11  using a join to control query output order

mysql  cookbook  2nd  edition

mysql cookbook 2nd edition

... Creating a Database and a Sample Table Problem You want to create a database and set up tables within it Solution Use a CREATE DATABASE statement to create the database, a CREATE TABLE statement ... Programs Converting Datafiles from One Format to Another Extracting and Rearranging Datafile Columns Using the SQL Mode to Control Bad Input Data Handling Validating and Transforming Data Using Pattern ... general characteristics of a set of data, such as how many values it contains or what its minimum, maximum, or average values are Chapter 9, Obtaining and Using Metadata, discusses how to get...

Ngày tải lên: 05/05/2014, 15:21

990 1,9K 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

... similarities with several products from the pur cluster of S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 ... complementation assays The ataP5, ataP4 and ataP10 genes were also independently inserted in the pIJ702 vector and the resulting plasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively (Materials and methods), ... Consequently, AtaP7 and AtaP10 should display similar activities, respectively ata12 encodes a 340 residue protein (Ata12) that shows a high similarity to GDP-D-mannose and other hexose dehydratases (data...

Ngày tải lên: 21/02/2014, 01:21

9 729 0
Báo cáo khoa học: " Use of flow cytometry to develop and characterize a set of monoclonal antibodies specific for rabbit leukocyte differentiation molecules" ppsx

Báo cáo khoa học: " Use of flow cytometry to develop and characterize a set of monoclonal antibodies specific for rabbit leukocyte differentiation molecules" ppsx

... BAQ4 4A CADO3 4A RACT4 8A HUH7 3A RTH16 1A RT1 8A RT 3A MRB12 8A CAM3 6A H2 0A HUH8 2A BAQ3 0A BAG4 0A LT4 1A ISC1 8A ISC3 9A ISC7 6A ISC 4A ISC2 4A ISC2 6A ISC3 6A ISC9 0A RT1 5A RTH3 3A RACT4 3A RACT4 4A RACT3 8A RT2 3A ... RTH 2A RTH23 0A RTH2 1A RT2 2A MRB6 1A RTH2 6A RTH6 5A RACT5 3A RTH 1A RTH19 2A ISC1 6A ISC2 7A ISC29E ISC3 8A RT 1A RACT1 9A RACT2 0A MRB12 0A RACT1 4A RACT2 1A RACT3 0A MRB2 5A MRB2 9A MRB14 3A BAQ4 4A CADO3 4A RT1 9A ... RTH2 1A RT2 2A MRB6 1A RTH2 6A RTH6 5A RACT5 3A RTH 1A RTH19 2A ISC1 6A ISC2 7A ISC29E ISC3 8A RT 1A RACT1 9A RACT2 0A MRB12 0A RACT3 0A MRB2 5A MRB2 9A MRB14 3A RACT1 4A RACT2 1A RT1 9A RTH7 2A RTH17 2A %+ Peripheral...

Ngày tải lên: 07/08/2014, 20:23

16 367 0
Báo cáo toán học: "MacMahon’s theorem for a set of permutations with given descent indices and right-maximal record" ppt

Báo cáo toán học: "MacMahon’s theorem for a set of permutations with given descent indices and right-maximal record" ppt

... r[max, v], majcode) if yi = 1, i < n − Acknowledgments I am grateful to N Bakhytjan and A Jumadildayeva for assistance in making calculations, and to the anonymous referee for essential remarks ... bi-statistics (f, majcode), (f, scode), counter-examples appear at n = Main Lemmas For a coding word α = α1 αn ∈ En , we say that i is a right-maximal index and αi is a right-maximal value ... for all compositions I = (i1 , , ir ) [5] When A is an ordered alphabet, Sn (A) can be realized as the sum of all nondecreasing words in An The commutative image of Sym is the algebra of...

Ngày tải lên: 08/08/2014, 12:22

14 417 0
báo cáo khoa học: " A set of EST-SNPs for map saturation and cultivar identification in melon" doc

báo cáo khoa học: " A set of EST-SNPs for map saturation and cultivar identification in melon" doc

... Mascarell-Creus A, Cañizares J, Vilarrasa J, Mora-Garc a S, Blanca J, Gonzalez-Ibeas D, Saladié M, Roig C, Deleu W, Picó B, et al.: An oligo-based microarray offers novel transcriptomic approaches ... from the Near-East region such as elongated (chate and flexuosus) and Asiatic ananas and chandalak types; group 3, modern cantalupensis cultivars; group 4, mainly traditional varieties and wild ... Z: Quality assessment parameters for ESTderived SNPs from catfish BMC Genomics 2008, 9:450 Yamamoto N, Tsugane T, Watanabe M, Yano K, Maeda F, Kuwata C, Torki M, Ban Y, Nishimura S, Shibata D:...

Ngày tải lên: 12/08/2014, 03:20

9 343 0
báo cáo khoa học: " A set of multiplex panels of microsatellite markers for rapid molecular characterization of rice accessions" ppsx

báo cáo khoa học: " A set of multiplex panels of microsatellite markers for rapid molecular characterization of rice accessions" ppsx

... tubes using sterile plastic beads by agitation on a Fastprep FP120 (Thermo Savant, Waltham, MA, USA) and the DNA was extracted using a rapid CTAB method as described [39] DNA concentration was measured ... technology has proved to be an efficient tool for plant genetic resource characterization, conservation, and management Among all different classes of molecular markers available for evaluating genetic ... accessions with the three panels, as well as statistical analyses and drafting of the manuscript AB designed and optimized multiplex panels A and B, and assisted in drafting the manuscript AANA...

Ngày tải lên: 12/08/2014, 05:20

10 246 0
Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

... 1.55 × 10-6 -10 GCGCGCGC RTAAAYAA* 18 391 11 6.52 × 10 14 7.70 × 10-12 1.65 × 10-9 1.68 × 10-12 WWWTTTGCTCR* 15 17 4.15 × 10-1 4.09 × 10-1 AAAAAAAAAAAAAAAAAAAAAAAA TAWWWWTAGM* YCCNYTNRRCCGN* GCGCNNNNNNGCGC ... patterns (known transcription factors are marked with a star) in the upstream region data set DNA pattern n CGCACCC* 28 AAGAAAAA* AACAACAAC TCCGTGGA* 427 25 22 L homogeneous 10 2.95 × 10-3 heterogeneous ... (p, a) , w) for all p Î  , a Î  , w Î  * We additionally suppose that this automaton is non d-ambiguous (a DFA having this property is also called a d-th order DFA in [48]), which means that...

Ngày tải lên: 12/08/2014, 17:20

18 412 0
Báo cáo y học: "he discovery, positioning and verification of a set of transcription-associated motifs in vertebrates" pps

Báo cáo y học: "he discovery, positioning and verification of a set of transcription-associated motifs in vertebrates" pps

... 5'-CGTCACGGGCGCTTCCATTTCAAAACT-3' Sense 5'-CTCTGTCAAGAAAGTGATGCCGTGAAA-3' Antisense 5'-GAATGTTCAGAAGAGCAGCCGAGGGAT-3' Sense 5'-CCAGGCCACGTTGTTATTTTGCTTCCGC-3' Antisense Deletion 5'-AAAATAACAACGTGGCCTGGCCAGAGCC-3' ... 5'-CCTTCAGGAGCCTCAACAACAACAAAT-3' Antisense 5'-ACAAATGAATGATTGGTCCCGACACGA-3' Sense 5'-GCGCTCCTCTCCCGTTATTGTTCAGGC-3' Antisense Deletion Q9BU67 Control 5'-CCTCTGTCCATCCATGCTACTGACCGA-3' Antisense 5'-CGTCACGGGCGCTTCCATTTCAAAACT-3' ... The TransFac database [15] and the Transcription Regulatory Regions Database (TRRD) [16] are good examples of this approach, and in our hands we find the Jaspar database [17] the most accurate...

Ngày tải lên: 14/08/2014, 15:20

14 295 0
Developing a set of legally compliant intangible asset valuation criteria and an equation supported TEV (total enterprise value) valuation approach

Developing a set of legally compliant intangible asset valuation criteria and an equation supported TEV (total enterprise value) valuation approach

... intangible asset transactions, can make -14the apparently simple cost-based approach harder to deploy than might appear to be the case The Market-Based Approach – the market-based approach bases ... Law and Intangible Asset Valuation: Towards A Supportive Case Law, Regulatory and Standards Framework 154 CHAPTER A Set of Enterprise Intangible Asset Valuation Criteria 228 CHAPTER The TEV (Total ... and able to be characterised against several established patterns, namely: • Equal in each period – for example cash paid against a pre-set loan • Equal in each period with a final balloon payment...

Ngày tải lên: 14/09/2015, 14:10

410 279 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

... would tackle a given brief • Press Pack/Kit: a branded pack handed out to the media by an organisation It normally contains background material, photographs, illustrations and news releases • ... example, you can promote a barcode printer in the printing media, packaging media and food retailing media • Viral campaign: a communications campaign which is designed to exploit the potential ... internet to spread messages rapidly The audience is encouraged to pass a message on to all their email contacts With special thanks to Fiona Campbell, Senior Lecturer, West Herts College Page 20...

Ngày tải lên: 23/12/2013, 00:15

2 495 0
Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 7) pptx

Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 7) pptx

... clinical laboratory company with a charge In Japan, many experts are available for analysis of toxic compounds; their results of analysis and maintenance of their analytical instruments are reliable ... poisons Actual training of analysis is essential rather than collecting informations on analytical methods to make accurate identification and quantitation of a causative toxin Even with an identical ... at a local laboratory; however, unfortunately, institutions undertaking such analysis are not many in Japan Private clinical laboratory companies undertake analysis of the limited number of toxic...

Ngày tải lên: 22/01/2014, 00:20

7 382 0
A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

... learners need Teaching a second language used to be aimed at enabling learners to read and appreciate class of literature Therefore, any teacher who was able to reach this aim was thought to ... need to understand what they are going to talk and also to master some particular grammar points and language skills The procedures that learners have to undergo to make themselves orally understood ... knows a foreign language can speak that language Pattison (1992) confirms that when a person speaks of knowing or learning a language they mean being able to speak the language Oral communication...

Ngày tải lên: 29/01/2014, 10:33

44 1,5K 1
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

... When an bn , we say that an /bn is bounded from above by a constant which is asymptotically universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically ... asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ∪ P0 ), n n area(Pqn+1 ∪ Pqn+1 ), area(Qn ∪ Qn ) 0 ... Lemma 4.11, we obtain a universal constant < λ < and an integer N ≥ such that for every n ≥ N , area(P An+2 ) ≥ λ area(P ∪ P ) for all P An , area(P (4.20) An+2 ) ≥ λ area(P ∪ P ) for all P An...

Ngày tải lên: 14/03/2014, 22:20

53 384 0
A Study of Elderly Living in Old Age Home and Within Family Set-up in Jammu pot

A Study of Elderly Living in Old Age Home and Within Family Set-up in Jammu pot

... 98 ARUNA DUBEY, SEEMA BHASIN, NEELIMA GUPTA ET AL CONCLUSION Old age had never been a problem for India where a value- based joint family system is supposed to prevail Indian culture is automatically ... social, emotional, economical, physical, help and support The perception of the aged at youth was that ‘old age’ was a period of relax- 96 ARUNA DUBEY, SEEMA BHASIN, NEELIMA GUPTA ET AL ation ... is leading to an increased danger of marginalization of the geriatric population due to migration, urbanization, and globalization Another impact of the globalization is the increasing economic...

Ngày tải lên: 22/03/2014, 14:20

6 918 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... lL cyclohexane and transferred to the autosampler vial GC/MS was carried out on a 5890 gas chromatograph coupled with a 5971 MSD (Hewlett-Packard, Palo Alto, CA, USA) equipped with a DB-1 cross-linked ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal...

Ngày tải lên: 23/03/2014, 13:20

11 478 0
NUPOS: A part of speech tag set for written English from Chaucer to the present ppt

NUPOS: A part of speech tag set for written English from Chaucer to the present ppt

... NUPOS, page 17 av-jn negative determiner as adverb adjective as adverb adjective as adverb (un) comparative adjective as adverb adj/noun as adverb av-jn-u un-adj/noun as adverb (un-) unduly 0.3 av-jp ... Christianly 0.5 unchristianly 0.2 av-dx av-j av-j-u av-jc av-jp-u av-js av-n av-s av-u av-vvg av-vvg-u av-vvn past participle as adverb ccx crd cs cst d dc past participle as adverb (un) negative adverb ... present participle as adjective (un-) past participle as adjective past participle as adjective (un-) comparative adjective comparative adj/noun comparative adjective (un-) present participles as comparative...

Ngày tải lên: 24/03/2014, 19:20

25 517 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

... Marrero-Ponce Y, Castillo-Garit JA, Torrens F, Romero-Zaldivar V & Castro E (2004) Atom, atom-type, and total linear indices of the molecular pseudographs atom adjacency matrix: application to ... 687726 Marrero-Ponce Y, Castillo-Garit JA, Olazabal E, Serrano HS, Morales A, Castanedo N, Ibarra-Velarde F, Huesca-Guillen A, Jorge E, del Valle A et al (2004) TOMOCOMD-CARDD, a novel approach for ... Huesca-Guillen A, Sanchez AM, Torrens F et al (2005) Atom, atom-type and total molecular linear indices as a promising approach for bioorganic and medicinal chemistry: theoretical and experimental assessment...

Ngày tải lên: 29/03/2014, 09:20

29 407 0
Giáo trình thực hành BCMSN   Chương 7 – Planning for Implementation of Voice in a Campus

Giáo trình thực hành BCMSN Chương 7 – Planning for Implementation of Voice in a Campus

... (config-vlan)#vlan 40 SW2950_02 (config-vlan)#name VLAN40 SW2950_02 (config-vlan)#end Cấu hình VLAN SW3560_01 SW3560_01(config-vlan)#name VLAN20 SW3560_01(config-vlan)#vlan 40 SW3560_01(config-vlan)#name ... SW2950_01 (config-vlan)#name VLAN20 SW2950_01 (config-vlan)#vlan 40 SW2950_01 (config-vlan)#name VLAN40 SW2950_01 (config-vlan)#end Cấu hình VLAN SW2950_02 SW2950_02 (config-vlan)#name VLAN20 SW2950_02 ... SW3560_01(config-if-range)#exit Bước 3: Cấu hình VLAN switch sau: VLAN 20 40 Cấu hình VLAN SW2950_01 SW2950_01 (config-vlan)#name VLAN20 SW2950_01 (config-vlan)#vlan 40 SW2950_01 (config-vlan)#name VLAN40 SW2950_01...

Ngày tải lên: 08/05/2014, 13:41

12 457 0
w