1 nicotinamide plays a key role in cellular energy metabolism

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... production in a similar manner, indicating that it may generally in uence monocyte in ammatory cytokine responses to LPS Our results suggest that acyltransferases play a key role in the production of in ammatory ... level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There was a background level ... originally described as a CoA-independent acyltransferase inhibitor [16], was included as it inhibits both LPCAT and LPAAT in MonoMac cells with IC50 values of 10 lM and 30 lM, respectively (data...

Ngày tải lên: 31/03/2014, 01:20

7 324 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

... increasing hydrogen ion concentration, involving a proton-catalysis by the distal (a5 8) histidine with pKa ˆ 6.2, as with the separated chains The value of ks also increased with increasing hydrogen ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against ... evidence suggests that the a1 b1 interface is much more important in maintaining normal hemoglobin stability than is the a1 b2 interface As a matter of fact, hemolytic anemia is known to result...

Ngày tải lên: 31/03/2014, 15:20

10 651 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi ... 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant sulfur response and metabolism Plant Cell 2006,...

Ngày tải lên: 11/08/2014, 11:21

10 431 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

... trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP ... observed with the single-cysteine-containing isoforms Obtaining full labelling and its accurate quantitation are difficult to achieve in practice, resulting in occasional instances where values for the ... Crowley et al reflect localization at the membrane–solute interface There was no alteration in the extent of labelling by BM in any conformational state examined In contrast, there was a dramatic reduction...

Ngày tải lên: 06/03/2014, 22:21

12 381 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

... Hishida et al fad49 plays a crucial role in adipogenesis KS+ (Stratagene, Agilent Technologies, Santa Clara, CA, USA) and analyzed by DNA sequencing as described below (Amersham Biosciences) and ... maintained in all cases (data not shown) The deduced protein primary structure of mouse and human fad49 The ORF of fad49 encodes a putative protein of 910 amino acids that contains a PX domain ... the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using a random primer and ReverTra Ace (Toyobo, Osaka, Japan) The cDNA was used as a template for quantitative...

Ngày tải lên: 16/03/2014, 04:20

13 385 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-3¢ for Akr1b8; ... primers were as follows: 5¢-CCCCTTACAGCTCTG CTTCATT-3¢ and 5¢-TCAAGAATGGATACACATAAA CACAAGGA-3¢ for Cyp2c29; 5¢-CCAGCTCTGCTTCAT TCCTCTCT-3¢ and 5¢-CGCAGGAATGGATAAACATA AGCA-3¢ for Cyp2c38; 5¢-ACTTCTCTGTGGCAAGCCC...

Ngày tải lên: 16/03/2014, 14:20

9 285 0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

... By using NSC23766, our group recently unraveled a Ca2+ -dependent pathway regulating secretion in thrombin-stimulated human platelets linking Rac1 activation to actin dynamics: Calcineurin®Rac1 ... Such a broad inhibitory profile of a Rac1 inhibitor suggests that pharmacological targeting of Rac1 is an interesting approach for developing future antiplatelet drugs Methods Materials Acetylsalicylic ... was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was determined by impedance...

Ngày tải lên: 18/06/2014, 16:20

10 441 0
báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

... signaling is associated with the pathways that lead to NFB activation and pro-inflammatory responses In contrast, TLR signaling pathways that activate IRFs can induce antiinflammatory mediators ... influencing pro-inflammatory cytokine production [3,31] In particular, administration of the NFB inhibitor Tat-NEMO Binding Domain provided protection against hypoxia-ischemia in neonatal rats ... Shizuo Akira (Osaka University, Osaka Japan) and were bred in our facility All mice were housed in an American Association for Laboratory Animal Careapproved facility Procedures were conducted according...

Ngày tải lên: 19/06/2014, 22:20

12 217 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

... 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ activated at 95°C for 10 minutes followed by 45 cycles of denaturing at ... according to a previously published and validated grading system where = no staining, = weak staining, = moderate staining, = strong staining, = very intense staining [6,13,17] Histopathology Pathological ... Animal work and handling were complied with the National Health and Research Council (Australia) Code of Practice for Animal Care in Research and Teaching (2004) [13] RNA extractions Total RNA was...

Ngày tải lên: 09/08/2014, 08:22

8 335 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, ... TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The NheI-BamHI...

Ngày tải lên: 13/08/2014, 01:20

12 339 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

... RXRA, S10 0A8 , S10 0A9 , SERPINB1, SLC1 0A1 , SMPDL 3A, SULT 2A1 , TANK, UBN1 G Lipid metabolism Drug metabolism ACAA1, ACACB, ADH 1A, ADH1B, ADH1C, ADM, AGT, AMACR, ATP 1A1 , CFH, DBP, DHCR7, EHHADH, FASN, ... transport Proc Natl Acad Sci USA 2001, 98:5306-5311 Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi ... Hamakubo T, Naito M, Auwerx J, Yanagisawa M, Kodama T, Sakai J: Activation of peroxisome proliferator-activated receptor delta induces fatty acid betaoxidation in skeletal muscle and attenuates...

Ngày tải lên: 14/08/2014, 08:20

14 385 0
Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf

Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf

... Mohapatra SS: Role of natriuretic peptide signaling in modulating asthma and inflammation Can Physiol Pharmacol 2007, 85:754-9 Piechota M, Banach M, Jacon A, Rysz J: Natriuretic peptides in cardiovascular ... NPRA-/- mice had little lung inflammation, suggesting that NPRA signaling in DCs plays a critical role in allergic Zhang et al Genetic Vaccines and Therapy 2011, 9:3 http://www.gvt-journal.com/content/9/1/3 ... of NPRA signaling on innate and adaptive immunity occur through NPRA-mediated alterations in gene expression in DCs Little is known about the role of NPRA signaling in innate immunity and about...

Ngày tải lên: 14/08/2014, 19:22

12 268 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

... Peters et al [52] in Australia using an LCA analyses considered three scenarios; (1) a sheep meat supply chain in Western Australia, (2) a beef supply chain in Victoria, Australia producing organic ... in the data available to suggest organic dairy systems management is significantly beneficial It must be noted, however, that Canadian and North American data is particularly scarce Sustainability ... offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and GHG efficiency...

Ngày tải lên: 08/03/2014, 23:20

41 527 1
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... D-galactose, D-galactobiose and D-galactotetraose were used as standards to identify the D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides ... 4.5 No activity of GALA could be detected against any of the transgalactooligosaccharides listed in Materials and methods Purification and characterization of GALA Hydrolysis of arabinogalactans...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

Extracellular signal-regulated kinase 1/2 plays a pro-life role in experimental brain stem death via MAPK signal-interacting kinase at rostral ventrolateral medulla pps

... Pharmacological blockade was again used to ascertain that these temporally correlated biochemical changes are causally linked to MEK1/2 or ERK1/2 activation in RVLM during experimental brain ... Bonventre JV, Alessandrini A: Intravenous administration of MEK inhibitor U0126 affords brain protection against forebrain ischemia and focal cerebral ischemia Proc Natl Acad Sci USA 2001, 98:11569-11574 ... the MEK/ ERK/MNK cascade in RVLM plays a pro-life role during experimental brain stem death by sustaining the central cardiovascular regulatory machinery via NOS I/PKG signaling Acknowledgements...

Ngày tải lên: 10/08/2014, 05:21

9 202 0
Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

... 5¢-GATTCTTAGCAGGTTCATCGCCATCT-3¢ 5¢-TGCACACACTTGGACAGAACAC-3¢ 5¢-GCGAAAACCTAGCTTGGGGAAG-3¢ 5¢-TATATAACGTGAAATGGACGC-3¢ 5¢-GAAGCTCTTCAGGAGGCACTTCCT-3¢ 5¢-CAATGGTGGGTACGCAGAGAGGAT-3¢ 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ ... 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ 5¢-AGAAAGTACAAATATCCATTC-3¢ 5¢-GAATTTAGTGATGGGCATGCTCCTG-3¢ 5¢-AGTAATCTTATCAGATTCACCAC-3¢ RT-PCR The constitutively expressed gene in tobacco, EF 1a, was also subjected to RT-PCR at ... NtKTI1 displays obviously antifungal activity against R solani, Rh nigricans and P parasitica var nicotianae, but does not inhibit F oxysporum, Physalospora piricola, Alternaria alternata, Magnaporthe...

Ngày tải lên: 23/03/2014, 03:20

13 501 0
Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

... FAM – AGG GGT CCT GGC TGC CTT CCT CTT C – TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA ... PDAR PDAR PDAR 99.65% P16INK 4a 5' GGC TCT ACA CAA GCT TCC TTT CC 3' 5' FAM – CCC CCA CCC TGG CTC TGA CCA – TAMRA 5' TCA TGA CCT GCC AGA GAG AAC A 3' 99.22% MMP-13 5' CCC CAG GCA TCA CCA TTC AAG ... study, and participated in interpretation of data and extensive prepa- 13 14 Luoma K, Riihimaki H, Luukkonen R, Raininko R, Viikari-Juntura E, Lamminen A: Low back pain in relation to lumbar disc...

Ngày tải lên: 09/08/2014, 10:20

12 618 0
báo cáo khoa học: " Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses" ppt

báo cáo khoa học: " Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses" ppt

... (TaKaRa, Dalian, China) using the primers 5’-TAC CAT GGA CAT GTT TAC TAT GAA TCA ATT-3’ (Nco I site underlined) and 5’-ATA CTA GTT TAA AAT GAG TAA CTC CAC A- 3’ (Spe I site underlined) An NcoI-SpeI ... threat and maintain osmotic balance, such as the anthocyanin and isoflavone pathways were induced, indicating an active response and defense mechanism protects the plant against external abiotic ... fragment containing MtCBF4 cDNA was inserted into pCAMBIA1302 containing the 35S CaMV promoter and a hygromycin (kanamycin) resistance marker The plasmid was introduced into Agrobacterium EHA105...

Ngày tải lên: 11/08/2014, 11:21

19 591 0
báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx

báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx

... ripening-associated patterns for aromatic and branched chain amino acid-, fatty acid-, and furanrelated classes, with a peak at the S3/Br stages and a more or less pronounced decline at later ripening ... peach and grape fruits J Plant Physiol 2009, 166:1241-1252 Han SY, Kitahata N, Sekimata K, Saito T, Kobayashi M, Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K, Yoshida S, Asami T: A novel inhibitor ... -Carotene -Carotene LCY-B -Carotene CHY-B -cryptoxanthin CHY-B LCY-B -Carotene CHY-E -cryptoxanthin CHY-B Lutein Zeaxanthin VDE ZEP Antheraxanthin VDE Mutatoxanthin, Auroxanthin ZEP Violaxanthin...

Ngày tải lên: 11/08/2014, 11:21

14 303 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... extracellular Ca2+ the sustained rise in intracellular Ca2+ seen following agonist stimulation is reduced, an effect mimicked by a range of di and tri-valent cations including Ni2+, La3+ and...

Ngày tải lên: 12/08/2014, 16:20

8 341 0

Bạn có muốn tìm thêm với từ khóa:

w