1 parent professional partnership model of pt in pivotal response training

Báo cáo khoa học: "A Preliminary Model of Centering in Dialog*" pptx

Báo cáo khoa học: "A Preliminary Model of Centering in Dialog*" pptx

... Stent, 19 98) 14 76 M1 em~[2Cb M3 l M1 Ub = t°pic M2 Dialog : 2 utts 11 0 13 6 16 9 71 49 Dialog 2:229 utts Dialog 3:208 utts 10 5 10 3 17 4 13 7 17 6 13 9 87 77 41 54 Z for all dialogs 318 48% 467 484 235 14 4 ... 14 4 Model total / 664 total utts 70% 73% 35% 22% I cheap transitions [ expensive trans M1 lVI2 M3 M1 lVI2 M3 47 94 48 47 13 3 14 4 14 5 93 37 37 13 6 14 9 14 9 38 54 84 58 58 11 4 12 3 12 3 M3 13 9 2 71 143 ... for modeling the local coherence of discourse Computational Linguistics, 21 (2) Megumi Kameyama 19 86 A property-shying contraint in centering In Proceedings of ACL 86 Megumi Kameyama 19 98 Intrasentential...

Ngày tải lên: 23/03/2014, 19:20

3 295 0
Báo cáo khoa học: "A MODEL OF REVISION IN NATURAL LANGUAGE GENERATION" pptx

Báo cáo khoa học: "A MODEL OF REVISION IN NATURAL LANGUAGE GENERATION" pptx

... Proceedings, pp.730-732 Collins, Allan & Dedre Gentner (19 80) "A Framework for a Cognitive Theory of Writing", in Gregg & Steinburg, eds, pp 51- 72 Flower, Linda & John Hayes (19 80) "The Dynamics of ... Changes to conceptually dictated decisions would shift the meanin~ of the text During initial generation, euristics for maintaining local cohesion are used, ~wing on the representations of simple local ... leaving it to the reader to infer Other ways of combining sentences can function to increase coherence as well Chafe (19 84) enumerates the devices used to combine "idea units" in written tex) including...

Ngày tải lên: 24/03/2014, 02:20

7 327 0
Báo cáo khoa học: Hodgkin Reed–Sternberg cells express 15-lipoxygenase-1 and are putative producers of eoxins in vivo Novel insight into the inflammatory features of classical Hodgkin lymphoma ppt

Báo cáo khoa học: Hodgkin Reed–Sternberg cells express 15-lipoxygenase-1 and are putative producers of eoxins in vivo Novel insight into the inflammatory features of classical Hodgkin lymphoma ppt

... expression of 15 -LO -1 in these cells RT-PCR analysis revealed mRNA expression of 15 -LO -1 but not of 15 -LO-2 in L1236 cells (data not shown) To demonstrate the expression of the 15 -LO -1 protein in L1236 ... stained with an antibody raised against 15 -LO -1 In most HL tumours, there was a distinct cytoplasmic positivity for 15 -LO -1 in tissue macrophages and a strong staining in eosinophils In 17 of ... high eosinophilia and weak staining of 15 -LO -1 in H-RS cells (Table 1) By contrast, no staining of 15 -LO -1 was observed in tumour biopsies from ten patients with nine different subtypes of NHL...

Ngày tải lên: 30/03/2014, 04:20

13 351 0
Claudin 1 is the direct target of RUNX3 in gastric epithelial cells

Claudin 1 is the direct target of RUNX3 in gastric epithelial cells

... Elevated (16 4) Gastric 1, 3, 4, 18 , 23 Diminished (15 5, 16 5 -16 7) 4, Elevated (16 2, 16 8) Prostate 3, Elevated (15 9) Breast 1, 2, 4, Diminished (15 8, 16 9, 17 0) 3, Elevated (17 1) Hepatocellular carcinoma ... junctions, interact directly with occludin and zonula occludens (ZO), and indirectly with AF-6 and the myosinbinding molecule cingulin (15 0 -15 2) Claudins bind to the PDZ-domain-containing proteins such ... mutation involving a singlenucleotide transition of arginine 12 2 to cysteine (R122C) within the conserved Runt domain was also discovered in the 11 9 human tumors investigated When tested on 17 nude...

Ngày tải lên: 11/09/2015, 09:00

146 286 0
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

... Journal 2007, 4 :11 8 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 Liu W, Peng Z, Liu Z, Lu Y, Ding J, Chen YH: High epitope density in a single recombinant protein molecule of the extracellular ... isotype in protection Role of Role of heavy chain isotype in protection Naive BALB/c mice were injected i.p with 10 μg mAb 14 C2 of G1 (triangles pointing down), G2b (diamonds) or G2a (triangles pointing ... Potter CW, Jennings R: Immunopotentiation of local and systemic humoral immune responses by ISCOMs, liposomes and FCA: role in protection against influenza A in mice Vaccine 19 93, 11 :13 02 -13 09 Zebedee...

Ngày tải lên: 18/06/2014, 18:20

14 522 0
Báo cáo y học: "Role of TRPV3 in immune response to development of dermatitis" doc

Báo cáo y học: "Role of TRPV3 in immune response to development of dermatitis" doc

... CAGCCTGGGAATCAGAACG BV1S1A1, BV2S1 BV3S1A1, BV4S1 BV5S1 BV2S2 BV6S1A1, BV7S1 BV8S1 BV8S2A1, 2, BV8S3 BV9S1 BV10S1A1, BV11S1 BV12S1T BV13S1 BV14S1 BV15S1A1, BV16S1A1, BV17S1, 2P, BV18S1 BV19S1 BV20S1 lated ... Target family MVB1 -1 MVB2 -1 MVB3 -1 MVB4 -1 MVB5 -1 MVB5-2 MVB6 -1 MVB7 -1 MVB8 -1 MVB8-2 MVB8-3 MVB9 -1 MVB10 -1 MVB 11- 1 MVB12 -1 MVB13 -1 MVB14 -1 MVB15 -1 MVB16 -1 MVB17 -1 MVB18 -1 MVB19 -1 MVB20 -1 ACGGTGCCCAGTCGTTTTAT ... 63.8 41. 5 218 .5 19 26.4 11 3.6 437.4 909.6 70.7 43.3 50.8 358.8 89.8 205.2 26.0 76.2 5.4 16 2.9 374.4 13 .2 12 .7 6.4 10 .3 457.3 15 .0 207.4 87.4 4.8 12 .1 3 .1 76.5 21. 7 285 .1 72.9 10 5.7 9.3 213 .9 11 7.9...

Ngày tải lên: 11/08/2014, 08:22

10 360 0
The impact of summer in-service teacher training on teacher change = Nghiên cứu về thay đổi của giáo viên dưới tác động của chương trình bồi dưỡng chuyên môn nghiệp vụ hè

The impact of summer in-service teacher training on teacher change = Nghiên cứu về thay đổi của giáo viên dưới tác động của chương trình bồi dưỡng chuyên môn nghiệp vụ hè

... education TESOL Quarterly, 23 (1) , 28-46 Gaunt, D (19 95) Supporting continuing professional development In H Bines & J Welton (Eds.) Managing partnership in teacher training and development London: ... existing problems, such as teachers‟ personal need, inefficient training, and financial problems, prevent in- service teacher training from functioning in improving the teachers‟ quality in the ... measures to be adopted by the Department of Education and Training of Vinh Phuc, schools and individual teachers in the planning of the future teacher in- service workshops 4.2 Findings: As mentioned...

Ngày tải lên: 30/03/2015, 14:33

47 597 0
Báo cáo khoa học: A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function potx

Báo cáo khoa học: A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function potx

... wht-2(RNAi)f umps -1( zu456); pyr -1( RNAi)f umps -1( RNAi); pyr -1( cu8)f umps -1( zu456); pyr -1( cu8)m umps -1( zu456); R12E2 .11 (RNAi)f Mosaic RNAi rrf -1( pk14 71) n rrf -1( pk14 71) ; umps -1( RNAi) Percentage of embryos ... containing 14 00 bp of sequence upstream of the predicted start codon of F11E6 .1 and the entire predicted coding sequence predicted to include the 3¢-end of splice forms F11E6.1a and F11E6.1b (Wormbase ... alx -1( gk275), apt-6(ok429), glo -1( zu437), mrp-4(ok1095), pgp-2(kx55), ppk-3(n2668), ppk-3(ok 115 0), ppk-3(zu443), rab -10 (dx2), rde -1( ne 219 ), rme -1( b1045), rrf -1( pk14 71) , rrf-3(pk1426), tat -1( kr15),...

Ngày tải lên: 06/03/2014, 09:22

20 442 0
Báo cáo khoa học: Adaptation to G93Asuperoxide dismutase 1 in a motor neuron cell line model of amyotrophic lateral sclerosis The role of glutathione doc

Báo cáo khoa học: Adaptation to G93Asuperoxide dismutase 1 in a motor neuron cell line model of amyotrophic lateral sclerosis The role of glutathione doc

... activity in ALS [12 ,13 ], suggesting that normal handling of GSH may be altered However, GSH binding sites in the spinal cord and GSH levels in cerebrospinal fluid were high in SALS patients [14 ,15 ], ... (dox)), the involvement of GCL in the increase in GSH was further confirmed by measuring GCL activity, which was 16 .44 ± 0. 31 nmolÆ min )1 mg )1 of protein, i.e  20% higher (P < 0. 01 by Student’s ... levels of the various cell lines ( P < 0. 01, P < 0.0 01) or the effect of t-BHQ in each cell line (**P < 0. 01, ***P < 0.0 01) and in the different cell lines (dP < 0.05, ddP < 0. 01, dddP < 0.0 01) insult...

Ngày tải lên: 29/03/2014, 23:20

14 370 0
báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf

báo cáo hóa học: " Anandamide inhibits Theiler’s virus induced VCAM-1 in brain endothelial cells and reduces leukocyte transmigration in a model of blood brain barrier by activation of CB1 receptors" pdf

... 6 21 ± 465++ Cnr1-/contralateral 12 , 013 ± 0,489 13 ,223 ± 0,788 15 ,909 2,327 15 909 ± 327 Ipsilateral 20,028 ± 1, 257## 21, 3 41 ± 0,958## 19 ,657 1, 120 19 657 ± 12 0# contralateral 16 ,956 ± 0, 913 17 ,15 1 ... have no competing interests Received: 11 May 2 011 Accepted: 18 August 2 011 Published: 18 August 2 011 References Engelhardt B, Ransohoff RM: The ins and outs of T-lymphocyte trafficking to the CNS: ... VCAM -1 in surrounding blood vessels close to the site of injection in Cnr1+/+ as well as in Cnr1-/- mice whereas VCAM -1 was not detected in brains of sham animal in both type of mice accordingly...

Ngày tải lên: 19/06/2014, 22:20

13 466 0
báo cáo khoa học: " Comparison of Radioimmuno and Carbon Nanotube Field-Effect Transistor Assays for Measuring Insulin-Like Growth Factor-1 in a Preclinical Model of Human Breast Cancer" doc

báo cáo khoa học: " Comparison of Radioimmuno and Carbon Nanotube Field-Effect Transistor Assays for Measuring Insulin-Like Growth Factor-1 in a Preclinical Model of Human Breast Cancer" doc

... wafers and instruments used in this study Received: 28 February 2 011 Accepted: September 2 011 Published: September 2 011 References Hadsell DL, Bonnette SG: IGF and insulin action in the mammary ... 0 .1 and -0 .1 volt, respectively With the IGF introduced on the circuit, the response in the electrical signal is typically in the range of to 15 % in the normalized units A response of IGF -1 binding ... were maintained in Jones et al Journal of Nanobiotechnology 2 011 , 9:36 http://www.jnanobiotechnology.com/content/9 /1/ 36 Page of Figure Measurement of IGF -1 in mouse serum Mouse serum IGF -1 was...

Ngày tải lên: 11/08/2014, 00:23

6 329 0
Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx

Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx

... Urine levels of TGF-β -1 after CYP Injection of CYP induced time dependent 10 0-fold increase in urine levels of TGF- 1 in rats of both sexes relative to the respective baseline values TGF- 1 levels ... TGF 1 [pg/mg of Creatinine] 500 10 00 15 00 2000 2500 Latent TGF 1 [pg/mg of Creatinine] Figure Relationship between urine TGF- 1 and NO2-/NO3- levels Inverse Inverse Relationship between urine ... approved the final manuscript Acknowledgements The work in this study was supported by NIH grant NIDDK RO1-DK 06 613 8 and NIDRR grant H133E070024 References 10 11 12 13 14 15 Competing interests The...

Ngày tải lên: 11/08/2014, 08:22

13 246 0
Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt

Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt

... (II/ 41) , IgD (11 -26c [11 -26]), CD 21 (eBio8D9 (8D9)), CD23 (B3B4), B220 (RA3-6B2), CD93 (AA4 .1) , CD62L (MEL -14 ), CD4 (GK1.5), CD8 (H3 517 .2), NK1 .1 (PK136), CD11c (N 418 ), Ly6C (HK1.4), CD11b (M1/70) ... used in murine models of atherosclerosis in SLE Statins in SLE patients and murine models have shown varying degrees of success in recent trials [7,38-40] Pravastatin was successful in reducing ... levels of IL -10 (interleukin10) - a cytokine secreted in response to damaged tissue Woo et al Arthritis Research & Therapy 2 010 , 12 :R93 http://arthritis-research.com/content /12 /3/R93 (a) Page of 13 ...

Ngày tải lên: 12/08/2014, 12:20

13 361 0
Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis

Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis

... Bhatia M Activation of Neurokinin -1 receptors Upregulates Substance P and Neurokinin -1 receptor in Murine Pancreatic Acinar Cells J Cell Mol Med 2 011 ; doi: 10 .11 11/ j .15 82-4934.2 011 . 014 75.x Koh YH Moochhala ... JS, Bhatia M Role of Protein Kinase C in Caerulein Induced Expression of Substance P and Neurokinin-1Receptors in Murine Pancreatic Acinar Cells J Cell Mol Med 2 011 ; 15 (10 ): 213 9-49 Koh YH, Moochhala ... family of peptides 16 1. 3.2 Sources and distribution of SP 17 1. 3.3 Neurokinin -1 receptor (NK1R) 18 1. 3.4 Pro-inflammatory effects of SP 18 1. 3.5 SP in acute...

Ngày tải lên: 09/09/2015, 17:54

190 438 0
Muscarinic mechanisms in a mouse model of myopia 1

Muscarinic mechanisms in a mouse model of myopia 1

... al 19 87) These findings imply regional retina control of the growth of different parts of the posterior globe of the eye 1. 2.6 Clinical Models of Myopia A number of clinical observations have indicated ... found in animal models for myopia include dopamine (Stone et al 19 91, Iuvone et al 19 91, Schaeffel et al 19 95, Lin et al 19 88), VIP (Stone et al 19 88, Butler et al 19 84, Erikson and Larson 19 81, ... of the receptor The allosteric nature of the protein is already apparent during interaction with G-proteins When interacting with G-proteins, the affinity of the classical (orthosteric) binding...

Ngày tải lên: 16/09/2015, 08:31

121 341 0
The roles of rac1 and syncollin in regulated exocytosis  insulin secreting INS 1 cells as a model

The roles of rac1 and syncollin in regulated exocytosis insulin secreting INS 1 cells as a model

... (complete medium) INS -1 pIRES INS -1 Transfected with 62-78 vector pIRES INS -1 N17Rac INS -1 Transfected with hygromycin 62-78 vector pIRES-N17Rac1 INS -1 V12Rac INS -1 Transfected with INS -1 Transfected ... CHAPTER 4 .1 DISCUSSION 80 THE ROLE OF RAC1 IN REGULATED INSULIN SECRETION 80 4 .1. 1 Activation of Rac1 by glucose stimulation in insulin-secreting cells 80 4 .1. 2 Altered intracellular ... EXPRESSION OF RAC1 MUTANTS RESULTS IN MARKED DISRUPTION OF F-ACTIN FILAMENTS IN INS -1 CELLS 57 3.7 EXPRESSING DOMINANT NEGATIVE RAC1 INHIBITS GLUCOSE- AND FORSKOLIN- STIMULATED INSULIN...

Ngày tải lên: 16/09/2015, 17:11

140 250 0
The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

... Substrates of caspase -1 14 1. 8.3 Synthetic caspase inhibitors 15 1. 9 Animal models in influenza pneumonia 16 1. 10 Caspase -1 and host response to infection in vivo 18 ... 12 9 4.2 Expression of caspase -1 and growth of virus in influenza A/PR/8/34 (H1N1) infection of RAW264.7 macrophages 13 0 4.3 Insights into the role of caspase -1 using a murine model ... pathology of influenza infection 1. 5 Innate immunity in the lungs in response to influenza 1. 5 .1 Pattern-recognition receptors and innate recognition of viral infection 1. 5.2 Early inflammatory...

Ngày tải lên: 13/10/2015, 16:41

190 828 0
RESEARCH ON THE FIRST ORDER GAMMA AUTOREGRESSIVE GAR(1) MODEL TO APPLY IN THE FIELD OF HYDROLOGY

RESEARCH ON THE FIRST ORDER GAMMA AUTOREGRESSIVE GAR(1) MODEL TO APPLY IN THE FIELD OF HYDROLOGY

... 76.84 10 6.38 94 .15 71. 44 85.60 19 5.30 705.26 10 39.30 622 .19 220.25 13 6.53 94.06 66.42 97.66 93.68 74.95 91. 32 17 4. 61 778. 81 1074.54 559 .19 267.63 14 7.64 10 1.39 87 .16 12 1. 01 1 01. 73 74.84 93.60 94 .19 ... 3 .1 Mean values at Nong Son station Month History GAR (1) -M GAR (1) -F Th.Fiering 10 11 12 15 00 248.96 13 8. 21 94.05 76.45 10 7.30 94.54 70.33 85.02 19 5.59 697 .19 10 41. 81 619 .97 245.40 13 7.85 93. 01 ... GAR (1) -M 1. 53 1. 23 1. 20 1. 98 1. 00 0.80 0.64 1. 76 5 .17 -0. 01 0.66 1. 12 GAR (1) -F 1. 51 0.95 0.73 2 .18 0.78 0.93 1. 32 3.44 2.32 -0 .12 1. 66 0.96 Th.Fiering 0.67 0.57 0.43 0.48 0.35 0.34 0.22 0.62 1. 73...

Ngày tải lên: 05/09/2016, 23:25

27 411 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

... conflict of interest exists 258 References 10 11 12 13 14 15 16 17 18 19 Bouhassira D., Lantéri-Minet M., Attal N., Laurent B., Touboul C Prevalence of chronic pain with neuropathic characteristics in ... Suppression of TLR4 attenuates neuropathic pain in CCI rats To examine the impact of TLR4-siRNA treatment on pain response in vivo, modulation of pain perception in the Bennett model of neuropathic pain ... of TLR4 with intrathecal siRNA delivery could alleviate pain responses in a rat CCI model, suggesting that siRNA targeting TLR4 could be of practical value in clinical situation Conflict of Interest...

Ngày tải lên: 25/10/2012, 11:48

9 488 0
w