... nation The names, places of birth and achievementsof top students in royal examination were engraved on stone stelae These stelae, carried on the backs of giant tortoises , are still standing today ... dual-focused aims, namely the learning of content and the simultaneous learning of a foreign language" The fact shows that the themes of the units in the text book of English 10,11 and 12 have a relationship ... fond C traditional 3 Van Mieu was a place to memorialize the most brilliant scholars of the nation A ignore B gather C honor 4 The stone stelae were engraved with the names of the top students
Ngày tải lên: 17/10/2017, 10:42
... Lead-in: Today we’re going to read a passage about Van Mieu – Quoc Tu Giam – a famous historical place in Viet Nam 2 Preteach vocabulary: - T asks Ss to look at the screen and pay attention to ... knowledge of other subjects to solve the topic but also learn more about the typical features of historical places; therefore, they will have positive attitude of appreciating the traditional values of ... of top students in royal examination were engraved on stone stelae These stelae, carried on the backs of giant tortoises , are still standing today and they attract great interest from visitors.
Ngày tải lên: 21/05/2021, 22:14
A study to assess the effectiveness of constructed wetland technology for polluted surface water treatment
... microorganisms (fecal coliform) which aim to protect the water quality and aquatic ecosystems The results showed the treatment effectiveness of loading of 500mL/min/m2 is higher than the loading of ... especially in the reed planting trial In particular, the treatment efficiency of pollutants such as TSS, BOD 5, COD reached a high rate of 85%, 90%, and 87%, respectively In addition, ANOVA statistical ... Abstract: The study aims to assess the applying effectiveness of constructed wetland technology for polluted surface water treatment The experimental models were operated with hydraulic loadings of
Ngày tải lên: 25/09/2020, 11:22
a framework to determine the effectiveness of dietary exposure mitigation to chemical contaminants
... way full insights into the inherent variability in the data can be obtained, allowing a clear assessment of any further steps required to accu-rately assess the impact of a risk management measure, ... assess the application and impact of any dietary Trang 3ex-adequate EFSA has advised that contaminants with a MoE of<10,000are not a priority for action (EFSA, 2012b) 3.1.3 Primary and secondary ... 1146, 103–109. Altaki, M.S., Santos, F.J., Galceran, M.T., 2009 Automated headspace solid-phase microextraction versus headspace for the analysis of furan in foods by gas chromatography–mass spectrometry
Ngày tải lên: 02/11/2022, 08:54
how to reduce the number of rating scale items without predictability loss
... way, it is possible to compute the AUC using an average of a number of trapezoidal approximations Practically, all advanced statistics can be questioned and they often gain recognition after their ... the second row (0.795) is not for variable 7 but the total of variables 1, 14, and 7 In particular, the last value (0.812) in Table 3is for the total of all variables Frankly, these numbers are ... graphical plot illustrating the performance of radar operators (hence ‘‘operating’’) A binary classifier represented absence or presence of an enemy aircraft and was used to plot the fraction of
Ngày tải lên: 04/12/2022, 10:36
Support for targeted sampling of red fox vulpes vulpes feces in sweden a method to improve the probability of finding echinococcus multilocularis
... track along a mowed grass path not shown on map The white asterisk (center) indicates an area of stones The grey shaded area (left-center) is an area of very dense water vole activity and indicates ... collections and molecular analyses and contributed to data interpretation HW contributed to data interpretation JH conceived the project and contributed to data preparation, sequence analyses, and data ... Sweden Two of these regions had a known parasites status and two had unknown parasite status at the onset of the study These findings, in light of the study design, are discussed as a basis for
Ngày tải lên: 19/03/2023, 15:41
Predictive maintenance as a means to increase the availability of positive displacement pumps at Ekurhuleni Base Metals
... of the collected data.Data Analysis and Data InterpretationData gathered was modelled and helped the researcher to answer the research question, as well as to provide advice on the state of the ... Management Act 107 of 1998, and Regulations (NEMA) • National Environmental Management Air Quality Act 39 of 2004 (NEMAQA) • National Environmental Management Waste Act 59 of 2008, and Regulations ... that arise after hours.10 Do you have a storeroom for keeping spares?Spares are stored in the main inventory, but occasional shortages can create pressure on the maintenance team The store-man
Ngày tải lên: 26/07/2023, 07:37
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM
... instructions and invaluable advice during the preparation and completion of this graduation paper. I also wish to acknowledge my debt to all the teachers of Faculty of Postgraduate Studies at Vietnam ... pleasure reading habits and their attitudes... learning reading that uses reading materials that are understandable and meaningful to the learner in order for learners to be able to ... Pleasure Reading Table 3.10: Gender and Attitude towards Pleasure Reading in English Table 3.11: Factors that may have influenced on Pleasure Reading Habit and their Attitudes (Pearson correlations
Ngày tải lên: 10/07/2015, 14:50
A number of measures to improve the efficiency of remembering and using englinsh vocabulary for students in grade 3,4,at ha phong primary school
... think that vocabulary are bricks, grammar isanother factor of language are considered as the grout to set up a homelanguage Teaching vocabulary is an important issue, but learning how to rememberfor ... teaching of any language, the role of vocabulary is very important So we can also say that “language is a set of vocabulary” That does not mean theonly unit to understand the individual words, ... presentthe words 2.1 Visuals: Example: - To present the word “a car”, I draw a car on the blackboard. - Ask Ss to read aloud and listen to the teacher and repeat twice To present vocabulary in
Ngày tải lên: 16/10/2019, 08:37
A number of measures to improve the efficiency of remembering and using englinsh vocabulary for students in grade 3,4,at ha phong primary school
... think that vocabulary are bricks, grammar isanother factor of language are considered as the grout to set up a homelanguage Teaching vocabulary is an important issue, but learning how to rememberfor ... teaching of any language, the role of vocabulary is very important So we can also say that “language is a set of vocabulary” That does not mean theonly unit to understand the individual words, ... presentthe words 2.1 Visuals: Example: - To present the word “a car”, I draw a car on the blackboard. - Ask Ss to read aloud and listen to the teacher and repeat twice To present vocabulary in
Ngày tải lên: 30/10/2019, 17:45
A number of measures to improve the efficiency of remembering and using englinsh vocabulary for students in grade 3,4,at ha phong primary school
... think that vocabulary are bricks, grammar isanother factor of language are considered as the grout to set up a homelanguage Teaching vocabulary is an important issue, but learning how to rememberfor ... teaching of any language, the role of vocabulary is very important So we can also say that “language is a set of vocabulary” That does not mean theonly unit to understand the individual words, ... presentthe words 2.1 Visuals: Example: - To present the word “a car”, I draw a car on the blackboard. - Ask Ss to read aloud and listen to the teacher and repeat twice To present vocabulary in
Ngày tải lên: 19/11/2019, 15:09
Creating sales stars a guide to managing the millennials on your team
... that a key reason managers don’t know how to manage today’s salespeople is that theycan’t relate to them and can’t get into their mindset They become afraid to manage them because theycome across ... warehouse, a back office, a sales team, a marketingteam, a board of directors, and several executives Sure, sales are soft and times are tough They have Trang 25always been tough Your sales team is about ... oraggressiveness The reasons are actually pretty straightforward: Trang 331 They always want to learn more To them, learning is part of the work experience.2 They are competitive They’re ambitious and want to
Ngày tải lên: 20/01/2020, 08:21
A quality by experimental design approach to assess the effect of formulation and process variables on the extrusion and spheronization of drug-loaded pellets containing polyplasdone® XL-10
... the maximum to the minimum for fines is 68.4 and a ratio greater than 10 usually indicates that a transformation of the data is appropriate prior to ANOVA, typically because the error associated ... compared to a highly soluble drug The influence of the spheronizer speed on the total yield appears in the model equation as both a main factor and as a factor in a two-factor interaction (Table ... was calculated as the ratio of the perimeter of a circle with an area equivalent to that of the pellet image (PEQPC) to the actual perimeter (Preal) of the pellet image: Sphericity¼PEQPC Preal
Ngày tải lên: 11/05/2020, 11:54
A number of measures to improve the efficiency of remembering and using englinsh vocabulary for students in grade 3,4,at ha phong primary school
... think that vocabulary are bricks, grammar isanother factor of language are considered as the grout to set up a homelanguage Teaching vocabulary is an important issue, but learning how to rememberfor ... teaching of any language, the role of vocabulary is very important So we can also say that “language is a set of vocabulary” That does not mean theonly unit to understand the individual words, ... andsustainable development of a nation Therefore, the Party and State haveidentified the aims of education is to train the people to meet the fullrequirements of the country industrialization and
Ngày tải lên: 28/07/2020, 06:33
Radiographers supporting radiologists in the interpretation of screening mammography: A viable strategy to meet the shortage in the number of radiologists
... interpreted at least 10 screening mammograms a day; as they improved their performance, the number of mammograms assigned daily increased to approximately 40 mammograms per day Each day, the radiographers, ... com-pares three hypothetical scenarios: (A) the status quo in which a radiologist reads all mammograms; (B) a radiog-rapher reads all mammograms; and (C) a radiogradiog-rapher reads all mammograms ... rate were calculated Overall observer performance was measured by calculating the AUC and the LR+ for each participant The AUC was estimated as the median of the sensitivity and specificity as
Ngày tải lên: 30/09/2020, 10:55
Adapting speaking tasks in the textbook tieng anh 10 to improve the effectiveness of speaking lessons at thuong cat high school a case study
... that you are the guest of a radio program “My favorite historical place” and you are asked about your favourite historical place that you have been to or know about by the MC of the show - The ... individual scores, their opinions about speaking tasks in the textbook and their behaviors while doing speaking tasks Based on the data, together with advantages in methodology, the speaking tasks are ... are adapted and speaking activities are implemented as pilot teaching is employed to realize the objectives of the action research The results indicate that most of the adapted tasks bring about
Ngày tải lên: 30/09/2020, 12:32
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together...
Ngày tải lên: 24/09/2012, 17:19
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
Ngày tải lên: 19/02/2014, 17:20
Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx
... earlier diagnosis of cancer a major focus and to act as a catalyst for action We are co-chairing the National Awareness and Early Diagnosis Initiative (NAEDI), which brings together a wide range of ... made in basic biology over the last several decades have led to an array of discoveries that can be translated into clinical practice to benefit the public As a result, the way cancer is managed ... prevention as few other research organisations, at least in the UK, are playing a substantial role in this area The UK already has considerable strengths in the area of basic science We have a responsibility...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo toán học: "A closed formula for the number of convex permutominoes" pot
... collaborators in [3], is a constructive method to produce all the objects of a given class, according to the growth of a certain parameter (the size) of the objects Basically, the idea is to perform ... parallelogram permutominoes of size n is equal to the nth Catalan number, 2n , n+1 n and moreover, that the number of directed-convex permutominoes of size n is equal to half the nth central binomial ... Proposition The operator ϑ satisfies conditions and of Proposition Proof We have to prove that any convex permutomino of size n ≥ is uniquely obtained through the application of the operator ϑ to a convex...
Ngày tải lên: 07/08/2014, 15:22