain Size, D50 (mm) Figure cv variation with D50 (modified from ICP- 05 guidelines) PREDICTIVE PERFORMANCE OF UWA- 05 The UWA...

Ngày tải lên: 13/08/2015, 10:37

7 466 1
Numerical study of pile capacity considering installation and negative

Numerical study of pile capacity considering installation and negative

... 153   5. 1 INTRODUCTION 153   5. 2 SOIL CONDITION 154   5. 2.1 Tuas South Ave site 154   5. 2.2 In-Situ Tests 154   5. 2.3 Laboratory Tests 157   ... 1 65 5. 4.1 Test programme 1 65 5. 4.2 Pile installation and instrumentations 1 65 5. 4.3 Static load test 167  5. 5 ANALYSIS OF TEST RESULTS 169  5. 5.1 ... Table 5- 1 Summary of the Pressuremeter Test Results 155   Table 5- 2 Summary of the Laboratory Test Results 158   Table 5- 3 PHC Spun pile Properties 1 65 Table 5- 4 Summary of...

Ngày tải lên: 08/09/2015, 22:17

293 602 0
Guide to system design for control of electrical noise

Guide to system design for control of electrical noise

... Earth Leakage/Ground Fault 5- 1 5- 1 5- 1 5- 2 5- 3 5- 4 5- 4 5- 5 5- 5 5- 5 5- 6 6-1 6-1 6-2 6-3 6-3 6-4 Chapter Objectives ... Suppression 200V pk 5. 5V pk 674mV pk R/C Across coil 100R/0.1uF 5. 5V pk 932mV pk 168mV pk R/C Across switch 100R/0.1uF 2.5V pk 103mV pk 70mV pk Transorb Across coil 14. 9V pk 1.8V pk 658 mV pk Transorb ... Checklist A-1 A-1 A-1 A-2 A -5 A -5 A-6 A-7 A-8 A-8 A-9 A-11 A-11 A-12 A-12 A-13 A -14 A- 15 A- 15 A- 15 A-16 Appendix A Noise Control Supplement Appendix B EMC...

Ngày tải lên: 02/11/2015, 23:24

127 615 0
DESIGN AND CHARACTERISTICS OF a NOVEL COMPLIANT PLANAR SPRING CAPABLE OF a POSITIVE STIFFNESS FOR a COMPACT VIBRATION ISOLATOR THIẾT kế và đặc TÍNH của lò XO PHẲNG mềm mới CHO bộ TÁCH RUNG ĐỘNG

DESIGN AND CHARACTERISTICS OF a NOVEL COMPLIANT PLANAR SPRING CAPABLE OF a POSITIVE STIFFNESS FOR a COMPACT VIBRATION ISOLATOR THIẾT kế và đặc TÍNH của lò XO PHẲNG mềm mới CHO bộ TÁCH RUNG ĐỘNG

... stiffness of the spring is required, the out of plane thickness w of flexure hinge or the in of plane thickness t of flexure hinge must also be changed A new stiffness of the isolator can be found by ... 3-D model of the spring Fig 2b presents a 2-D view of the spring Table shows the dimensions of the spring The proposed spring is designed by combining between the rigid links with the in -of- plane ... coefficient of the damper The dynamic equation of the proposed isolator is derived by combining Eqs (2) and (3) The Lagrange L is formed by taking the difference of the scalar quantities of kinematic...

Ngày tải lên: 08/06/2016, 14:07

8 424 0
Oxford collocations dictionary for students of english  chương 2 7

Oxford collocations dictionary for students of english chương 2 7

... a tale of LA gang life I rape • PREP ina/the-Wewereinthesamegang I-ofagang of skin heads • PHRASES a member of a gang game noun group of friends • PREP - of Youprobably go with a gang offriends ... glimpse of the other side of Adam Burns • PREP - at The exhibition offers afascinating glimpse at life beneath the waves - into Take a glimpse into thefuture of rail travel -of She got a glimpse of ... last government a change of government It is time we had a change of government the government of the day This was a decision taken by the government of the day a member of a government The prime...

Ngày tải lên: 19/08/2013, 09:54

23 871 1
English for students of Physics_Unit 7

English for students of Physics_Unit 7

... pull of the earth on all objects holds them to the surface of the earth Without it, the spin of the earth would send them floating off into space The gravitational attraction of every bit of matter ... substances independently of their volumes 12 The density of a mixture of two liquids usually depends on the ratio in which they are mixed The same is true for the density of a solution of a solid in a ... is an example of a pair of equal and opposite forces, as required by Newton’s third law of motion) The Earth pulls on you with a force (your weight) directed towards the center of the Earth;...

Ngày tải lên: 17/10/2013, 16:15

14 713 1
iec 60364-7-707 electrical installations of buildings - requirements for special installations or

iec 60364-7-707 electrical installations of buildings - requirements for special installations or

... 1984 707 .54 5.2.2 T I - 15 - Other special methods In extreme cases, if the safety requirements of Sub-clause 707 .54 5.2.1 are fulfilled but electrical noise on the main earthing terminal of the ... function of external influences Section 482: Protection against fire 364 -5- 51 (1979) Part 5: Selection and erection of electrical equip ment Chapter 51 : Common rules Amendment KO.I (1982) 364 -5- 523 ... (1983) Part 5: Selection and erection of electrical equip ment Chapter 52 : Wiring systems Section 52 3 Current-carrying capacitors 364 -5- 537 (1981) Part 5: Selection and erection of electrical...

Ngày tải lên: 25/12/2013, 11:05

23 296 4
Tài liệu Module 7: Creating a Security Design for Accounts pdf

Tài liệu Module 7: Creating a Security Design for Accounts pdf

... $2,000 By reducing the number of compromises by 1 .5, this option would save the company $13,000 annually ($ 15, 000 - $2,000 = $13,000) Option costs $10,000 By reducing the number of compromises by ... $30,000 By reducing the number of compromises by 3 .5, this option only saves the company $5, 000 annually ($ 35, 000 - $30,000 = $5, 000) What are some other considerations when choosing one or more of ... number of compromised passwords by 3 .5 8 Module 7: Creating a Security Design for Accounts Questions What is the annual loss expectancy (ALE) of the threat? $10,000 x = $50 ,000 Subtract the cost of...

Ngày tải lên: 18/01/2014, 05:20

30 353 0
Overview of the Capital Markets in Vietnam
and Directions for Development

Overview of the Capital Markets in Vietnam and Directions for Development

... 75 70 Yr 13 80 75 - Yr 14 80 75 - n.a n.a n.a n.a n.a 60 57 57 56 55 56 54 52 - - - - 60 Yr 65 40 45 50 61 Yr 70 50 50 55 61 Yr 75 55 55 60 62 Yr 75 60 60 70 Yr 75 70 60 70 62 61 Yr 80 75 65 ... 70 75 75 75 80 80 80 80 80 25 30 40 50 55 60 70 75 80 80 80 80 80 80 30 40 45 50 55 60 60 65 65 65 70 75 75 75 5 25 40 50 55 60 70 70 70 70 70 70 70 Source: EBRD Table 6: Sector Share of GDP by ... 4,000 304 5. 5 1,271,000 993 8.3 172,971 817 3.7 3,972,4 85 31,181 -0.4 54 6,713 11,476 7.0 1,719 311 5. 0 95, 164 3,9 15 4.2 n.a n.a n.a 77, 954 9 75 4.4 88,2 75 21,200 3.3 126,770 2, 058 5. 3 35, 058 436...

Ngày tải lên: 21/01/2014, 12:59

71 580 0
Tài liệu Reporting Corrections of Errors and Changes in Accounting Principles - Amending SFFAS No. 7, Accounting for Revenue and Other Financing Sources pdf

Tài liệu Reporting Corrections of Errors and Changes in Accounting Principles - Amending SFFAS No. 7, Accounting for Revenue and Other Financing Sources pdf

... Street NW Suite 6 814 Mailstop 6K17V Washington, DC 2 054 8 Telephone (202) 51 2-7 350 FAX (202) 51 2-7366 FASAB FASAB Federal Accounting Standards Advisory Board U.S General Accounting Office 441 G Street, ... Accounting Standards Advisory Board 441 G Street, NW, Suite 6 814 Mailstop 6K17V Washington, DC 2 054 8 Telephone (202) 51 2-7 350 Fax (202) 51 2-7366 www.financenet.gov/fasab.htm EXECUTIVE SUMMARY EXECUTIVE ... addressed in paragraph 76 of SFFAS No Board Approval 25 This statement was approved by unanimous vote of the Board Federal Accounting Standards Advisory Board Reporting Corrections of Errors and Changes...

Ngày tải lên: 17/02/2014, 10:20

14 521 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

... cluster 2 ) 15. 7 ) 15. 5 ) 15. 2 )13.2 ) 15. 5 )14. 9 1 Table Amino acid residues forming hydrogen bonds in the cER–CD58 – interface The residues in the turn region of peptide cER and in CD58 which are ... (sc) of 0. 25, 0. 35, 0. 45, 0 .55 and 0. 65 ns were performed with coupling constants calculated from starting model and observed 3JHNa The correlation time was expected to be in the range 0. 25 0. 65 ... coordinates of ligated hCD58 were retrieved from the Protein Data Bank (accession code 1qa9; the monomer of hCD58 was unmerged from the complex of hCD2–hCD58) [30] Ó FEBS 2004 Design of peptides...

Ngày tải lên: 19/02/2014, 13:20

14 660 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... two isoforms of human Hsp90 was strengthened by heat shock (Fig 5A) The stronger interaction of ERK5 with Hsp90b, relative to Hsp90a, was then confirmed through an analysis of extracts of PP30[hHsp90a]slt2D ... gifts of strains, plasmids and antisera This work was supported by grants from the Wellcome Trust (07 457 5 ⁄ Z ⁄ 04 ⁄ Z), BBSRC (C506721 ⁄ 1), the EU 6th Framework program (FP 650 6 850 , FP 651 8230), ... Stimulation of the weak ATPase activity of human Hsp90 by a client protein J Mol Biol 3 15, 787–798 Owen BA, Sullivan WP, Felts SJ & Toft DO (2002) Regulation of heat shock protein 90 ATPase activity by...

Ngày tải lên: 23/03/2014, 07:20

11 428 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... ATGTGGCTGCATGGGACGTG TCTGCAGGGTCACGGAGATG Exon Exon Exon Exon 257 P563 P564 Human genes FDX1 Primers P581 P582 P583 P584 P5 85 P586 AAATTGGCGACTCTCTGCTAG CTTGCTCATGTCAACAGACTG CTTGGAGTCATCCCCAACAC ... 271) Table Primer sequences Gene FDXR Primer sequences Primer location Amplified band (bp) P 553 P 554 P 557 P 558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG ... P 450 scc in the skin (Eur J Biochem 271) 4183 Fig 1H-NMR (50 0 MHz) spectrum of the product of P 450 scc-mediated side-chain cleavage of 7-DHC (A) Spectrum of the enzymatic side-chain cleavage of...

Ngày tải lên: 23/03/2014, 13:20

11 478 0
API - 2510A - Fire-Protection Considerations for the Design and Operation of Liquefied Petroleum Gas (LPG) Storage Facilities

API - 2510A - Fire-Protection Considerations for the Design and Operation of Liquefied Petroleum Gas (LPG) Storage Facilities

... Introduction 20 5. 2 Water-Application Rates 20 5. 3 Methods of Water Application 22 5. 4 Design Considerations for Water Supply 23 5. 5 Detection Systems ... see 3 .5. 5 in API Standard 251 0 h The extent of vaporization can be reduced by judicious arrangement of drainage paths, including the use of shallow ditches or trenches when applicable, and by the ... storage at pressures below 15 pounds per square inch gauge d Installations covered by API Standard 250 8 e Installations covered by NFPA Standards 58 or 59 f Department of Transportation (DOT) containers...

Ngày tải lên: 27/03/2014, 14:07

44 2,8K 0
Design for aesthetics: interactions of design variables and aesthetic properties pdf

Design for aesthetics: interactions of design variables and aesthetic properties pdf

... size and spacing of features • degree of symmetry of arrangements of objects about centre of mass, major axes and planes of references of the whole product • relative spacings of objects relative ... • • • ratio of major linear dimensions of object features ratio of areas ratio of volumes major orientation smoothness of curvature convexity of shape global shape characteristics of smallest ... computer supported design for aesthetics in a number of ways By manipulating the identified design variables in terms of shape, composition and physical properties of a a given designed product,...

Ngày tải lên: 30/03/2014, 16:20

8 410 0
w