07 lunasin a cancer preventive seed peptide

... Minakata H (2003) Insight into tachykinin-related peptides, their receptors, and invertebrate tachykinins: a review Zool Sci 5, 533–549 Satake H, Ogasawara M, Kawada T, Masuda K, Aoyama M, Minakata ... VII Val-Asn-Pro-Tyr-Ser-Phe-Gln-Gly-Thr-Arg-NH2 Leu-Asn-Ala-Asn-Ser-Phe-Met-Gly-Ser-Arg-NH2 Thr-Val-Ser-Ala-Asn-Ala-Phe-Leu-Gly-Ser-Arg-NH2 Ser-Asp-Ala-Leu-Ala-Phe-Val-Pro-Thr-Arg-NH2 Met-Asn-Ser-Leu-Ser-Phe-Gly-Pro-Pro-Lys-NH2 ... Kanda A, Takahashi T, Satake H & Minakata H (2006) Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated from the common octopus (Octopus vulgaris)...

Ngày tải lên: 19/02/2014, 00:20

... DDBJ/EMBL/GenBank databases under accession number AB081457 Intron Intron Intron Intron CGACAGgtgagt)3069 bpÀcaacagGTATAT TTTTGTgtaaat)146 bpÀcaacagGTATAA AGACGGgtatga)469 bpÀtttcagGTAGTG TGCCAGgtatgt)119 ... 5¢-AI (A/ C)GIATG (A/ C)GIACIGTIA CIAA(T/C)TA(T/C)TT-3¢ (I represents an inosine residue) and 5¢-CA (A/ G)CA (A/ G)TAIATIGG (A/ G)TT (A/ G)TA CAT-3¢, corresponding to amino-acid sequences RMRTVTNYF (at transmembrane ... LRQSQFVGAR-NH2 AAGMGFFGAR-NH2 AAPSGFFGAR-NH2 AAYSGFFGAR-NH2 APSMGFFGAR-NH2 APKMGFFGAR-NH2 [11] More recently, a partial sequence of another putative tachykinin-related peptide receptor, LTKR was also identified...

Ngày tải lên: 21/02/2014, 03:20

... socioeconomic variables such as age, education, marital status, and employment status, and clinical variables such as cancer stage at diagnosis, time after diagnosis, and initial treatment All measures ... information that is congruent with a patient’s needs at that particular time is an important determinant for patient satisfaction and affects health-related quality of life (HRQoL) and anxiety and depression ... criteria a) Age ≥ 18 years (no upper age limit) b) Diagnosed with endometrial or ovarian cancer Exclusion criteria a) Patients with borderline ovarian cancer b) Patients undergoing palliative care...

Ngày tải lên: 05/03/2014, 15:20

... and Bac 2A, show similar activities against Gram-negative bacteria and stronger activities against Gram-positive bacteria [6], and Bac 2A also acts as a potent chemoattractant, inducing chemotaxis ... Salt-resistant homodimeric bactenecin J Y Lee et al antibacterial activity against both Gram-negative and certain Gram-positive bacteria [5] In addition, two linear variants of bactenecin, Bac2S ... obtained with the isolated native peptide, which displayed broad-spectrum antimicrobial activity against Gram-positive and Gram-negative bacteria, and suggests to us that it is probable that native...

Ngày tải lên: 07/03/2014, 06:20

... development CAP-23 accumulates in the neuronal growth cone and has a marked effect on the rearrangement of the actin cytoskeleton [38] An early consequence of CAP-23 accumulation is an increase in dynamic ... NAP-22, as well as a variant of this lipopeptide, Y11L were purchased from BioSource International (Hopkinton, MA, USA) Phospholipids and cholesterol were purchased from Avanti Polar Lipids (Alabaster, ... Kropolova ES, Novitskaya VA, Bogdanova MN & Mosevitsky MI (2003) Natural N-terminal fragments of brain abundant myristoylated protein BASP1 Biochim Biophys Acta General Subj 1622, 14–19 Widmer F & Caroni...

Ngày tải lên: 07/03/2014, 17:20

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide at which ... Makovitzki A, Avrahami D & Shai Y (2006) Ultrashort antibacterial and antifungal lipopeptides Proc Natl Acad Sci USA 103, 15997–16002 60 Matsuzaki K (1999) Why and how are peptide lipid interactions...

Ngày tải lên: 16/03/2014, 00:20

... bromide assay [36] on mouse CT26 (colon carcinoma), 4T1 (mammary gland), N2C (mammary gland) and TSA (mammary adenocarcinoma) and on human U87 (glioblastoma) cancer cell lines, as well as on monkey ... oxidation state via its absorbance at 455 nm [21,23] and at pH 8.5 and 15 °C (A) Wild-type DAAO or m-DAAO at 8.6 lM, O2 at 305 lM and D-Ala at 0.6 mM The symbols are the experimental data points ... such as those reported in (A) tive half-reaction obtained for Q144R-DAAO are identical to those of wt-DAAO, a detailed kinetic investigation of this mutant DAAO was not carried out As with wt-DAAO...

Ngày tải lên: 16/03/2014, 02:20

... skate electric organ by calcium channel antagonists: a detailed pharmacological study Neuropharmacology 35, 1537–1546 Ruiz MA, Clares B, Morales ME, Cazalla S & Gallardo V (2 007) Preparation and ... solution Statistical analysis All experimental data were examined by analysis of variance (anova) procedures, and significant differences among the means from triplicate determinations were assessed ... transmembrane helices and are anchored to the presynaptic membrane and vesicular membrane, respectively SNAP-25 is peripherally attached to the presynaptic membrane Thus, formation of a parallel...

Ngày tải lên: 30/03/2014, 04:20

... sensory nucleus and the lateral parabrachial nucleus of the brainstem A small number of scattered NPS-positive cells were found in other brain areas, such as amygdala and hypothalamus The NPS-producing ... produce a transient increase in intracellular free Ca2+, indicating that NPS might be an excitatory transmitter in vivo by elevating intracellular Ca2+ A radiolabled analog of NPS (125I-labeled ... 12 van der Werf YD, Witter MP & Groenewegen HJ (2002) The intralaminar and midline nuclei of the thalamus Anatomical and functional evidence for participation in processes of arousal and awareness...

Ngày tải lên: 30/03/2014, 11:20

... Immunostaining of prostate cancer tissue with antibodies against AMACR and PSA Immunostaining of prostate cancer tissue with antibodies against AMACR and PSA Surgically resected prostate cancer ... prostate carcinoma Am J Surg Pathol 2001, 25:1397-1404 Rubin MA, Zhou M, Dhanasekaran SM, Varambally S, Barrette TR, Sanda MG, Pienta KJ, Ghosh D, Chinnaiyan AM: alpha-Methylacyl coenzyme A racemase ... release assay at the indicated effector/target ratios AMACR-derived peptides might serve as a cancer vaccine for HLA -A2 4-positive prostate cancer patients It is possible that AMACR-targeting therapy...

Ngày tải lên: 18/06/2014, 15:20

... Rhineland-Palatinate vineyard area Rhineland-Palatinate* Total Communities Total area (ha) Area under wine (ha) % area under wine Inhabitants (per ha) Inhabitants per community (median, min-max) ... figures and data on area under wine cultivation were obtained from the statistical office of Rhineland-Palatinate Statistical methods Completeness of the Rhineland-Palatinate cancer registry varies ... (C20) Anus and anal canal (C21) Liver and intrahepatic bile ducts (C22) Gallbladder & biliary tract (C23–C24) Gallbladder (C23) Other and unspecified parts of biliary tract (C24) Pancreas (C25) Nasal...

Ngày tải lên: 20/06/2014, 00:20

... BS Medical oncologist, surgical oncologist, gynecologic oncologist, radiation oncologist, subspecialties cuả surgery ear nose and throat, urology, thoracic surgery, etc… Pathologists sau chiếu ... thường rờ (palpated) thấy cục vú mà bệnh nhân không rờ thấy Bước tất bnhân làm mammogram tức thì, chụp phim theo lối cổ điển (diagnostic mammogram) vòng năm qua, có máy làm digital mammogram, phim ... thường cần ý kiến cuả radiologists) MRI có lợi có tìm thấy vết (lesions) không "thấy" digital mammograms hay ultrasound (vì làm cho dự tính ch a bệnh (plan of treatment) thay đổi hẳn, đặc biệt...

Ngày tải lên: 13/07/2014, 22:20

... Reynolds and El-Kassaby (1990) used cumulative seedcrop data to assess parental balance in a Douglas fir seed orchard, and found the cumulative seed- yield curve is a better parameter than cone-yield ... in assessing parental balance with respect to (in terms of) genetic diversity and family representation This study was conducted to: 1) contrast methods of evaluating parental balance and female ... effective population number; 2) determine parental imbalance in this orchard; and 3) contrast parental imbalance over years MATERIALS AND METHODS The study was conducted in the Pacific Forest...

Ngày tải lên: 08/08/2014, 23:22

... rheumatic diseases and to access all their clinical features Frank and colleagues analyzed sera from 216 patients with idiopathic inflammatory myopathies to assess putative associations between anti-SS -A/ Ro-52 ... serum that was available in larger quantities was used to generate a calibrator The sample was diluted 1:200 to yield an optical density of about 2.0 in the ELISA The optical density of each patient ... (University of Calgary, Canada) for technical assistance with the addressable laser bead immunoassay and Wilma Vree Egberts (Radboud University Nijmegen, The Netherlands) for technical assistance References...

Ngày tải lên: 09/08/2014, 06:22

... caacctctgggttcagcttttgccaagcttcagCACCCTGAGAATGGAGACAGTGTTTGAAGAGATGGATG T S G F S F C Q A S A P STOP NUP214 (exon 29) XKR3 (exon 3) caacctctgggttcagcttttgccaagcttcagGTGTTTGCACACCGTTAGAAATTACCACAAATGGTTGAAAAATC T S G F S F C Q A S G V C T ... 4) caacctctgggttcagcttttgccaagcttcagCATTGCTGATGACATTTTCCCTGTTATCAGTTACTTATGGGGC T S G F S F C Q A S A L L M T F S L L S V T Y G XKR3 (exon 4) NUP214 (exon 27) attttctccatcaggCATTGCTGATGACATTTTCCCTGTTATCAGTTACTTATGGGGCCATTCGCTGCAATATACT ... 10:57-63 Maher CA, Kumar-Sinha C, Cao X, Kalyana-Sundaram S, Han B, Jing X, Sam L, Barrette T, Palanisamy N, Chinnaiyan AM: Transcriptome sequencing to detect gene fusions in cancer Nature 2009,...

Ngày tải lên: 09/08/2014, 20:20

... cG250 and low dose subcutaneous IL-2 in patients with advanced renal cell carcinoma Cancer Immun, 2 007, 7: 13 14 Xu C, Lo A, Yammanuru A, Tallarico AS, Brady K, Murakami A, Barteneva N, Zhu Q, Marasco ... Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library Xiangan Tu1*§, Jintao Zhuang1*, Wenwei Wang1, Liang Zhao1, Liangyun Zhao1, Jiquan Zhao1, Chunhua ... potential for use in early diagnosis and targeted therapy of RCC Materials Renal carcinoma line A4 98 and a normal renal cell line HK-2 were obtained from Medical Academy of China (Beijing, PR China)...

Ngày tải lên: 10/08/2014, 10:21

... HIP peptide- 1 display dramatic qualitative and quantitative differences Tritiated Hp that binds to HIP peptide- 1 exhibits an increase in ATIII-dependent anti FXa activity over starting material ... pools as measured by anion exchange chromatographic analyses The validity of using the commercially available tritiated Hp as a model for unlabelled Hp is discussed Anion exchange chromatography ... PBS and bound materials were eluted with a 0.15 to 0.70 M NaCl gradient 1-ml fractions were collected and the amount of material and salt content in each fraction was quantitated as in "Materials...

Ngày tải lên: 11/08/2014, 08:20

... 5'ATTTAAGGATCCGAGAGCCATGGA 3' 5'ATGCTGCTCGAGTTATATACAAATGTTGC 3' 5'CATAGAATTCGCAAAAGCAGGAGT 3' 5'TATCGCTCGAGAGTAGAAACAAGGAG 3' 5'AGCCTGGAATTCATGAAAAAATTA 3' 5'CTCACTCGAGACATTTTCAGGGA 3' aIn all of the above mentioned ... AGCCTGGAATTCATGAAAAAATTA 3' 5' ATCGAACTCGAGATTTTCAGGGAT 3' 5' AGGGCTGGCGGTTGGGGGTTATTCGC 3' 5' GAGTCACTTTAAAATTTGTATACAC 3' 5' GATGTTAACGATACCAGCC 3' 5' GCGTGAATGTAAGCGTGAC 3' 5'ATTTAAGGATCCGAGAGCCATGGA 3' ... pC-HA-F pC-HA-R pC-NA-F pC-NA-R pC-P1-FP pC-P1-RP 5' CATAGAATTCGCAAAAGCAGGAGT 3' 5' TATCGCTCGAGAGTAGAAACAAGGAG 3' 5' ATTTAAGGTACCGACAGCCATGGA 3' 5' ATGCTGCTCGAGTATACAAATGTTGC 3' 5' AGCCTGGAATTCATGAAAAAATTA...

Ngày tải lên: 12/08/2014, 04:21

... found ALDH1 a clinically relevant marker, identifying subpopulations of cancer cells in all liposarcoma patient samples analyzed ALDH expression has proven a useful marker for cancers of several ... breast cancers Clin Cancer Res 2009, 15:4234-4241 21 Yin AH, Miraglia S, Zanjani ED, Almeida-Porada G, Ogawa M, et al: AC133, a novel marker for human hematopoietic stem and progenitor cells ... signaling induces the expansion of human hematopoietic stem cells Proc Natl Acad Sci USA 2006, 103:11 707- 11712 Douville J, Beaulieu R, Balicki D: ALDH1 as a functional marker of cancer stem and...

Ngày tải lên: 13/08/2014, 15:21