... Trang 2 ReadingTrang 31.It’s considered as the “brain” of this machine. 2 It’s square It is used to store information 3 It has the same name as an animal which hates cats 4 It gives ... in pairs, ask and answer 3 How can you relax with computers? 4 Can computers be used to replace human beings in future? Trang 18Task 3: Work in pairs, ask and answer the questions 1 Are ... I can listen to music, play games, watch films… 4 Can computers be used to replace human beings in future? - No, they can’t Trang 19Post-readingTrang 22Rearrange advantages and disadvantages
Ngày tải lên: 13/04/2021, 04:01
... Analysis of Inbound Logistics Activities Correlation Analysis Cost Advantage Access to Quantity Advantage Faster/Earlier Delivery Advantage Customized Arrival Advantage Trang 11Comparison of Results ... the faculty and staff of the Department of Management, especially Dr Sang M Lee, Linda Rohn, and Cathy Watson The author would especially like to thank Annette and Hillary Samaras, who sacrificed ... the approaches to competitive advantage upon which this dissertation will focus, as shown on Figure 1.1 Trang 19data systems and supply chain techniques as a means of harmonizing organizational
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... proteinases Proc Natl Acad Sci USA 80, 6066–6070 13 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Acceler-ated transport and maturation of lysosomal alpha-galac-tosidase A in Fabry lymphoblasts ... influence of glucosidase and mannosidase inhibi-tion on the mutant ASAs (Gly86Asp, Tyr201Cys, Asp335Val, Pro136Leu, Asp255His, Thr274Met) In these experiments all of the mutant ASAs behaved rather ... and A5 is almost as efficient as with mAb B1 The location of epitopes suggests that folding of ASA starts within a central part of the molecule [14] This is accompanied by a partial expression of
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... includ-ing the ERK1⁄ 2 pathway, the PKB pathway and the Janus kinase⁄ signal transducer and activator of tran-scription (JAK-STAT) pathway, to promote prolifera-tion, survival and transformation [56,57] ... PD0325901 and rapa-mycin was more effective than PD0325901 alone, and death arising from the combination therapy was at least partially BIM-dependent [71] Both of these stud-ies suggest that TOR activity ... p53-upregulated modulator of apoptosis; RACK1, receptor for activated C-kinase-1; RAS, rat sarcoma virus concogene; RNAi, RNA interference; RSK, ribosomal protein S6 kinase. Trang 2associated x protein
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... Trang 1phage display screening of a peptide libraryJeannine Mohrlu¨der1,2, Thomas Stangler1,2, Yvonne Hoffmann1,2, Katja Wiesehan2, Anja Mataruga3 and Dieter Willbold1,2 1 Institut fu¨r Physikalische ... each binding curve The association rate konwas determined to be 1.3· 104m)1Æs)1 and the dissociation rate koffto be 8.3· 10)4s)1 Rmax values decreased, as expected, with increasing baseline A ... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABA-RAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln⁄ Asn side chain and
Ngày tải lên: 16/03/2014, 05:20
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... inequality and poverty Ottawa: Status of Women Canada; 2001 [5] Day S, Brodsky G Women and the equality deficit: the impact of restructuring Canada’s social programs Ottawa: Status of Women Canada; 1998 ... increasing poverty and low income threatens Canadians’ health and health care system Canadian Review of Social Policy 2003;51:9–28 [19] Raphael D, Bryant T The limitations of population health as ... and US and to a lesser extent in Canada 9.1 Decline of the welfare state Teeple [11] sees increasing income and wealth inequalities and the weakening of social infrastructures within Canada and
Ngày tải lên: 22/03/2014, 11:20
Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot
... NY, 1994 43 TA Instruments Manual for DMA 2980 Dynamic Mechanical Analyzer 73 VITA Catherine Keel Beck was born in April 11, 1977 to Walter and Sandi Keel of Atlanta, Georgia After graduating ... washed in toluene The contact angle of water for the 100c sample was less than that of the 100t sample indicating a more polar surface The AFM images of the toluene washed 70 and chloroform washed ... which calculates the total polymer thickness For each image, at least and as many as 12 height differences have been calculated and averaged together to give an overall feature height of each sample
Ngày tải lên: 23/03/2014, 01:20
As A Matter Of Course pdf
... counteract an unpleasant brain-impression by something pleasant but false We must call a spade aspade, but not consider it a component part of the man who handles it, nor yet associate the man with ... Identification Number] 64-6221541 Title: As A Matter Of Course Author: Annie Payson Call Release Date: August, 2003 [Etext# 4385] [Yes, we are more than one year ahead of schedule] [This file wasfirst ... downswhen they master us; and of course retain no jot of that fascination which is a good part of their very shallowness, and brings new life as we take them as a matter of course Then we are swung
Ngày tải lên: 23/03/2014, 02:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6-for Tubulin a6-rev ... 83581–83552 NC_000076 Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC ... Trang 1of major maps in CAD cells does not preclude neuriteformation C Gasto´n Bisig1, Marı´a E Chesta1, Guillermo G Zampar1, Silvia A Purro1, Vero´nica S Santander2 and Carlos A Arce1 1 Centro
Ngày tải lên: 23/03/2014, 05:22
Fermentation as a Method of Food Processing ppt
... fermenting cabbage German salami (smoked), Italian salami, Lebanon bologna (sausage), Longaniza (sausage), and Teewurst are typical fermented meat products of Europe While paak made of fish and cereal ... cultures of lactic acid bacteria had a wider range of activity against mutagensthan those produced with a single strain of lactic acid bacteria (Tamai et al., 1995). Antimutagenic properties of the ... natural pH of leaf extract (Pandey & Srivastava, 1993) Trang 17During fermentation certain micro-organisms produce vitamins at a higher rate thanothers do The content of thiamine and riboflavin
Ngày tải lên: 24/03/2014, 04:20
NUPOS: A part of speech tag set for written English from Chaucer to the present ppt
... Trang 10nouns like ‘water closet’ the first noun acts as a kind of adjective; in a phrase like “the dead will rise” the adjective acts as a kind of noun NUPOS as-sumes that such quasi-adjectival ... of the automatic tagger may consist of a set of rules or of a statistical analysis of the results Either way, a good tagger will provide ac-curate descriptions for 97 out of a 100 words as-Why ... the apostrophized ‘s’ can also stand for ‘is’ or ‘has’ in contracted forms, where it has a linguistically sounder claim to be treated as a separate word But if you want a tag set ca-pable of processing
Ngày tải lên: 24/03/2014, 19:20
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... Trang 1Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly Madeleine E Hackney1,5 Svetlana Kantorovich2 and Gammon M Earhart1,3,4 Falls are the leading ... increasing age (Rogers and Mille 2003) Gait changes associated with aging include decreased gait speed, decreased stride length, increased double support time, and increased width of the base of ... Myers1995), the Modified Falls Efficacy Scale (Hill et al 1996), and the 17-item Philadelphia Geriatric Center Morale Scale (Lawton 1975) Balance was evaluated using the Functional Reach (Duncan
Ngày tải lên: 28/03/2014, 20:20
the transactor book of bits and pieces #1 for all commodore computers! (a collection of the bits and pieces sections from the transactor, v. 4-6)
... 112 Which Way Did He Go? ¢ 112 Aquarius ¢ 112 Quick Note: on sprites 113 SHIFTing your WAIT 117 Quick Note: on GET 117 Easy Disk Salvaging 118 A Magic Number? 118 Safe VAL Function 119 ... 350800 And Its Relatives 161 Tickertape 162 Debugging Aid Update 162 Easy Program UN-NEW After Reset 163 1541 DOS Crash With REL Files 163 1541 DOS Wedge Tips 163 One-Line Decimal + Base B 164 ... loader 10 for j= 20480 to 20539 : read x : poke j, x : next : end 20 data 169, 128,133, 1,169, 0,133, 0 30 data 168,169, 1,145, 0,200,192, 0 19 Tha Traneactor Rank of Rits and Pieces #1 Trang
Ngày tải lên: 31/05/2014, 02:01
báo cáo sinh học:" Migration as a form of workforce attrition: a nine-country study of pharmacists" pptx
... Hart LG: The migration of physicians from sub-Saharan Africa to the United States of America: measures of the African brain drain Human Resources for Health 2004, 2:17. 3. Hagopian A, Ofosu A, ... coordinators: Brooke Myers, Australia; Mamunur Rashid, Bangladesh; Maja Kovacevic, Croatia; Mohammed Atef Abd El Hakim, Egypt; Suresh Panthee and Ganesh Subedi, Nepal; Pedro Lucas and Andreia Bruno, ... Trang 1Bio Med CentralPage 1 of 10 Human Resources for Health Open Access Research Migration as a form of workforce attrition: a nine-country study of pharmacists Tana Wuliji*1,2, Sarah Carter2
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
... estima-tion (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased by non-random missing data patterns (n = 21,736; ... that physical activity partially mediates the impact of chronic conditions on several health outcomes that are important to quality of life Physical activity of at least 1,000 Kcal per week was ... to indicate whether they had a disease or another health condition diagnosed by a health professional that had lasted, or was expected to last, 6 months or more These data were used to classify
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Behaviour of motor unit action potential rate, estimated from surface EMG, as a measure of muscle activation level" potx
... area was assumed to be circular The radius of the detection area (10 mm) was estimated based on [16] and [17] The simulated location of the electrode array was between the innervation zone and ... of MUAPs, eMR was substantially lower than the actual MUAP Rate (aMR) The percentage of detected MUAPs decreased with aMR, but the relation between eMR and aMR was rather stable in all simulated ... was drawn from a Gaussian distribution with a mean of 83.3 ms and a standard deviation (SD) of 7 ms (corresponding to a mean firing rate of 12 pps with an SD of 1 pps) The vari-ation within a
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
... relevant covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms of ... 090 '15 7 1. 000 1. 000 056 1. 000 400 ** 465 ** 1. 000 - .16 7 311 ** 055 1. 000 16 6 5 81 ** 216 329 * 1. 000 1. 000 410 ** 1. 000 227 268 * 1. 000 083 313 * 16 4 1. 000 -.030 396 ** 15 3 015 1. 000 Bivariate ... questionnaire, performed statistical analysis and drafted the manuscript TO participated to conceive and design the study assisted in statistical analysis and helped to draft the manuscript PFM participated...
Ngày tải lên: 20/06/2014, 15:20
Suitability of insulin like growth factor 1 (IGF1) as a measure of relative growth rates in lingcod
... recombinant salmon IGF1 The assay was validated for lingcod by running a series of plasma dilutions and assessing parallelism of the lingcod plasma by comparison with to standards (Figure 1) Data analysis.—We ... plasma was frozen and stored at −80◦ C Plasma IGF1 concentration was quantified by means of the radioimmunoassay developed by Shimizu et al (2000) with barramundi Lates calcarifer antibody and ... Montlake Boulevard East, Seattle, Washington 9 811 2, USA Anne H Beaudreau School of Aquatic and Fishery Sciences, University of Washington, Box 355020, Seattle, Washington 9 819 5, USA Donald A Larsen,...
Ngày tải lên: 04/09/2015, 17:15
Social Phobia as a Consequence of Brain Defects
... formulation, the physical complaints typical of social phobia, are associated with rapid release of catecholamines (noradrenaline, adrenaline, and/or dopamine) and are assumed to reflect a pronounced ... releasing agent fenfluramine (Tancer, Mailman, Stein, Mason, Carson, & Goldeen, 19 94) The NE system has been probed by Brain Defects 15 1 administration of the a2 A (alpha 2A) agonist clonidine (Tancer, ... (accepting) accepting and negative and neutral expresssions: activation accompanied by in amygdala, evaluation of: hippocampus, Task performance: parahippocampal recognition of gyrus, medial type of emotion...
Ngày tải lên: 01/11/2013, 08:20
Social Phobia as a Consequence of Cognitive Biases
... grounds as an instance of a ‘‘category mistake.’’ According to Ryle (19 49) this logical fallacy consists of treating the label for a class of events as if it were a member of that class From this vantage ... let alone as evidence of a bias However that may be, this putative ‘‘bias’’ is assigned a role of some importance as it is proclaimed to necessitate a correction by means of cognitive therapy ... treated as if originating in a scale of equal intervals This violates the basic postulates of the analysis of variance The relevant data should have been properly treated through some form of...
Ngày tải lên: 01/11/2013, 08:20