1 4 step at 840 rpm with a high anti windup gain

... Tel: 49 -89-627 - 14 4- 0 Fax: 49 -89-627 - 14 4- 44 Korea - Daegu Tel: 82-53- 744 -43 01 Fax: 82-53- 744 -43 02 Italy - Milan Tel: 39-03 31- 742 611 Fax: 39-03 31- 46 67 81 Atlanta Duluth, GA Tel: 678-957-9 6 14 Fax: ... 91- 80-3090 -44 44 Fax: 91- 80-3090 -40 80 India - New Delhi Tel: 91- 11- 41 6 0-86 31 Fax: 91- 11- 41 6 0-8632 Austria - Wels Tel: 43 -7 242 -2 244 -39 Fax: 43 -7 242 -2 244 -393 Denmark - Copenhagen Tel: 45 -44 50-2828 Fax: 45 -44 85-2829 ... Q 1A Q 2A Q 1A Q 2A Q 1A Q 2A Q 1A Q 2A Q1B Q2B Q1B Q2B Q1B Q2B Q1B Q2B FIGURE 12 : FAST DECAY PWM TIMING DIAGRAM Drive FIGURE 14 : Decay Drive PWM1H1 PWM1H1 PWM1L1 PWM1L1 PWM1H2 PWM1H2 PWM1L2 PWM1L2 TABLE...

Ngày tải lên: 11/01/2016, 16:55

... Simulations with Matlab Antonio Valderrábano González1, Juan Manuel Ramirez2 and Francisco Beltrán Carbajal3 1Universidad Politécnica de la Zona Metropolitana de Guadalajara, 2Cinvestav, Unidad ... 10 .8 V rms; M 11 = 0. 04 400 V -40 0 0 .48 33 0 .48 75 0 .4 917 0 .49 58 0.5 0 .49 58 0.5 0 .49 58 0.5 ia (t) A 21 - 21 0 .48 33 0 .48 75 0 .4 917 ea (t) A 2.82 -2.82 0 .48 33 0 .48 75 0 .4 917 Time(sec) Fig 13 Effect of ... Deterministic ATC calculation methods, determine ATC for definite time and certain environment Straight forward implement, easy and fast are most Available Transfer Capability Calculation 14 5 important...

Ngày tải lên: 09/08/2014, 16:21

... He said he was from Jamaica; and I said, "I suppose you have been free a long 14 time?" to which he, replied, with great energy, "Before I was born, I was free," and repeated it again and again,—"before ... Burial-Place.—Chinese Miners.—Umatilla.—Walla Walla.—Sage-Brush and Bunch-Grass.—Flowers in the Desert.—"Stick" Indians.— Klickatats.—Spokane Indian.—Snakes.—Dead Chiefs. A Kamas-Field.—Basaltic ... Bay stations, kept by Angus McDonald, an old Scotchman, who has been there for a great many years He is an educated gentleman, of a great deal of character and intelligence; and his wife is an...

Ngày tải lên: 22/03/2014, 22:20

... (AAAGGGCCAACAGTTGTTTC); CLN1, CK 215 8 (TAGGGTAGCGTGCCACAAAA) and CK 215 9 (CGTCT CTTGCAGGCTGAACA); PCL1, CK23 64 (GCTAACAA CTGAGAATGCGA) and CK2366 (ACACAAGAGTTAA GGACAAG) The primers used for the amplification ... fragments from the coding regions were: CLN2, CK17 24 (ATAGTGATGCCACTGTAGAC) and CK1725 (CATGATGGGGTTGATATGGT); CLN1, CK22 54 (TAGTTCACCGCAAAGTACTG) and CK2255 (TATTGTAGAGGCCAGTTGCA); PCL1, CK2 348 ... ura3D0 a MAT alpha, cdc28 -13 (congenic to W303) MATa, MATa, pep4 :: URA3 (congenic to W303) MATa, cln3::URA3 (congenic to W303) MATa, [YEplac1 81] MATa, cln3::URA3, [YEplac1 81] MATa, cln3::URA3...

Ngày tải lên: 23/03/2014, 05:22

... back to this issue again and again We are just using this example as a prologue Typically in a class on differential equations, we learn to transform a linear ordinary equation into an algebraic ... that we can write H1 a = H1 G d = [G G ] d G4 That is, to maintain the same information at the location a, we must divide the branch-off information at C by G4 Similarly, we note that at the position ... (s + a) (s + a) (s + a) n s (s + a) (s + a) (s + b) s (s + a) s (s + a) (s + b) s (s + a) (s + b) f(t) e at t e at t n – 1e – at (n – 1) ! (1 – e – at) a (e – at – e – bt) b a (1 – at) e – at (be...

Ngày tải lên: 01/04/2014, 10:57

... Illustrative Examples 5.5 .1 Example 5.5.2 Example 5.5.3 Example 5.5 .4 Example Summary 10 1 10 2 10 5 10 9 11 5 11 5 11 8 12 2 12 2 12 4 12 7 13 7 13 8 6 .1 6.2 Quantized Fault Detection with Mixed Time-Delays and Packet ... ˆ 11 ˆ ϒ 21 ∗ ˆ ϒ22 < 0, (2. 34) and T P1k +1 + P2k +1 − P3k +1 − P3k +1 − k +1 (2.35) are satisfied with the parameters updated by ˆ 1 Mk +1 = Mk +1 and ˆ 1 Nk +1 = Nk +1 , where ∗ ¯ 22k , 11 = ¯ 11 k ... part by the National 973 Project under Grant 2009CB320600, the National Natural Science Foundation of China under Grants 612 7 315 6, 611 340 09, 610 040 67, and 611 0 41 2 5, the Engineering and Physical...

Ngày tải lên: 24/04/2014, 15:12

... calculated The nature of the data collected provided for a matchedpair analysis, as each subject has had both a TBST and a QFT Utilizing the discordant pairs (a matched pair in which the outcomes are ... proposal, IRB approval, data collection, data analysis, and writing the final paper All authors actively participated in reviewing/editing of the final paper for submission Acknowledgements The Authors ... (%) κ statistic p-value 56.9 0 .11 45 0. 016 8 57.9 0 .15 67 0.0 011 54. 6 0.05 94 0 .12 73 p-value 0.0379 0.0 049 0. 816 4 Sensitivity (%) Specificity (%) PPV (%) NPV (%) Kappa McNemar's Page of (page number...

Ngày tải lên: 20/06/2014, 00:20

... then p1 a1 p ··· p2 a2 p p pn an − a 11 a2 2 · · · ann ≥ P with equality for a1 a2 · · · an When Qi √ ak , ak ak · · · an · · · ak 1 √ ak − √ , 2 .15 Rk , equality holds again for a1 a2 ··· , ... Applications with equality for ··· a2 a1 In the case i , an−i ··· an−i an , 2.27 an−i an−i ··· 1, from 2.26 , we get a1 a2 · · · an ≥ √ n n a1 a2 · · · an a1 /an 2/n an /a1 , 2.28 with equality for a2 a3 ... let p1 , p2 , , pn be positive real numbers such that p1 p1 a1 p2 a2 p ··· p pn an p a 11 a2 2 · · · ann ≥ Qi ai , ak ··· 2. 21 ak 1 p2 , Q i aRk k 2.22 with equality for a1 Remark 2 .11 For p1 ···...

Ngày tải lên: 21/06/2014, 07:20

... performance of CPM Impact of PA nonlinearity for different backoffs 10 0 10 1 10 1 BER BER 10 −2 10 −2 10 −3 10 −3 10 4 10 4 10 12 14 16 18 20 Average received Eb /N0 (dB) AWGN bound No quantization ... International Conference on Universal Personal Communications, vol 2, pp 6 31 635, Ottawa, Ont, Canada, October 19 93 [ 14 ] A A M Saleh and R A Valenzuela, “Statistical model for indoor multipath ... precoder 10 1 Bit error rate () 10 0 10 1 Bit error rate () 10 0 10 −2 10 −2 10 −3 10 4 10 −3 10 15 Average received Eb /N0 (dB) 20 10 4 25 K = −20 dBc K = 16 dBc AWGN bound No phase noise K = − 24 dBc...

Ngày tải lên: 22/06/2014, 19:20

... for the base stations (with dual-polarized antennas each): indoor colocation (a) , indoor medium spatial separation (b), indoor opposite location with larger separation (c), and outdoor location ... “Design and ı ı evaluation of a compact antenna array for MIMO applications,” in Proceedings of IEEE Antennas and Propagation Soci- [15 ] [16 ] [17 ] [18 ] [19 ] [20] [ 21] ety International Symposium, ... due to spatial separation, even though the spacing is larger: while the lowest average correlation coefficient is obtained for antennas pairs with spatial and polarization diversities (1 4 and 2-3),...

Ngày tải lên: 22/06/2014, 22:20

... D1 Frame QP Sequence Frames Frame rate range length encoded type 30 30 30 30 30 30 30 30 30 20 44 382 20 44 300 20 44 300 20 44 300 20 44 300 20 44 44 9 20 44 10 65 20 44 300 20 44 300 10 0 10 0 10 0 ... Mother daughter 43 .02 16 79660 0.96 1. 13% JM 9.3 FQP 17 6730 −0. 24 0. 01% 41 . 46 16 17 1370 −0.59 −3.02% 41 . 7 16 17 345 0 −0.35 1. 84% JM 9.3 FQP 41 . 78 20 743 400 JM 9.3 RC 41 . 88 16 743 610 0 .1 PRC w/o ... refinement 24 .15 25.2 25.02 25.23 44 40 40 40 28630 28790 28 210 28320 Stefan JM 9.3 FQP JM 9.3 RC PRC w/o QP refinement RC with QP refinement 24 . 14 24 .13 24 .17 24. 33 44 40 40 40 72080 72270 718 40 7 213 0...

Ngày tải lên: 22/06/2014, 23:20

... irregular waves NLSW cannot model a vertical wall because the shallow water limit is violated, a pragmatic manipulation of the wall geometry is necessary The author used two 11 pragmatic approaches: ... numerical wave flume) is able to simulate the interaction between wave – wall and flow at structures of any shape (vertical walls, hollow walls …), from wave generation at boundary to wave propagation ... deviation of  63.2%) and 12 9 .4% ( 10 0.6%) for PA1 and PA2, respectively The results from COBRAS-UC and measurements match relatively well with a mean error 39.7% (a standard deviation of  24. 5%)...

Ngày tải lên: 25/07/2014, 17:34

... Basal area Height Diameter Age Mean annual apical growth (trees·ha 1) LV1 Species (m2·ha 1) (m) (cm) (yr) (cm·yr 1) 3.39 (1. 87) A Living 83 43 23 21. 9 3.20 (1. 58) A 7 .1 (3.8) A 10 4 (42 ) A Dead ... vegetation patches (Fig 1) It is also at this interface that the mean annual apical growth was highest (Fig 5), the maximum growth rate being 19 .3 cm·yr 1 for pine and 18 .0 cm·yr 1 for spruce Spatio-temporal ... Picea mariana and Larix laricina seedlings, Can J For Res 16 (19 86) 12 01 12 06 [29] Lieffers V.J., Rothwell R.L., Rooting of peatland black spruce and tamarack in relation to depth of water table,...

Ngày tải lên: 08/08/2014, 01:21

... 52 IIA-R dAATCCCAGAAATTCTCCCG IIA-H dAATCCCAGAAATTCTCCCA IIIB-NA1F dCAGTGGTTTCACAATGTGAA IIIB-NA1R dATGGACTTCTAGCTGCACCG IIIB-NA1PR dGTCTCTTTCTGCTTGGTGATGG IIIB-NA1PR dTTTTCCCCTCTAAACTGGG Sequencing ... dCCCATCCAACCCTGG IIB-E6SR dGGCAGATTCCTCAGCAAATCA 56 FCGR2B (3'UTR) IIB-UTRSF dTGGGGAGGACAGGGAGAT IIB-UTRSR dATCACTTTTAATGTGCTGGTAGAGG 63 PCR1 dGGAGAAACCATCATGCTGAG 4INM dCAATTTTGCTGCTATGGGC 52 IIA-R ... MCSD1 Statistical analyses Statistical analyses were performed using the Stata statistical software (Stata Statistical Software, release 8.0; Stata Corporation, College Station, TX, USA) unless...

Ngày tải lên: 09/08/2014, 07:20

... ± 0 .15 7 g/cm2 at baseline and 0.780 ± 0 .17 4 g/cm2 year later) in the nonresponders and -0 .4% (0. 840 ± 0 . 14 2 g/cm2 at baseline and 0.836 ± 0 . 14 1 g/cm2 year later) in responders (Figure 1) Accordingly, ... European League Against Rheumatism response criteria for rheumatoid arthritis Comparison with the preliminary American College of Rheumatology and the World Health Organization/ International League ... serum of rheumatoid arthritis patients and their normalization after anti- tumor necrosis factor alpha treatment Arthritis Rheum 2002, 46 :17 44 -17 53 Page of (page number not for citation purposes)...

Ngày tải lên: 09/08/2014, 10:20

... the data and reviewed all iterations of the paper DW and AH designed the study AH and RS analyzed the data DW and RS supervised the clinical sample and data collection DW treated all cases AH and ... 75:23-27 Franchi L, Baccetti T, McNamara JAJ: Treatment and posttreatment effects of acrylic splint Herbst appliance therapy Am J OrthodDentofacial Orthop 19 99, 11 5 (4) :42 9 -43 8 Flores-Mir C, Ayeh A, Goswani ... Foundation for Statistical Computing, Vienna, Austria 2009, [http://www.R-project.org] Dahlberg G: Statistical methods for the medical andbiological students Allen and Unwin 19 40 doi :10 .11 86 /17 46 -16 0X-6-3...

Ngày tải lên: 11/08/2014, 20:20

... since we are not actually connected to a patient Also, the ECG waveform is played back at a slower rate because µC/Probe doesn’t sample the data from the target fast enough to play the data at live ... much signal you can capture on your ‘scope’ Step 4. 5 Change the mode to ‘Trig Mode’ and repeat step 4. 4 Step 4. 6 Make sure you clap for at least minute In fact, you can also shout and say something ... points of the array are read and displayed at once It’s the application’s responsibility to update the array, whether circularly or once New Workspace Step 3 .1 Create a ‘New Workspace’ by clicking...

Ngày tải lên: 22/06/2015, 14:19

... intention states (active and passive) are defined to indicate that the human partner leads and follows, respectively In [73], 1. 4 Trajectory Adaptation a crane robot is designed to aid the walking ... to have a straightforward formulation and be feasible for a general class of applications As such the desired parameters of the impedance model can be obtained and a desired interaction behavior ... in human-human collaboration usually keep communicating with each other through kinds of medias In a typical physical humanrobot collaboration, force and position sensors are available and they...

Ngày tải lên: 08/09/2015, 18:23