14 c choline in mixed rumen fluid

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

... Secondly, differences in the parasite species being subject to testing will also in uence the choice of concentration used in the screening process simply because of between species differences ... critical step in the process providing the capacity to systematically capture the scattered information available and keep track of the originating source Assemble a list of plant species occurring ... emergence and wide-spread incidence of chemical residues in human food and antimicrobial and anthelmintic resistance causing a surge of interest in the use of “natural” alternatives to chemicals in...

Ngày tải lên: 15/03/2014, 04:20

252 4,5K 0
ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES potx

ECOLOGY OF COLD SEEP SEDIMENTS: INTERACTIONS OF FAUNA WITH FLOW, CHEMISTRY AND MICROBES potx

... metres in diameter contain mats of sulphur bacteria surrounded by two 15 LISA A LEVIN Figure Seep ‘ring’ consisting of bacterial mats in the core (~45 cm) and a concentric ring of vesicomyid clams ... aggregation Increasing patch age leads to a decline in primary producers (symbiont-bearing taxa) and increasing importance of secondary and higher predators, as well as non-endemic species Species richness ... biogeochemical turnover in gas hydrate-bearing sediments at Hydrate Ridge, Cascadia Margin: numerical modeling and mass balances Geochimica et Cosmochimica Acta 67, 3403–3421 40 ECOLOGY OF COLD...

Ngày tải lên: 15/03/2014, 19:20

46 436 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

... laser scanning microscope CMC carboxymethyl cellulose C- PAM cationic poly(acrylamide) cryo-SEM cryogenic scanning electron microscope CS cationic starch D.S degree of substitution DMA dynamic mechanical ... In contrast to xyloglucan and CMC, addition PDADMAC induced a sharp increase in frequency and a decrease in dissipation, indicating a reduction of the detected mass and an increase in elasticity ... the NFC by optical microscopy Scanning electron microscopy (SEM) The instrument used in the scanning electron microscopic examination of the composite film structures (Paper IV) was a Hitachi S4700...

Ngày tải lên: 18/03/2014, 02:20

89 706 1
Báo cáo khoa học: Surface-enhanced vibrational spectroscopy for probing transient interactions of proteins with biomimetic interfaces: electric field effects on structure, dynamics and function of cytochromec doc

Báo cáo khoa học: Surface-enhanced vibrational spectroscopy for probing transient interactions of proteins with biomimetic interfaces: electric field effects on structure, dynamics and function of cytochromec doc

... protein structural changes occur concomitantly with electron transfer [26] These changes are reflected by bands that have also been detected in redox-induced IR difference spectra of cytochrome c in ... corresponding to high local electric fields Furthermore, the local electric field strength in the electrochemical systems can readily be controlled by changing various parameters An increase in the electric ... data points in the low-field regime, both in electrochemical and in spectroelectrochemical measurements, one may conclude that the kinetic data follow the expected exponential distance dependence...

Ngày tải lên: 22/03/2014, 16:20

9 441 0
Báo cáo khoa học: Interactions of ultraspiracle with ecdysone receptor in the transduction of ecdysone- and juvenile hormone-signaling pdf

Báo cáo khoa học: Interactions of ultraspiracle with ecdysone receptor in the transduction of ecdysone- and juvenile hormone-signaling pdf

... (HA)-tag was placed at the N-terminus of the dUSP by cloning a double-stranded oligomer of the following sequence (upper strand, 5¢-AGCTACCCATACGACGTGCCAGACTACG CATCTCTG-3¢) into the BamHI site ... Fang et al Interaction of ultraspiracle and ecdysone receptor in hormone signaling a construct containing a single motif in the fi direction was used in this study Cell culture and transfections Spodoptera ... III-activated transcription by hydrophobic residue (L 314) in putative coactivator-binding hydrophobic groove of USP (A) Activity of DR1JHECore promoter in Sf9 cells cotransfected with the indicated...

Ngày tải lên: 23/03/2014, 13:20

13 414 0
Báo cáo y học: "Complex genetic association of 6q23 with autoimmune rheumatic conditions" docx

Báo cáo y học: "Complex genetic association of 6q23 with autoimmune rheumatic conditions" docx

... rheumatic diseases Competing interests The authors declare that they have no competing interests References Dieguez-Gonzalez R, Calaza M, Perez-Pampin E, Balsa A, Blanco FJ, Cañete JD, Caliz R, Carreño ... Genet 2007, 39 :147 7 -148 2 Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP, Ma A: κ Failure to regulate TNF-induced NF-κB and cell death responses in A20-deficient mice Science 2000, 289:2350-2354 ... Eyre S, Hinks A, Bowes J, Donn R, Symmons D, Hider S, Bruce IN; Wellcome Trust Case Control Consortium, Wilson AG, Marinou I, Morgan A, Emery P; YEAR Consortium, Carter A, Steer S, Hocking L, Reid...

Ngày tải lên: 09/08/2014, 14:20

2 208 0
Interactions of viologens with conducting polymers, metal salt solutions and glucose oxidase

Interactions of viologens with conducting polymers, metal salt solutions and glucose oxidase

... electrochemically oxidized to create active monomeric and dimeric species which react to form a conjugated polymer backbone The main characteristic of a conducting polymer is a conjugated backbone ... the chemical way of synthesis Electrochemical synthesis permits direct grafting of the conducting polymer onto the electrode surface, which can be of special interest for electrochemical applications ... as inactive packaging and insulating material However, this narrow perspective has been rapidly changing since a new class of polymer known as intrinsically conductive polymers or electroactive...

Ngày tải lên: 16/09/2015, 17:13

223 612 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC ... CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG ... Spcoq7-m Spcoq3-w Spcoq3-x Spcoq3-y Spcoq3-z Spcoq3-m cyc1-w cyc1-x cyc1-y cyc1-z cyc1-m nb2 primer CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC...

Ngày tải lên: 18/02/2014, 14:20

16 647 0
Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

Báo cáo khoa học: The capsid protein of human immunodeficiency virus: interactions of HIV-1 capsid with host protein factors ppt

... (B) X-ray crystal structure of HIV-1 CA (Protein Data Bank code: 1E6J) Helices N1–N7 in the CA-NTD and C1 C4 in the CA-CTD are indicated [79] The CyPA-binding loop (red) and interdomain linker (green) ... p6 COOH 500 HIV-1 CA CyPA binding loop C- term N5 C3 N4 N7 C4 Interdomain linker N6 N3 C1 N term N-term reaction, to generate the correct conformation of proline, which is a rate-limiting step in ... within the cyclophi- C2 N2 N1 CA-NTD CA-CTD lin binding loop, have also been identified [41] A glycine-proline motif appears to be a prerequisite for binding the CyPA active site The speci c CA...

Ngày tải lên: 07/03/2014, 00:20

10 399 0
Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

Báo cáo khoa học: Interactions of imidazoline ligands with the active site of purified monoamine oxidase A potx

... Imidazoline binding in the MAO-A active site ˚ speed the calculations, the enzyme was cut to 12 A around the active site before each docking The docking procedure was tested using clorgyline as a control ... Keynes, UK) The linear secondary plots were fitted in Excel Spectra were recorded approximately after each addition in a Shimadzu UV-2101PC spectrophotometer in an anaerobic cuvette containing MAO-A ... Parini A & Lanier SM (1995) Imidazoline ⁄ guanidinium binding domains on monoamine oxidases ) relationship to subtypes of imidazoline-binding proteins and tissue-speci c interaction of imidazoline...

Ngày tải lên: 07/03/2014, 10:20

9 479 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

... AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), and cloned in pPROTET and ... humidified conditions (P8), and AAAGACATA (P9), and their complementary sequences CATGTCTCT (P 2C) , CATGTCCTT (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , ... 5¢-AAGCAAACCTCGGGGATAC T-3¢; reverse, 5¢-GGGGCTTGATCTCAAAATGA-3¢ The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢ PCR conditions...

Ngày tải lên: 07/03/2014, 10:20

14 396 0
Báo cáo khoa học: Differential interactions of decorin and decorin mutants with type I and type VI collagens pptx

Báo cáo khoa học: Differential interactions of decorin and decorin mutants with type I and type VI collagens pptx

... 5¢-GATTGTCTACAACTGGG CACC-3¢ The amino acid at E180 in DCN E180Q is likewise substituted A cDNA construct for the truncated decorin species DCN Q153 (M1–Q153), in which six of a total of 10 leucine-rich ... chondroitin ABC lyase digestion) in HBS Decorin core protein concentrations were as indicated (B) Interaction with wild-type decorin in HBS buffer (solid lines) and in HBS buffer containing 15 lM ZnCl2 ... glycosaminoglycan-free core protein Evidently the glycosaminoglycan chain of decorin stabilizes the tertiary structure of the proteoglycans thereby causing difference in binding affinity As decorin...

Ngày tải lên: 07/03/2014, 16:20

10 461 0
Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf

... Gacto, M (1994) Cyclic AMP signalling pathway and trehalase activation in the fission yeast Schizosaccharomyces pombe Microbiology 140 , 146 7 147 2 24 Stoscheck, C. M (1990) Quantitation of protein ... (CCGCTCGAGCCTAACGG TGTGGAATAC, which hybridizes at positions 715–732 in the tps1+ ORF and shows an internal XhoI site), and the 3¢ oligonucleotide TAF-3 (CTACGGCGGCCGCCCGAGC TAGAATTCATCGA, which hybridizes ... J., Vicente-Soler, J & Gacto, M (1997) Protein kinase Sck1 is involved in trehalase activation by glucose and nitrogen source in the fission yeast Schizosaccharomyces pombe Microbiology 143 , 2457–2463...

Ngày tải lên: 08/03/2014, 23:20

9 431 0
Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf

Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf

... “arithmetic” aspect alluded to above In this text we shall be concerned with both aspects, but our original contribution concerns the “motivic” aspect, more precisely, in finding a way to circumvent ... Q-motive structure of M induces a direct sum decomposition H(M, C) = H(M, C) σ σ∈Hom(Q ,C) which respects both Q0 -structures The notation H(M, C) σ refers to the complex vector subspace of H(M, C) where ... Periods of Hecke Characters, Lecture Notes in Math 1301, SpringerVerlag, New York, 1988 [20] L C Washington, Introduction to Cyclotomic Fields, Second edition, Grad Texts in Math 83, Springer-Verlag,...

Ngày tải lên: 14/03/2014, 22:20

29 513 0
Báo cáo khoa học: Interactions of elongation factor EF-P with the Escherichia coli ribosome doc

Báo cáo khoa học: Interactions of elongation factor EF-P with the Escherichia coli ribosome doc

... in the presence (+) or absence (–) of EF-P protein The positions of chemical attack were determined using reverse transcriptase and a 22-nucleotide cDNA primer 5¢-TCTCCAGCGCCACGGCAGATAGG GACC-3¢, ... provides information regarding the quality of the search match, including the acquired MS ⁄ MS scan numbers, final candidate search cross-correlation (X-corr) score, the normalized delta cross-correlation ... of action of a factor from Escherichia coli required to reconstruct translation Proc Natl Acad Sci USA 82, 1648–1652 Ganoza MD, Cunningham C & Green RM (1995) A new factor from Escherichia coli...

Ngày tải lên: 16/03/2014, 06:20

11 363 0
Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

... presence of the catalytic tetramer C1 r2 C1 s2 in the C1 complex that hinders the interaction of the C1 q subunit with the polysaccharide According to this hypothesis fucoidan should then interact ... Biochem 270) Altogether these results indicate that the collagen-like region of C1 q contains distinct sites for the binding of DNA and for the binding of the catalytic tetramer C1 r2 C1 s2 Interactions ... resulting C1 q-DNA complex was resistant to the stretching and combing of DNA on PMMA surfaces, indicating the strength of the interaction A continuous succession of fluorescent C1 q could be observed...

Ngày tải lên: 16/03/2014, 23:20

7 396 0
Báo cáo khóa học: The proteasome inhibitor, MG132, promotes the reprogramming of translation in C2C12 myoblasts and facilitates the association of hsp25 with the eIF4F complex pptx

Báo cáo khóa học: The proteasome inhibitor, MG132, promotes the reprogramming of translation in C2C12 myoblasts and facilitates the association of hsp25 with the eIF4F complex pptx

... aliquots containing equal amounts of protein was determined by precipitation with trichloroacetic acid Extracts containing equal amounts of protein were diluted in Buffer C [50 mM Tris/HCl, pH ... paraformaldehyde in NaCl/Pi, pH 7.4 for 15 After a single rinse with NaCl/Pi, cells were permeabilized in NaCl/Pi containing 0.1% (v/v) Triton X-100 for min, rinsed once in NaCl/Pi then incubated with ... appearance, being generally concentrated in the perinuclear region Levels of both hsp25 (Fig 4C) and aB-crystallin (Fig 4D) were increased with MG132, each showing a distinct, reproducible localization;...

Ngày tải lên: 23/03/2014, 12:20

16 405 0
Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

... contradictory reports on which domains of CD2AP are involved in the nephrin-binding [27,28] Consequently, it is possible that the biologically more critical interaction occurs between podocin and CD2AP, ... IQGAP1 is a scaffolding protein connecting Ca2+ ⁄ calmodulin and Rac1 ⁄ Cdc42-mediated signalling and cytoskeleton [51] Very interesting is the recent observation that IQGAP1 interacts with CLIP-170, ... the nephrin intracellular domain responsible for IQGAP1 binding All constructs containing the C- terminal half of the intracellular domain (amino acids 1167–1256) bound IQGAP1, whereas we could not...

Ngày tải lên: 23/03/2014, 13:20

16 334 0
Báo cáo Y học: Chimeric receptor analyses of the interactions of the ectodomains of ErbB-1 with epidermal growth factor and of those of ErbB-4 with neuregulin potx

Báo cáo Y học: Chimeric receptor analyses of the interactions of the ectodomains of ErbB-1 with epidermal growth factor and of those of ErbB-4 with neuregulin potx

... pcDNA3.1/Zeo(+) (Invitrogen) A schematic diagram of the constructed chimeric receptors is shown in Fig 1A The constructs were carefully designed to maintain the disulfide bond connections within ... antibiotics The mammalian expression vectors, which were constructed to express the wild-type or chimeric receptors, were introduced into CHO cells by the LipofectAMINE method (Life Technologies Inc) ... the chimeric receptors Monolayers of CHO cell clones expressing the wild-type ErbB-1, ErbB-4, or the indicated chimeric receptor were incubated with 125I-labeled EGF at C for h After the incubation,...

Ngày tải lên: 24/03/2014, 03:21

7 452 0
Báo cáo khoa học: Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus pot

Báo cáo khoa học: Interactions of the peripheral subunit-binding domain of the dihydrolipoyl acetyltransferase component in the assembly of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus pot

... 5¢-ATGCCGTCCGTGATGAAGTATGC-3¢; R135M (reverse), 5¢-CGCGCATACTTCATCACGGAC GGCAT-3¢; R135K (forward), 5¢-GCCATGCCGTCCGT GAAGAAGTATGCGCGCGAAAAA-3¢; R135K (reverse), 5¢-TTTCGCGCGCATACTTCTTCACGGACGGCA-3¢; ... R13 5C- ethyl R13 5C- propyl R13 5C- butyl R135M R135L R135K Arg135 (wt) (–CH3) (–CH2SCH3) (–CH2SCH2CH3) (–CH2SCH2CH2CH3) (–CH2SCH2CH2CH2CH3) (–CH2CH2SCH3) (–CH2CH(CH3)(CH3)) (–CH2CH2CH2CH2NH3+) (–CH2CH2CH2NHC(¼ ... R135M R135L R135K Arg135 (wt) (–CH3) (–CH2SCH3) (–CH2SCH2CH3) (–CH2SCH2CH2CH3) (–CH2SCH2CH2CH2CH3) (–CH2CH2SCH3) (–CH2CH(CH3)(CH3)) (–CH2CH2CH2CH2NH3+) (–CH2CH2CH2NH 2C( ¼ NH)NH3+) )10.5 )10.8 )10.6...

Ngày tải lên: 30/03/2014, 20:20

9 323 0
w