2  getting basic geolocation data with a fallback

... Probability Decrease at the Disambiguating Region A total of 30 pairs of a garden-path sentence and its ambiguous, non-garden-path control were tested for a comparison of the probability decrease ... the main-verb interpretation for the ambiguous -ed form, and later it makes a repair when the ambiguity is resolved as a past-participle The RR ambiguity is often categorized as a syntactic ambiguity, ... of data used and the interpretation of the model for human Conclusion Our studies show that, at least for the sample of test materials that we culled from the standard literature, a statistical...

Ngày tải lên: 17/03/2014, 04:20

... by a model with s (m-1) parameters However, a parsimonious model is desired Data The data are represent individuals organized or = The data in the contingency table can be represented symbolically ... that candidates for selection are sampled from a distribution with known first and second moments, a priori Theoretical problems arising when linear models are applied to categorical data (G are ... (H although in most instances , 1982) VEY R A scores other than integers may be preferable (S 1964) , NELL Additional complications arise in scaling categorical data in animal breeding The and...

Ngày tải lên: 09/08/2014, 22:23

... appropriate for survival data Zhang and Sun (2010b) gives the latest review of statistical analysis for interval censored data In general, the theoretical justification for interval censored data analysis ... usual univariate failure time data, which could be analyzed with a generalized linear model Since the observations in the resampled data are independent, we may take the average of all resampled-based ... expression with their sample estimates which may cause significant inaccuracies Therefore, it is desirable to have a practical computation approach to approximate the asymptotic variance A common practice...

Ngày tải lên: 10/09/2015, 09:32

... sequentially read data from a data source  The return results of Command SQL statements (no constructor)  How to use DataReader with data providers?  How to retrieving data using a DataReader? ... between a null reference and a null database value  If the column value is equal to DBNull.Value, it represents a null database field  If you want to add a null value to a table in database, use ... if DataReader is closed  Close():  Closes the DataReader  This allows you to use the Connection for another task Slide Get data from DataReader object  Using DataReader to retrieve data from...

Ngày tải lên: 13/05/2014, 12:19

... colour, spiral grain, multiseriate wood rays) on both standard small-size samples and industrial-size boards Our data have a hierarchical organization Each level of the hierarchy could be a level ... climates: north of Alsace (sandstone hills and sandy-loamy soils in the plain), Plateau lorrain, Val de Loire, Basse-Normandie, Allier-Bourbonnais (Center of France) In each region, a large range ... modeling the variability of Sessile oak growth, morphology and wood quality, based on appropriate sampling plans and use of available statistical methods (mixed models) This programme associated the...

Ngày tải lên: 08/08/2014, 14:20

... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... C-fibres Acta Anaesthesiol Scand 1990; 34: 335-8 69 Pasqualucci A, Varrassi G, Braschi A, et al Epidural local anesthetic plus corticosteroid for the treatment of cervical brachial radicular pain: ... 20: 539-45 Schwarzer AC, Wang SC, Bogduk N, et al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain Ann Rheum Dis...

Ngày tải lên: 26/10/2012, 09:07

... serial interface Serial on router GAD a From the global configuration mode, configure interface Serial on router GAD Refer to the interface chart GAD(config)#interface serial GAD(config-if)#ip address ... the Windows taskbar, locate the HyperTerminal program: Start > Programs > Accessories > Communications > HyperTerminal - 10 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 1.2.3 Copyright ... subnet mask, and default gateway a Host connected to router GAD IP Address: Subnet mask: 255.255.0.0 Default gateway: - 10 172.16.0.2 172.16.0.1 CCNA 3: Switching Basics and Intermediate Routing...

Ngày tải lên: 21/12/2013, 19:15

... M+0#!7&%'7)0-!)%!&079(.0!)+0!+%'0!7(308!.9* .A! >%5! f5! G#!)+0!6%%9,!'0#/8!.9* .A! M01!J0))*#3,8!,090.)!)+0!L()(1(,0!)(18!)+0#! ,090.)!0(.+!=%##0.)*%#!(#-!.9* .A! S0&*$;8!(#-!)+0#!.9* .A! GZ5! H%&!*#,)&/.)*%#,!%#!*'7%&)*#3!>0)4% &A" #.5'-18!&0$0&!)%!0?0&.*,0!^!%$!O(1! ... I&0

Ngày tải lên: 21/12/2013, 19:15

... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... { // Create a DataSet of the added, modified, and deleted records DataSet dsDelta = dsSource.GetChanges(DataRowState.Added | DataRowState.Modified | DataRowState.Deleted); if (dsDelta != null) ... DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared and...

Ngày tải lên: 21/01/2014, 11:20

... Basic XUL Concepts You have already seen many of XUL's basic features at work When you load the example in the previous example, the browser identifies it as a XUL file, parses the data, creates ... tabbed indentations where you can avoid them), and XUL widgets you are familiar with 2.2.3 The XUL Namespace Like other markup vocabularies, XUL uses a namespace declaration to define the particular ... as ChatZilla and JSLib, as examples of how some people have already started using Mozilla's XPFE technologies Along with these applications, you'll note the use of the name "xFly" in many examples...

Ngày tải lên: 26/01/2014, 07:20

... features a label widget and an image, both situated within a vbox that lays them out properly in the available space These widgets make up the chrome of your application, the Mozilla user interface ... services and features that already exist in Mozilla They can also help you organize your own work into reusable parts, such as application stylesheets, widgets, and script libraries, as described later ... stylesheet, and a script file, for example The rest of this chapter explains how to organize and package the code in Example 2-4 and launch it as a standalone window by using the -chrome option when launching...

Ngày tải lên: 26/01/2014, 07:20

... together can be the basis for your own application development A package is a group of directories and related files that make up a Mozilla application A small, typical package may include a single ... that sits within the package and interacts with Mozilla's chrome directory RDF files are XML files that describe data in a machine-readable form Each xFly package subdirectory needs its own manifest ... general, to make your package registerable, create manifests that describe your package in terms that Mozilla can understand Although it's customary to make registration a part of the installation process...

Ngày tải lên: 26/01/2014, 07:20

... ratio obtained at h (data not shown) At 30 the basolateral ⁄ apical uptake ratio was 9.1 ± 3.7 and 5.2 ± 0.3 for 5-dayand 15-day-differentiated cells, respectively At 24 h the basolateral ⁄ apical ... dose and route of supplementation Data from a meta-analysis suggested that glutamine supplementation in critically ill patients may be associated with a decrease in complications and mortality rate, ... SCGIHETTFNSIMKCDVDIRKDLYANTVLSGGTTMYPGIADRMQK EITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWISK Q EYDESGPSIVHR KCF B ADNFSLHDALSGSGNPNPQGWPGAWGNQPAGAGGYPGASYPGAYP GQAPPGAYPGQAPPGAYHGAPGAYPGAPAPGVYPGPPSGPGAYPS SGQPSAPGAYPATGPYGAPAGPLIVPYNLPLPGGVVPR...

Ngày tải lên: 20/02/2014, 01:20

... Glycosaminoglycan kass (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases, ... Conard J, Brosstad F, Lie Larsen M, Samama M & Abildgaard U (1983) Molar antithrombin concentration in normal human plasma Haemostasis 13, 363– 368 Skinner R, Abrahams JP, Whisstock JC, Lesk AM,...

Ngày tải lên: 20/02/2014, 02:21

... SQL Maintain data DataSet Get data Command Object Maintain data Get data Connection Object DataAdapter Provider Database VB.Net 2005 - Chapter 6 Main Difference:DataSet-DataReader DataSet Data structure ... demand on client memory and CPU System .Data Architecture Program DataReader DataSet DataProvider DataAdapter Database VB.Net 2005 - Chapter Details: System .Data Architecture Program DataReader Action ... schema and data in a disconnected fashion Useful for editing data offline and later update to data source DataReader Like Phone connection Doesn’t need to store data in memory Object to access data...

Ngày tải lên: 13/05/2014, 12:19

... evidence that trastuzumab may synergize with specific T-cells [12], making a combinatorial approach with vaccination and trastuzumab an attractive clinical treatment modality pDNA immunization has several ... obsolete and vaccines alone successful against early and metastatic breast cancer This would facilitate the practical management of Her2 positive carcinomas, since trastuzumab based strategies are ... Results Patient characteristics and clinical observations Eight women with a mean age of 57.5 years were accrued in this study Patient characteristics are summarized in Table All patients had advanced...

Ngày tải lên: 18/06/2014, 16:20

... Visual Analogue Scale pre and postoperatively Visual Analogue Scale pre and postoperatively tages of this technique include less paraspinal musculature trauma and smaller wounds Bone removal is ... introduced at the safe triangle of Kambin, [2] the risk of nerve damage was low We did not have any neurological deficit in all the patients done under general anesthesia The advantage of general anesthesia ... case and data collection SBT supervised and helped in manuscript preparation All authors read and approved the final manuscript References 10 11 12 Kambin P, Brager M: Percutaneous Posterolateral...

Ngày tải lên: 20/06/2014, 01:20

... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with ... Real-time PCR amplifications were performed with primers UL6-f (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3')...

Ngày tải lên: 20/06/2014, 01:20

... radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant ... formation (1) and bridging or lamellar bone formation (2) An assessment of these results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical ... the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-; FGF2-) group at weeks in ratio Bone incorporation,...

Ngày tải lên: 20/06/2014, 04:20

... digital video broadcasting (DVB) system In [22], horizontal FEC coding across packets was applied, so that the initial data within each packet was a orded greater protection than later data, though ... there are 13 (0.25 × 50) packets allocated for a zone-2 with capacity of 50 packets The same calculation is repeated for the next data point at a ratio of 0.2, but with aggregated probability ... Bluetooth master node to slave S1, while slave S2 acts as a traffic source to slave node S3 As already mentioned, there is no direct slave-slave communication, and therefore a master maintains separate...

Ngày tải lên: 22/06/2014, 06:20