1 evidence supporting a genetic basis for cad

Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

... Tsukahara S, Kawaguchi Y, Terai C, Hara M, Tomatsu T, Yamanaka H, Horiuchi T, Tao K, Yasutomo K, Hamada D, Yasui N, Inoue H, Itakura M, Okamoto H, Kamatani N, Momohara S: Association of STAT4 with ... regression analysis was performed under the additive model for the minor allele Assuming a polymorphic site with two alleles A and a, genotypes were encoded as = aa, = Aa, and = AA Population attributable ... Tokyo, Japan Page of (page number not for citation purposes) Arthritis Research & Therapy Vol 10 No Kawasaki et al the genetic background of SLE may be greater in the Japanese population than in Americans...

Ngày tải lên: 09/08/2014, 13:22

9 479 0
Báo cáo y học: "TLR7 single-nucleotide polymorphisms in the 3’ untranslated region and intron 2 independently contribute to systemic lupus erythematosus in Japanese women: a case-control association study" ppsx

Báo cáo y học: "TLR7 single-nucleotide polymorphisms in the 3’ untranslated region and intron 2 independently contribute to systemic lupus erythematosus in Japanese women: a case-control association study" ppsx

... and have opposing inflammatory and regulatory roles in a murine model of lupus Immunity 2006, 25:417-428 Komatsuda A, Wakui H, Iwamoto K, Ozawa M, Togashi M, Masai R, Maki N, Hatakeyama T, Sawada ... Human Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba 305-8575, Japan Department of Rheumatology, Clinical Research Center for Allergy and Rheumatology, Sagamihara National Hospital, National ... National Hospital Organization, 18-1 Sakuradai, Minami-ku, Sagamihara 252-0392, Japan 3Division of Clinical Immunology, Doctoral Program in Clinical Sciences, Graduate School of Comprehensive Human...

Ngày tải lên: 12/08/2014, 15:22

8 342 0
Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx

Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx

... studies J Rheumatol 2005, 32:1139-1142 Kizawa H, Kou I, Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, et al.: An aspartic acid repeat polymorphism in asporin inhibits ... medical evaluation as OA) Radiographic exploration was not performed in controls This study was approved by the Ethical Committee for Clinical Research of Galicia and all cases and controls gave ... the samples and participated in the design and analysis of the study, MP-S, ML and JJG-R evaluated the patients, and AG coordinated the study and participated in its design and analysis Acknowledgements...

Ngày tải lên: 09/08/2014, 07:20

4 431 0
Báo cáo y học: "Association of single-nucleotide polymorphisms in RHOB and TXNDC3 with knee osteoarthritis susceptibility: two case-control studies in East Asian populations and a meta-analysis" docx

Báo cáo y học: "Association of single-nucleotide polymorphisms in RHOB and TXNDC3 with knee osteoarthritis susceptibility: two case-control studies in East Asian populations and a meta-analysis" docx

... Rheumatol 2007, 19:429-434 Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A functional ... not associated with hip osteoarthritis in a United Kingdom Caucasian population Osteoarthritis Cartilage 2006, 14:295-298 18 Ikegawa S, Kawamura S, Takahashi A, Nakamura T, Kamatani N: Replication ... A, Kawakami A, Yamamoto S, Uchida A, Nakamura K, Notoya K, Nakamura Y, Ikegawa S: An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases susceptibility to osteoarthritis...

Ngày tải lên: 09/08/2014, 10:23

6 439 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

... 11 7A: 136-142 20 Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A functional polymorphism ... Yoshida A, Tominaga S, Nagano J, Shimizu A, Wakana S, Gondo Y, Noda T, Shiroishi T, Ikegawa S: A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis impairs joint formation and causes ... JR, Savarirayan R, White SM, Graham JM Jr, Gale RP, Svarch E, Newman WG, Kleckers AR, Francomano CA, Govindaiah V, Singh L, Morrison S, Thomas JT, Warman ML: The mutational spectrum of brachydactyly...

Ngày tải lên: 09/08/2014, 13:22

5 447 0
Báo cáo y học: "Association between occupational exposure to mineral oil and rheumatoid arthritis: results from the Swedish EIRA case–control study" docx

Báo cáo y học: "Association between occupational exposure to mineral oil and rheumatoid arthritis: results from the Swedish EIRA case–control study" docx

... mineral oils compared with unexposed men aAdjusted for age and residential area bAdjusted for age, residential area and smoking The presence of HLA-DR SE genes is a risk factor for RF+ RA and anti-CP+ ... kinds of mineral oils compared with unexposed men aRF status unknown for one unexposed case bAdjusted for age and residential area cAdjusted for age, residential area and smoking according to ... RA as compared with anti-CP- RA was seen for all the specific mineral oils The RR of developing anti-CP+ RA associated with In the analysis, adjustment was made according to age, residential area...

Ngày tải lên: 09/08/2014, 07:20

8 373 0
Báo cáo y học: "Association of functional variants of PTPN22 and tp53 in psoriatic arthritis: a case-control study" docx

Báo cáo y học: "Association of functional variants of PTPN22 and tp53 in psoriatic arthritis: a case-control study" docx

... Toronto Informed consent was obtained from all patients All PsA probands were Caucasians Information was collected systematically and included age at onset of psoriasis and PsA, and disease pattern ... mean age at onset of the study was 49.7 years The mean age at onset of psoriasis was 29.3 years (standard deviation 14.2 years) and the mean age at onset of PsA was 38.1 years (standard deviation ... mean age at onset of psoriasis was 26.8 years (standard deviation 12.1 years) and the mean age at onset of PsA was 33.0 years (standard deviation 10.8 years) Forty-four per cent of the PsA patients...

Ngày tải lên: 09/08/2014, 07:20

3 327 0
Báo cáo y học: "Association of the microsatellite in the 3'''' untranslated region of the CD154 gene with rheumatoid arthritis in females from a Spanish cohort: a case-control study" ppsx

Báo cáo y học: "Association of the microsatellite in the 3'''' untranslated region of the CD154 gene with rheumatoid arthritis in females from a Spanish cohort: a case-control study" ppsx

... alleles, was as homogeneous as that in the 24CAs samples, validating our stratification of patients by 24CAs allele A similar pattern was also observed in healthy individuals, although a statistical ... Gotoh H, Kawaguchi Y, Harigai M, Hara M, Saito S, Yamaguchi T, Shimada K, Kawamoto M, Tomatsu T, Kamatani N: Increased CD40 expression on articular chondrocytes from patients with rheumatoid arthritis: ... Rheumatology criteria were enrolled at the Rheumatology Unit at the Dr Negrin General Hospital from Gran Canaria (Canary Islands, Spain) The median age at onset of RA was 45 years (interquartile...

Ngày tải lên: 09/08/2014, 10:21

11 457 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... primers for MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and ... susceptibility Rheumatology (Oxford) 2007, 46:426-430 Martinez A, Fernandez-Arquero M, Balsa A, Rubio A, Alves H, Pascual-Salcedo D, Martin-Mola E, de la Concha EG: Primary association of a MICA allele with...

Ngày tải lên: 09/08/2014, 14:20

11 460 0
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt

Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt

... that Acadian ethnicity was a confounding variable, we compared rates of the T allele in non-Acadian patients with Crohn's disease to those of non-Acadian controls (Table 4) In this analysis, patients ... groups (Acadian) than in others (African American) In the case of Crohn's patients of Acadian descent, the rate of the T allele (47% vs 23%) was significantly higher than the rate of the T allele ... disease Nat Genet 2004, 36:471-5 Tokuhiro S, Yamada R, Chang X, Suzuki A, Kochi Y, Sawada T, Suzuki M, Nagasaki M, Ohtsuki M, Ono M, Furukawa H, Nagashima M, Yoshino S, Mabuchi A, Sekine A, Saito...

Ngày tải lên: 11/08/2014, 10:23

8 297 0
báo cáo khoa học: " The association of aggressive and chronic periodontitis with systemic manifestations and dental anomalies in a jordanian population: a case control study" pdf

báo cáo khoa học: " The association of aggressive and chronic periodontitis with systemic manifestations and dental anomalies in a jordanian population: a case control study" pdf

... distolingual/palatal) Inter-examiner reliability was calculated using alpha statistics with regard to probing depth and CAL on 16 quadrants Diagnosis of CP and AP was based on CAL values and confirmed radiographically ... http://www.head-face-med.com/content/6/1/30 Page of Table HAD Scale for Anxiety and Depression among the study population Variables CP AP Controls Table Dental Anomalies in CP and AP Dental Anomaly Site CP AP Controls No (% )a P values ... collection and patient examination, and contributed to writing of the manuscript JAK put forward the research design and participated in data analysis YSK carried out the statistical analysis All authors...

Ngày tải lên: 11/08/2014, 20:20

8 290 0
báo cáo khoa học:" Lack of association between celiac disease and dental enamel hypoplasia in a case-control study from an Italian central region" pdf

báo cáo khoa học:" Lack of association between celiac disease and dental enamel hypoplasia in a case-control study from an Italian central region" pdf

... Sangianantoni A, D'Angio F, Santarelli A, Lo Muzio L: Oral aphthous ulcers and dental enamel defects in children with coeliac disease Acta Paediatr 2006, 95(2):203-207 Majorana A, Sapelli PL, Malagoli ... Paediatric Department of the University Politecnica of Marche (Ancona, Italy), and the diagnosis of CD was based on serological tests (Ab-htTG IgA, Ab-htTG IgG, AGA IgA, AGA IgG, EMA IgA, EMA IgG), ... N, Malhotra V: Adult celiac disease in northern India Indian J Gastroenterol 2003, 22(4):124-126 Lahteenoja H, Toivanen A, Viander M, Maki M, Irjala K, Raiha I, Syrjanen S: Oral mucosal changes...

Ngày tải lên: 11/08/2014, 23:22

6 309 0
Báo cáo y học: "Association between occupation and knee and hip replacement due to osteoarthritis: a case-control study" doc

Báo cáo y học: "Association between occupation and knee and hip replacement due to osteoarthritis: a case-control study" doc

... data analysis and drafting the manuscript JF, TI and SL conceived the study TI, ME and SL revised the manuscript All authors participated in data analysis and all authors approved the final version ... significant A sex-stratified multivariable logistic regression model with occupation as the exposure variable and case-control status as the dependent variable adjusted for age and BMI was done For ... the addition of recreational physical activity as a covariate and the results presented remained essentially the same Total knee or hip joint replacement for OA and occupation in men The mean age...

Ngày tải lên: 12/08/2014, 14:21

9 299 0
Báo cáo y học: "Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese" potx

Báo cáo y học: "Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese" potx

... transplantation in a tendon defect: a biomechanical study Knee Surg Sports Traumatol Arthrosc 2008, 16:333-339 19 Yamada S, Tomoeda M, Ozawa Y, Yoneda S, Terashima Y, Ikezawa K, Ikegawa S, Saito ... repeat protein family closely related to decorin and biglycan J Biol Chem 2001, 276:12201-12211 15 Kizawa H, Kou I, Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto ... Toyosawa S, Murakami S: PLAP-1/asporin, a novel negative regulator of periodontal ligament mineralization J Biol Chem 2007, 282:23070-23080 20 Tomoeda M, Yamada S, Shirai H, Ozawa Y, Yanagita M,...

Ngày tải lên: 12/08/2014, 15:22

5 273 0
Báo cáo y học: "Attributable mortality of Acinetobacter baumannii infections in critically ill patients: a systematic review of matched cohort and case-control studies" doc

Báo cáo y học: "Attributable mortality of Acinetobacter baumannii infections in critically ill patients: a systematic review of matched cohort and case-control studies" doc

... medical and surgical ICU in Spain [20] Falagas et al [21] Available online http://ccforum.com/content/10/2/R48 A baumannii (cases) with the outcomes of matched patients without A baumannii isolation ... addition, Garrouste-Orgeas and colleagues [23], in a 1-year prospective observational survey, evaluated the clinical effect of salivary or rectal carriage of multi-resistant Acinetobacter baumannii and/ ... that A baumannii bacteremias are as severe as other Gram-negative bacteremias and thus may result in considerable mortality Page of (page number not for citation purposes) Some of the investigators...

Ngày tải lên: 12/08/2014, 23:23

8 324 1
THE VALUE OF RE USING PRIOR NESTED CASE CONTROL DATA IN NEW STUDIES WITH DIFFERENT OUTCOME

THE VALUE OF RE USING PRIOR NESTED CASE CONTROL DATA IN NEW STUDIES WITH DIFFERENT OUTCOME

... saved and the average and variance of the log hazard ratio estimates across 500 datasets were calculated The relative efficiency was calculated as the ratio of the empirical variance of the log hazard ... be balanced against the additional efforts required for non-standard data analysis We want to emphasize that we used a limited range of parameters for our simulation; researchers need to be cautious ... only available prior data Table 3.3 Average estimates of the statistical efficiencies of analyses that use only data from study B relative to analyses that include prior data from study A with...

Ngày tải lên: 12/10/2015, 17:36

84 202 0
 Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

... given indication Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers The possible explanations may be: ... equivalence in esophagus cancer, stomach cancer, liver cancer, pancreas cancer, lung cancer cancers, and cancers on the minor sites, whereas the equivalence is uncertain for bladder cancer and ... accurate and validation? Although most clinical study activities are aimed at showing that equivalence can also be claimed for generic versions of innovator drugs and for such diverse entities as...

Ngày tải lên: 26/10/2012, 09:48

9 534 1
Breast cancer risk in relation to occupations with exposure to carcinogens and endocrine disruptors: a Canadian case–control study pptx

Breast cancer risk in relation to occupations with exposure to carcinogens and endocrine disruptors: a Canadian case–control study pptx

... Luginaah I, Laukkanen E, Hellyer D, Reinhartz A, Watterson A, Abu-Zahra H, Maticka-Tyndale E, Schneider K, Beck M, Gilbertson M: Occupation and breast cancer: a Canadian case– control study Ann ... significant elevations for premenopausal breast cancer and laundry/drycleaning for postmenopausal cancer Villeneuve et al [22] analyzed a case–control study (1230 cases) in two departments of France ... Geneva: World Health Organization; 1990 32 Statistics Canada: North American industrial classification system http://www.statcan.gc.ca/subjects-sujets/standard-norme/naics-scian/2002/ naics-scian02l-eng.htm...

Ngày tải lên: 06/03/2014, 02:21

17 462 0
Occupation and Breast Cancer: A Canadian Case–Control Study docx

Occupation and Breast Cancer: A Canadian Case–Control Study docx

... Classification Ottawa, Canada 16 STATISTICS CANADA 1998 North American Industrial Classification System Ottawa, Canada 17 CHECKOWAY, H., N PEARCE & D CRAWFORD-BROWN 1989 Research Methods in Occupational ... research grant from Canadian Breast Cancer Research Foundation—Ontario Chapter 60 BROPHY, J., M KEITH, I LUGINAAH, et al 2003 Occupational histories of breast cancer patients year research grant ... et al.: OCCUPATION AND BREAST CANCER 771 are persistent and bioaccumulate in the adipose tissue.29 A case–control study that controlled for both traditional breast cancer risk factors as well as...

Ngày tải lên: 06/03/2014, 02:21

13 463 0
w