... frequency of 40 MHz, a fairly standard charge pump and PFD configuration with gain Kphase of 750 A/ 2π, a multimodulus divider programmable between 64 and 127, and an LC-based VCO with a KVCO of approximately ... University of Central Florida under a Motorola Research Grant on SAW device package electrical characterization and oscillator design From 1991 to 1995, he was a Staff and Lead Oscillator Design ... photograph of the synthesizer Figure 9: Comparison of measured and simulated phase noise for the 4.1–4.3 GHz band The square dots are the simulated data −60 Table 2: Comparison of measured and simulated...
Ngày tải lên: 22/06/2014, 22:20
... Accepted) Surajit Saha‡, Orhan Kahya‡, Manu Jaiswal, Amar Srivastava, Anil Annadi, Jayakumar Balakrishnan, Alexandre Pachoud, Chee-Tat Toh, Byung-Hee Hong, Jong-Hyun Ahn, T Venkatesan, and Barbaros Özyilmaz, ... films of VO2 (A) and VO2(B).” (Manuscript in preparation) 14 A, Rana, T Sarkar, S Saha, X Hai, M Motapothula, A Srivastava, K Gopinadhan, B Kumar, A Ariando, L Ping and T Venkatesan, “Surface midgap ... thank Banabir Pal, Kalon Gopinadhan, Sinu Mathew, Xiao Wang , Mallikarjunarao Motapothula, Lv Weiming, Huang Zhen, Anil Annadi, Zeng Shengwei, Liu Zhiqi, Michal Dykas, Yong Liang Zhao, Tarapada...
Ngày tải lên: 09/09/2015, 08:13
Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2
... Special thanks goes out to Sai Mun and Souvik for always giving me timely assistance and advice in so many areas of research Also to Shruthi, who has been of great assistance for databasing, and analysis ... Tan CL, Reginald K, Chew FT (2006) Genomic organization and characterization of group allergen paralogs from Dermatophagoides farinae In: The 63th American Academy of Allergy and Immunology Annual ... PCR with μg of genomic D farinae DNA using primers Df2F_3 (5’-ATGATTTCCAAAATCTTGTGC-3’) and Df2R_3 (5’-TTAATCACGCATTTTAGCGTG-3’) for Der f and DF975_MET (5’ATGAACCGATTCCTCATTGTT-3’) and EcoR1Df975R...
Ngày tải lên: 15/09/2015, 17:09
Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant
... GTTCGGCAAAGCATACTTGGAAAACGTTTTGGATATCCC 3′ 5′ GGGATATCCAAAACGTTTTCCAAGTATGCTTTGCCGAAC 3′ E23 0A: 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG ... CATTACTTGTTTGAAGGAATATTTAGAAGCTGTTGTC 3' M1-R: 5' GACAACAGCTTCTAAATATTCCTTCAAACAAGTAATG 3' M2-F: 5' CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' ... of CaMnn5p: D28 2A: 5′ CGTCTTGTACTTAGCATCTGACAATTTCCCAACTAG 3′ 5′ CTAGTTGGGAAATTGTCAGATGCTAAGTACAAGACG 3′ D28 4A: 5′ CGTCTTGTACTTAGATTCTGCAAATTTCCCAACTAG 3′ 5′ CTAGTTGGGAAATTTGCAGAATCTAAGTACAAGACG...
Ngày tải lên: 16/09/2015, 08:30
Volume 2 wind energy 2 13 – design and implementation of a wind power project
... rate The economic result, that is, the annual profit is calculated in this way [4]: Pa ¼ Ia −Ca −OMa where Pa is annual profit, Ia is annual income, Ca is annual cost of capital, OMa is annual ... meteorological data are available in a database, as well as wind turbine models This wind atlas software then calculates the estimated production of the wind turbines and park efficiency, and there are even ... visual impact It is also possible to create wind resource maps with some of these programs In complex terrain and where available data are unreliable (in mountain areas, large lakes, and at sea),...
Ngày tải lên: 30/12/2017, 14:20
The Design and Implementation of a Log-Structured File System
... have been primarily in the areas of cost and capacity rather than performance There are two components of disk performance: transfer bandwidth and access time Although both of these factors are ... simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator was allowed to run until the write cost stabilized and all coldstart variance ... separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system can...
Ngày tải lên: 12/09/2012, 15:05
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"
... Clinically significant oroantral communications a study of incidence and site Int J Oral Maxillofac Surg 1994;23:19-21 Haas R, Watzak G, Baron M, Tepper G, Mailath G, Watzek G A preliminary study of ... and clavulanic acid g The fixed partial prosthesis was removed and the contiguous mucosa appeared healthy A buccal full thickness flap was harvested and the presence of a small OAF was verified ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic...
Ngày tải lên: 25/10/2012, 11:48
Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester
... degrees, the peak rate of heat release is at 357 degree crank angle and on retarding by and degrees, the peak heat release rate is found at 362 and 363 degrees against 361 degree with standard timing ... development of biofuel, Planning commission, Government of India, 2003 S Jindal, B.P Nandwana, N.S Rathore Comparative evaluation of combustion, performance and emissions of Jatropha methyl ester and Karanj ... hydrocarbon (HC) and oxides of nitrogen (NOx) with exhaust gas opacity The software enables evaluation of performance from the acquired data using standard relationships The BTHE is evaluated...
Ngày tải lên: 05/09/2013, 16:11
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with use of...
Ngày tải lên: 05/09/2013, 16:30
the meaning and structure of a narrative a systemic functional analysis
... the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... the meaning and structure of “Torquay? But I said Turkey!” as a text The analysis is based on the framework of Halliday’s (1994)An Introduction to Functional Grammar, Halliday and 21 Hasan’s (1997) ... written channel - High lexical density and parataxis and low grammatical intricacy CHAPTER IV: CONCLUSION 4.1 Recapitulation The writing of “The meaning and structure of a narrative: a systemic...
Ngày tải lên: 07/09/2013, 13:48
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch
... exit, and turn all the devices off Then remove and store the cables and adapter 3-4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6.2.9 Copyright 2003, Cisco Systems, Inc Erasing ... hostname, access, and command mode passwords, as well as the management LAN settings These values are shown in the chart If problems occur while performing this configuration, refer to the Basic ... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such...
Ngày tải lên: 16/10/2013, 21:15
Design and Implementation of a Three-Phase Induction Motor Control Scheme
... advantages are clearly explained Wildi also presents the two types of induction motors: “the squirrel cage induction motor” and the “wound motor” An explanation of the advantages and disadvantages ... Therefore, data acquisition, debugging and fault logging are realized ì fast A/ D (Analogue to Digital) converters with 10-bit resolution make the computation of accurate, real-time phase current measurements ... to generate a means of instantaneously controlling the torque and flux Field-orientated controllers require control of both magnitude and phase of the AC quantities and are, therefore, also referred...
Ngày tải lên: 27/10/2013, 23:15
Design and Simulation of A CMOS-MEMS Accelerometer
... on a probe station Table lists major parameters of the device Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a ... total sensing capacitance of 60fF Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4 The capacitance ratios are derived from the ratios of driving ... capacitors, Cd is about an order of magnitude larger than Cd_air, so approximately the total gap capacitance is equal to the sum of Cm_air and Cd_air, which is close to the gap capacitance of...
Ngày tải lên: 27/10/2013, 23:15
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx
... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...
Ngày tải lên: 21/12/2013, 19:15
Design, fabrication, and characterization of a solenoidsystem to generate magnetic field for an ECR proton source
... analysis of Langmuir probe characterization for ECR plasma Indian J Phys 80: 1011–1015 Jain S K, Jain A, Hannurkar P R, Kotaiah S 2007 Characterization of plasma parameter, first beam results, and ... solutions and precision measurements Nucl Instr Meth Phys Res A2 98: 13–21 Bhawalkar D D, Bhujle A G, Fatnani P, Hannurkar P R, Joshi S C, Karmarkar M G, Kotaiah S, Mhaskar S P, Pande S A, Prabhu S ... development at CEA/Saclay Rev Sci Instrum 75(5): 1414–1416 http://laacg1.lanl.gov Poisson code, Reference manual, LA-UR-87-126, LANL 1987 Jain S K, Jain A, Sharma D, Hannurkar P R 2006 Acquisition and analysis...
Ngày tải lên: 22/12/2013, 08:58
Tài liệu Controlling the Playback Speed and Direction of a Timeline docx
... that the user can employ to navigate this timeline forward and backward Return to the main timeline With the Actions panel open, select Frame of the Actions layer and add the following script at ... the statement is executed, the function has been passed a value of "ff" or "rew" This part of the conditional statement has a nested if/else statement Because the task of fast-forwarding and rewinding ... lines of script within the else part of the statement handle this common functionality in either case Following that, the value of action is further evaluated If action has a value of "ff", an onEnterFrame...
Ngày tải lên: 24/12/2013, 07:17
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc
... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... between Chicago and Amsterdam TCP Throughput (Mbps) 80 70 60 50 40 30 20 Number of UDT flows 10 Stability • Stability index of UDT and TCP – Stability: average standard deviation of throughout ... TCP flows and UDT flows between SARA and StarLight Realtime snapshot of the throughput The UDT flows have similar performance and leave enough space for TCP flows TCP Friendliness • Impact on short...
Ngày tải lên: 15/01/2014, 15:59