... improvement and must have the active engagement of top management The aim of these seminars was to raise the CEOs‘ awareness of TQM, help them recognise its relevance to their companies, and gain their ... has edited and arranged the original handbooks, developed learning activities and an interactive testing system, and has now made this available online as an e- learning programme in A Roadmap ... them Each company then put these Handbooks into practice The experts returned at a later stage and used the Handbook-related check-sheets to assess progress Any problems were identified and guidance...
Ngày tải lên: 18/02/2014, 11:20
... Act of 2011 requiring the GSEs to increase their fees by an average of at least 0.10 percentage points above the average guarantee fee imposed in 2011 Revenues generated by these fee increases ... imply an average growth rate below the average for historical recoveries Recent recoveries have been somewhat weaker than average, but the last two expansions were preceded by mild recessions ... loans held on banks’ balance sheets (legacy loans) as well as securities backed by residential and commercial real estate loans (legacy securities) The Treasury implemented the legacy securities...
Ngày tải lên: 29/03/2014, 19:20
A Primer on Developing An E-Business Strategy Submitted to: First Stop Business Information Center doc
... just as feedback can reduce the size of a company’s customer care center, FAQ’s can the same Many companies receive the same questions over and over again A simple FAQ page that answers the most ... The ability to understand customer needs and to respond proactively to customer concerns/requests can be differentiating elements that are developed into a competitive advantage Organizations are ... deemed prudent to integrate these into an organizations overall strategy (Kalakota and Whinston 1997) Databases have several advantages over the traditional language of the WWW i .e. , HTML These...
Ngày tải lên: 28/06/2014, 12:20
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
... of the viruses in swine, avian and human populations it enhances the likelihood of genetic exchange, or “reassortment” of the genetic material between these viruses The mechanism of this reassortment ... proven either One, how does an intestinal virus change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able ... to be false Other theories were that presence of gas warfare, and chemicals used in explosives along with the number of corpses left unburied had created a new “super germ” The potential of an...
Ngày tải lên: 02/11/2012, 11:12
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
Ngày tải lên: 06/11/2012, 10:35
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
... Vietnam national University, Hanoi College of Foreign Languages Department of Postgraduate Studies A study oF An alternative approach to teaching essay writing to TOEFL learners (Nghiên ... learners (Nghiên cứu Đổi phơng pháp dạy viết Luận cho học viên chứng ToefL) By: Nguyen Thi Chung Mien Supervisor: Do Ba Quy, MA Hanoi, 2005 ...
Ngày tải lên: 06/11/2012, 10:35
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
... subjects in order to explain the purpose, relevance and importance of the study, as well as to clarify any questions that the learners had The data were collected and analyzed to survey the learners’ ... the learners to state exactly how many kinds of essay they had learned before However, the learners were more or less familiar with Agreeing and Disagreeing, Giving an Explanation or Making an ... motivated and interesting if either the teacher or learners work all the time It should be a combination between the teacher and learners in which the teacher is a good guide and organizer and learners...
Ngày tải lên: 06/11/2012, 10:35
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
... to some extent, a great affect on them They interact and play with each other and can give them advice immediately Moreover, they are at the same or around age so they can more easily to understand ... are the very important and necessary teachers at the beginning of life for any human being Yet, when children are grown up they must need other teachers for example books, friends and even failure ... life, they will tell the students to avoid mistakes that they passed So, parents are the best teachers and they use their experience to teach their children Secondly, parents always bring the best...
Ngày tải lên: 06/11/2012, 10:35
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
... self-expression (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities ... undertaken to investigate consumers’ awareness about auto-voltage stabilizer brand name and their evaluation towards LiOA brand in details Its objectives are: • To evaluate the brand awareness ... is to develop a deep set of meaning for a brand, it is called as a deep brand; otherwise it is a shallow brand For instance, Mercedes is a deep brand because we understand its meaning along all...
Ngày tải lên: 13/04/2013, 10:29
Sending E-mail
... MailSender implementation Listing 8-4 The Spring JavaMailSender Interface public interface JavaMailSender extends MailSender { MimeMessage createMimeMessage(); MimeMessage createMimeMessage(InputStream ... the accepted standard and must therefore be used for sending binary data by e- mail The standard has also been adopted in other circumstances, and related parts of the standard are used for other ... concerned with the manipulation of MIME messages However, it extends MailSender, so as a matter of convenience you can use a JavaMailSender implementation in any context where you need a MailSender...
Ngày tải lên: 08/10/2013, 21:20
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
... phases are then supplied in the same time and the torque can be estimated to: Figure Rotor fluxes in the stator phases and their variations vs the position of tlie rotor 'fie scheme of a torque ... instantaneous torque of the machine is This first transformation allows to reduce a three-phase system to an equivalent two-phase (xa,xp) system plus the zero-sequence component xo A vector g ... New Electrical Drive Concept for the Veriical Axis of a Selective Compliance Arm Robot", 3rd International Conference on Power Electronics and Variable-Speed Drives C Marchand, A Razek, "Electromagnetic...
Ngày tải lên: 03/01/2014, 19:50
Tài liệu Creating an XML File That Shows Changes Made to a DataSet pptx
... makeChangesButton_Click(object sender, System.EventArgs e) { // Disable the make changes button makeChangesButton.Enabled = false; DataTable dt = ds.Tables["Categories"]; // Delete the first row ... This section contains error information for an element in the section Elements in this section are matched to elements in the section using the diffgr:id annotation ... the elements that have been modified or deleted Elements in this section are matched to elements in the section using the diffgr:id annotation with matching values ...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Module 7: Configuring IIS to Provide E-Mail Support doc
... Designating a Masquerade Domain Name A masquerade domain name is a name that you want to appear in message headers The masquerade domain name replaces the actual local domain name that appears ... receive messages SMTP servers to exchange e- mail messages Administrators to receive e- mail messages that are driven by events on the Web server, such as users sending forms from Web pages Sending and ... and Receiving E- Mail Messages When a user sends an e- mail message, the delivery process begins with the message being transmitted to an SMTP server If the destination domain name of the message...
Ngày tải lên: 24/01/2014, 10:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... can act as auxiliary elements to the PAI-2 core ARE II sequence To investigate the means by which these ARE elements cooperate in modulating PAI-2 mRNA stability, REMSA analyses were performed ... However, both 5¢- to 3¢ and 3¢- to 5¢ pathways can be simultaneously engaged in mRNA decay in an AREmediated manner [45], suggesting that the pathway of mammalian ARE-mediated mRNA decay can be...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu C++ Lab2 Sending the output to a printfile Data Types pptx
... the program Assign this handle to an actual DOS file name DOS file names are character long, a dot, and character extension You may include the drive letter and path in front of the file name ... as a preprocessor directive There are three data types than can be used for floating point numbers: float, and double Float requires bytes and the double bytes The more bytes used the better ... memory saved for an int You can substitute the data type used inside the parenthesis Before manipulating a variable, you must assign a value to it You can assign a value at the time you declare...
Ngày tải lên: 20/02/2014, 08:20
Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt
... integer value to DOS { The left bracket indicates the beginning of the main int dollar, quarterR, dimeR, nickelR, pennyR, remainder; Variables that are used in the main are declared There are ... code If you are not an experienced typist or a programmer, I suggest that you compile the program after every few lines Make sure there are no errors You are allowed to have warnings, but no errors ... the keyboard calculate quarter rolls and remainder quarter_rolls = dollars / 10 remainder = dollars % 10 calculate dime rolls and remainder dime_rolls = remainder / remainder = remainder % calculate...
Ngày tải lên: 20/02/2014, 08:20