13  using a specific session cookie with nikto

Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

Báo cáo khoa học: "Elimination of Mange Mites Sarcoptes scabiei var. suis from Two Naturally Infested Danish Sow Herds Using a Single Injection Regime with Doramectin" pdf

... body Animals were restrained, and the area was scraped with a sharp spoon until blood was visible The material obtained from the scraped area was transferred into a Vacutainer® glass tube labelled ... an SPF programme like the Danish system, (which has an extremely high guarantee of mange-free status) not be available, a quarantine facility must be used and managed on an all-in, all-out basis ... days of age Housing: Gestation and mating areas, as well as farrowing pens, had slatted flooring Pregnant sows were kept in stalls Pigs were weaned into a climate-controlled 2-stage weaning accommodation,...

Ngày tải lên: 12/08/2014, 15:20

10 261 0
AN1145   using a USB flash drive with an embedded host

AN1145 using a USB flash drive with an embedded host

... Viejo, CA Tel: 949-462-9523 Fax: 949-462-9608 Santa Clara Santa Clara, CA Tel: 408-961-6444 Fax: 408-961-6445 Toronto Mississauga, Ontario, Canada Tel: 905-673-0699 Fax: 905-673-6509 Australia - ... sprintf(), to place a formatted string containing the time-stamp and the ADC reading in a buffer The application double-buffers the data to allow data to be read and written simultaneously When a buffer ... Most real-time data analysis requires that data be captured at a fixed, high-speed rate, on the order of milliseconds rather than seconds While PCs offer great data analysis tools, they cannot...

Ngày tải lên: 11/01/2016, 16:46

14 276 0
báo cáo khoa học: "Full recovery of a 13-year-old boy with pediatric Ramsay Hunt syndrome using a shorter course of aciclovir and steroid at lower doses: a case report" pot

báo cáo khoa học: "Full recovery of a 13-year-old boy with pediatric Ramsay Hunt syndrome using a shorter course of aciclovir and steroid at lower doses: a case report" pot

... syndrome was diagnosed The diagnosis of Ramsay Hunt syndrome was explained to our patient and his father, advice on eye care was given and a referral for physiotherapy was made Our patient was lost ... months after the onset of illness; at this time, his facial nerve function was normal (House-Brackmann grade I) An otoscopic examination was unremarkable Our patient had apparently made a full ... our patient admitted having had chicken pox about three months previously; he had no prior vaccination against varicella zoster virus Based on the history and physical examination, Ramsay Hunt...

Ngày tải lên: 10/08/2014, 22:24

4 277 0
Tài liệu Lab 2.2.4 Establishing a Console Session with HyperTerminal doc

Tài liệu Lab 2.2.4 Establishing a Console Session with HyperTerminal doc

... Step Start HyperTerminal program a Turn on the computer and router b From the Widows taskbar, locate the HyperTerminal program: Start > Programs > Accessories > Communications > Hyper Terminal Step ... Step Name the HyperTerminal Session a At the “Connection Description” popup, enter a name in the connection Name: field and select OK Step Specify the computers connecting interface a At the ... establishing a console session with the router Step Closing the session a To end the console session from a HyperTerminal session, select: File > Exit b When the HyperTerminal disconnect warning...

Ngày tải lên: 18/01/2014, 04:20

4 425 0
Tài liệu Using a Transaction with a DataAdapter pptx

Tài liệu Using a Transaction with a DataAdapter pptx

... System.EventArgs e) { // Refresh the orders data dt.Clear( ); da.Fill(dt); } Discussion You can use a transaction with a DataAdapter to allow the roll back of updates made by the DataAdapter in ... private const String ORDERS_TABLE = "Orders"; private DataTable dt; private SqlDataAdapter da; private SqlCommandBuilder cb; // private void TransactionDataAdapterForm_Load(object sender, ... da.SelectCommand.Transaction = tran; If custom update logic is used for the DataAdapter, the Transaction must be associated with the DeleteCommand, InsertCommand, and UpdateCommand of the DataAdapter,...

Ngày tải lên: 21/01/2014, 11:20

4 282 0
Báo cáo khoa học: "A TRANSFER MODEL USING A TYPED FEATURE STRUCTURE REWRITING SYSTEM WITH INHERITANCE" pot

Báo cáo khoa học: "A TRANSFER MODEL USING A TYPED FEATURE STRUCTURE REWRITING SYSTEM WITH INHERITANCE" pot

... produced after transfer, and make appropriate pragmatic decisions RELATING SURFACE AND ABSTRACT SPEECH ACTS A problem in translating dialogues is to translate adequately the speaker's communicative ... English 2a~ Aarld new PROP symbols in the translate.act, txans-speaker and trans-hearer slots [japanese: JASA [speech-act-type: #sat~EQUEST, manner: #man=DIRECT, speaker: # j-sp-J-SPEAK~ hearer: ... propositional content has (I) a lexical head, (2) a set of syntactic featur~ (such as tense-aspect-modality, determination, gender and may have (3) a set of ), dependents which are analyzed as case...

Ngày tải lên: 17/03/2014, 20:20

6 265 0
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc

Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc

... Koyasu S, Nishida E, Kadowaki T, Matsuzaki F, Iida K, Harada F, Kasuga M, Sakai H & Yahara I (1986) Two mammalian heat shock proteins, HSP90 and HSP100, are actin-binding proteins Proc Natl Acad ... USA) Horseradish peroxidase (HRP)-conjugated anti-Cdc37 (E-4) was purchased from Santa Cruz (Santa Cruz, CA, USA), anti-FLAG (M2) and anti-FLAG (M2) affinity gel from Sigma (Saint Louis, MO, USA), ... binding an activating regulatory coprotein to an inactive catalytic subunit can activate a kinase In many signal-transducing protein kinases, site-specific phosphorylation by an upstream protein kinase...

Ngày tải lên: 30/03/2014, 03:20

14 349 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

10 541 0
báo cáo hóa học: " Work life of persons with asthma, rhinitis, and COPD: A study using a national, population-based sample" docx

báo cáo hóa học: " Work life of persons with asthma, rhinitis, and COPD: A study using a national, population-based sample" docx

... year of advancing age was associated with a significantly, albeit slightly decreased hazard for leaving work (hazard ratio of 0.95/year, 95% CI 0.94 – 0.96), as were those with less than a high ... were also omitted from the estimations This may account for the finding that advanced age was significantly, although weakly associated with a decreased hazard of leaving work These limitations ... work limitation and occupational disability in an international study Chest 2003, 124(3):1153-1159 Saarinen K, Karjalainen A, Martikainen R, Uitti J, Tammilehto L, Klaukka T, Kurppa K: Prevalence...

Ngày tải lên: 20/06/2014, 00:20

9 295 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... site Arch Virol 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine rotavirus serotypes by polymerase chain reaction ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4...

Ngày tải lên: 20/06/2014, 01:20

4 330 0
Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot

Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot

... illustration of a p-FET The p-FET is integrated with an onchip optical filter composed of a selectively transmissible material at a particular wavelength to evaluate a small quantity of A peptides ... whole experiment and supported the mathematical approach and the organization of this article All authors read and approved the final manuscript Acknowledgements This research was supported by ... Extracellular amyloid formation and associated pathology in neural grafts Nat Neurosci 2003, 6:370-377 Small DH, McLean CA: Alzheimer’s disease and the amyloid b protein: what is the role of amyloid?...

Ngày tải lên: 20/06/2014, 20:20

12 691 0
Báo cáo hóa học: " Durability test with fuel starvation using a Pt/CNF catalyst in PEMFC" ppt

Báo cáo hóa học: " Durability test with fuel starvation using a Pt/CNF catalyst in PEMFC" ppt

... (b) MEA-1 at the cathode, (c) MEA-2 at the anode, (d) MEA-2 at the cathode, (e) MEA-3 at the anode, and (f) MEA-3 at the cathode Table Catalysts used for the preparation of MEAs Catalyst MEA number ... Saminathan K, Kamavaram V, Veedu V, Kannan AM: Preparation and evaluation of electrodeposited platinum nanoparticles on in situ carbon nanotubes grown carbon paper for proton exchange membrane ... Pt/CNF was evaluated by fuel starvation The performance was compared with a commercial catalyst before and after accelerated tests The fuel starvation caused carbon corrosion with a reverse voltage...

Ngày tải lên: 20/06/2014, 23:20

16 204 0
Báo cáo hóa học: " Micro-nano hybrid structures with manipulated wettability using a two-step silicon etching on a large area" ppt

Báo cáo hóa học: " Micro-nano hybrid structures with manipulated wettability using a two-step silicon etching on a large area" ppt

... study and surface characterizations using FE-SEM and participated in draft writing SJS conducted practical MNHS fabrication, surface wettability characterizations, and graphical information creation ... were conducted using KSV CAM-200 (KSV Ins.) The value of contact angle on each fabricated substrate was automatically calculated based on the calibrating program, KSV Contact Angle Measurement System ... boiling Table Contact angle (θ) measurements for the MNHS Figurea PR removal Pillar Asher Pillar Acetone Cavity Asher Cavity a Micro-pattern Contact angle Acetone SEM images displayed not match practical...

Ngày tải lên: 21/06/2014, 04:20

10 319 0
Báo cáo hóa học: " Parameter Estimation of a Plucked String Synthesis Model Using a Genetic Algorithm with Perceptual Fitness Calculation" ppt

Báo cáo hóa học: " Parameter Estimation of a Plucked String Synthesis Model Using a Genetic Algorithm with Perceptual Fitness Calculation" ppt

... operates uniformly at early stage and more locally as the current generation approaches the maximum generation We have defined the scheme to operate in such a way that the change is always at least ... can be seen, the overall temporal envelopes and the partial envelopes for a recorded tone are very similar to those that are analyzed from a tone that uses estimated parameter values Appraisal ... Press, Cambridge, Mass, USA, 1998 Parameter Estimation Using a Genetic Algorithm [35] J H Holland, Adaptation in Natural and Artificial Systems, University of Michigan Press, Ann Arbor, Mich, USA,...

Ngày tải lên: 23/06/2014, 01:20

15 234 0
Báo cáo vật lý: "Synthesis of Degradable Bio-Composites Based on Recycle Polypropylene Filled with Bamboo Powder Using a Reactive Process" pptx

Báo cáo vật lý: "Synthesis of Degradable Bio-Composites Based on Recycle Polypropylene Filled with Bamboo Powder Using a Reactive Process" pptx

... in masterbatches mixture can extent the interaction among BP, AA and PP These mean that the above mixture can arise the radical reaction among PP, AA and BP cellulose conducting either primary ... specimen before degradation was white transparent with smooth surface After degradation, the specimen changed to grey transparent with coarse surface SEM micrographs of rPP/DVB/AA/BP bio-composite ... weight caused by natural degradable process MATERIALS AND METHODS 2.1 General Information All starting compounds were purchased from E Merck and used as such without any further purification The...

Ngày tải lên: 07/08/2014, 14:20

11 242 0
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc

... Hospital del Henares, Coslada, Madrid, Spain 3BAP Health Outcomes Research, Oviedo, Spain 4Value Demonstration Unit, AstraZeneca Medical Department, Madrid, Spain 5Neuroscience Area, AstraZeneca ... Uriarte, and Fermín Mayoral for their contribution in the linguistic validation Author details Department of Psychiatry, Hospital Universitario de Salamanca, Salamanca, Spain 2Department of Psychiatry, ... statistical analyses were carried out using the statistical packages SPSS (version 14.0; SPSS, Chicago, IL, USA) and Stata (version 10.0; Stata, College Station, TX, USA) For all statistical...

Ngày tải lên: 09/08/2014, 01:21

8 477 0
Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt

... It evaluates 38 joints separately (all proximal interphalangeal and metacarpophalangeal joints, four sites in the wrists, interphalangeal joints of the great toes, and metatarsophalangeals to ... first years of disease, reaching a peak at about 15 years In contrast, patients with two 1G 5A haplotypes seem to develop more pronounced radiographic damage after more than 15 years of RA To analyse ... primary sclerosing cholangitis Gastroenterology 2001, 121:124-130 25 Terashima M, Akita H, Kanazawa K, Inoue N, Yamada S, Ito K, Matsuda Y, Takai E, Iwai C, Kurogane H, Yoshida Y, Yokoyama M:...

Ngày tải lên: 09/08/2014, 01:23

9 358 0

Bạn có muốn tìm thêm với từ khóa:

w