04 xylan a promising hemicellulose for pharmaceutical use

... dissent, a monolingual approach was strongly promoted in the language-teaching literature Teachers and learners were advised Trang 2not to use the learners’ own language (L1) for explanation, translation, ... that the use of their L1 was useful in meaning-focused activities The researchers recommended that L1 use was “a normal psychological process that allows learners to initiate and sustain verbal ... impacted by the task type than proficiency pairing L1 was mainly used for the purpose of task management and to facilitate deliberations over vocabulary When used for task management, L1 tended

Ngày tải lên: 10/01/2020, 03:20

... dry reforming (CO2 reforming) and partial oxidation of methane Dry reforming of methane (DRM) (1) has drawn attention because this process takes advantage of the available CO2 in natural gas reservoirs ... NiO-based catalysts such as coke formation and sintering at high reaction temperatures, many diverse researches from using new carriers to supporting catalyst by alkali, alkaline earth metals and ... large specific surface area ( 500 - 1000m2/g) Santa Barbara Amorphous 15 (SBA-15), a mesoporous material owning regular hex-agonal pores of 4.6 - 30nm in diameter, has been used as support for

Ngày tải lên: 12/01/2020, 00:26

... Pramod Kumar Sahu 1 , Ramakrishnan Srinivasan 2 and Udai B Singh 1 1 ICAR-National Bureau of Agriculturally Important Microorganisms, Mau, UP, India 2 ICAR-Indian Grassland and Fodder Research ... J.D.G and Dangl J.L (2006) The Plant Immune System Nature Reviews 444: 323-329 Kavitha A., Prabhakar P., Narasimhulu M., Vijayalakshmi M., Venkateswarlu Y., Venkateswara Rao K and Subba Raju ... V.M., Walker A.R and Franco C.M.M (2008) Endophytic actinobacteria induce defense pathways in Arabidiopsis thaliana Molecular Plant-Microbe Interactions 21: 208-218 Dhanasekaran D., Sivamani

Ngày tải lên: 21/05/2020, 21:07

... Paola Lanuti2,3, Marco Marchisio2,3, Yasamin Al-Qassab1,4, Federica Vezzali1, Silvano Capitani1,5and Valeria Bertagnolo1* Abstract Background: The malignant potential of triple negative breast ... invasive ductal breast carcinomas Chin Med J (Engl) 2009;122:2763 –9. 8 Aomatsu N, Yashiro M, Kashiwagi S, Takashima T, Ishikawa T, Ohsawa M, Wakasa K, Hirakawa K CD133 is a useful surrogate marker ... financial means to perform the described experiments and to use the Flow Cytometry Facility of the LTTA Center - University of Ferrara, Italy. Availability of data and materials All data generated

Ngày tải lên: 06/08/2020, 03:46

... were analyzed. Na: not applicable. Trang 3DNA isolation and bisulfite modificationDNA was isolated from colonic tissues and stool samples by using a QIAamp DNA Mini Kit (Qiagen), and a QiAamp DNA ... primer pair: forward, 5 ’-AGGCCTGCTGAAAATGACTGAATAT-3’ and reverse, 5 ’-GCTGTATCGTCAAGGCACTCTT-3’ PCR was performed in a reaction volume of 20 μL consisting of 2 μL of 10 ng/μL of DNA sample, ... pancreatic intraepithelial neoplasia and pancreatic ductal adenocarcinoma Am J Pathol 2002, 160(5):1573 –1581. 57 Tan AC, Jimeno A, Lin SH, Wheelhouse J, Chan F, Solomon A, et al: Characterizing

Ngày tải lên: 05/11/2020, 05:41

... dissent, a monolingual approach was strongly promoted in the language-teaching literature Teachers and learners were advised Trang 2not to use the learners’ own language (L1) for explanation, translation, ... that the use of their L1 was useful in meaning-focused activities The researchers recommended that L1 use was “a normal psychological process that allows learners to initiate and sustain verbal ... impacted by the task type than proficiency pairing L1 was mainly used for the purpose of task management and to facilitate deliberations over vocabulary When used for task management, L1 tended

Ngày tải lên: 28/01/2021, 20:35

... của Trương Tam hay hơn của Lý Tứ. c 张三的脾气比李四好。 Tính của Trương Tam hay hơn Lý Tứ. - N 1的N/ N+[của]+N1 vừa có thể thay bằng N的/[của]+N1 vừa có thể thay bằng N1 Ví dụ: a 张三的衣服比李四的衣服多。 Quần áo của ... Báo hôm nay hay hơn của hôm qua Báo hôm nay hay hơn hôm qua. (22) 录像机的磁带比录音机的磁带贵。 (22’) Băng từ của máy ghi hình đắt hơn băng từ của máy ghi âm. * Băng từ của máy ghi hình đắt hơn của máy ghi ... N+[của]+N1 có thể thay bằng N的/[của]+N1nhưng không thay bằng N1 được.Ví dụ: a 张三的公鸡比李四的公鸡更好斗。 Gà của Trương Tam chọi giỏi hơn gà của Lý Tứ. b 张三的公鸡比李四的更好斗。 Gà của Trương Tam chọi giỏi hơn của Lý

Ngày tải lên: 18/03/2021, 08:06

... can act as an active photocatalyst for the photodegradation of phenol.35 Later it was also shown that MOFs can also act as photocatalysts for the decolorization of organic contaminates.36−38 Among ... surface-modified metal–organic frameworks as a promising method for removal of dye from aqueous samples Seyed Ershad MORADI1, Shayessteh DADFARNIA1, ∗, Ali Mohammad HAJI SHABANI1, Saeed EMAMI2 1Department ... 88.5% and then it approximately reaches a plateau with further increase in the concentration of catalyst This is because a larger amount of catalyst offers more active sites that accelerate the

Ngày tải lên: 13/01/2022, 00:24

... and manufacture of oral formulations such as tablets and cap-sules is a very important aspect of drug delivery in the pharmaceutical industry To prepare a sustained release tablet of a water-soluble ... mathematical modeling of membrane systems and (6) to analyze release rate data and test the validity of the mathematical model Freshman students will perform a simple experiment to analyze a ... (TBCB Pharmaceutical Equipment Corp, GardenCove, CA), $5,700: This small bench-top machine is designed for pressing round tablets from various granular materials, applicable to laboratory used for

Ngày tải lên: 19/10/2022, 02:18

... developing targeted test preparation materials that familiarize test takers with assessment requirements is essential Employing a universal approach—using broadly applicable scenarios and minor adaptations, ... Psychological Association, & National Council on Measurement in Education (2014) Standards for educational and psychological testing Washington DC: American Educational Research Association Bachman, L ... Journal of Educational Measurement, 50, 1–73 Laing, S P.,& Kami, A (2003) Alternative assessment of language and literacy in culturally and linguistically diverse populations Language, Speech, and

Ngày tải lên: 23/11/2022, 18:54

... significantly advance our understanding in this field Trang 26Ago, Y., Takahashi, K., Nakamura, S., Hashimoto, H., Baba, A., Matsuda, T., 2007 Anxiety-like and exploratory behaviors of isolation-reared ... methamphetamine, in animal models of depression, rather than systematically compiling and comparing literature on drugs of various pharmacological classes We also critically analyzed the advantages ... Behav Pharmacol 23, 650-657 American Psychiatric Association, 2013 Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition American Psychiatric Association, Arlington, VA Andersen,

Ngày tải lên: 26/07/2023, 07:40

... have significant advantages of performance, applicability and sustainability for users due to their advanced structures such as flexible Trang 10cells, cells with a carbon electrode, semi transparent ... light was introduced Secondly, a semi-transparent, A4-sized perovskite module was created in 2018 and tested internationally in Poland and Japan Last but not least, solar carport, a charging station ... hopefully will allow for high-performance and low-cost PVs PSCs also have a lower weight than glass-based silicon PVs Another advantage is that perovskite materials can be printed or painted over

Ngày tải lên: 28/05/2024, 13:57

... include Laminaria hyperborea, Laminaria digitata, Laminaria japonica, Ascophyllum nodosum, Eclonia maxima, Lessonia nigrescens, Durvillea antarctica, Sargassum sp., Macrocystis pyrifera and etc ... that have characterized and evaluated the ability of many alginate lyases for the AOS production Han et al (2016) reported the characterization and module truncation of Aly5, an alginate Trang ... 2017; Accepted for publication: 27 December 2017 Abstract Alginate oligosaccharides (AOS) have been known as a natural material with a wide variety of biological activities, and used for a long

Ngày tải lên: 03/03/2020, 20:55

... presented as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’) b-actin (forward, 5’ CTGGCACCACACCTTCTA-CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC-GATTTCCCGC ... quantification; PAP: static acid phosphatase; PCa: prostate cancer; PIN: pro-static intraepithelial neoplasm; PSA: prostate specific antigen; RNAi: RNA interference; shRNA: short-hairpin RNA Additional material ... contains a typical signal sequence, a cysteine-rich domain, a fourfold fasciclin 1-like (FAS-1) domain and a C-terminal domain[1,2].The FAS-1 domain, an evolutionarily ancient adhesion domain, also

Ngày tải lên: 18/06/2014, 19:20

... endometrial, and ovarian cancers, as well as squamous cell carcinoma of the head and neck and multiple myeloma [6,7] Syndecan-1 appears particularly interesting for breast carcinoma radioimmunotherapy ... Yang Q, Reiss M, Kearney T, Higgins SA, Weidhaas J, Harris L, Hait W, Toppmeyer D: Locoregional relapse and distant metastasis in conservatively managed triple negative early-stage breast cancer ... Original magnification ×400 for CD138 immunostaining. Trang 6or 1 h after18FDG injection Tumor imaging with124I-labeled B-B4 was as informative as 18FDG for tumor visualization, even 1 day after antibody

Ngày tải lên: 21/06/2014, 01:20

... polymeric nanoparticles Carboxylate-functionalized, acrylate-based nanoparticles were synthesized via standard microwave-assisted, free radical polymerization techniques [38] Nanoparticles used for all ... and Cerium Oxide Nanoparticles Based on Dissolution and Oxidative Stress Properties ACS Nano 2008, 2:2121-2134. 22 Ahamed M, Akhtar MJ, Siddiqui MA, Ahmad J, Musarrat J, Al-Khedhairy AA, AlSalhi ... Trang 1N A N O E X P R E S S Open AccessBeyond platinum: synthesis, characterization, nanoparticles for potential use as a drug delivery vector Alesha N Harris, Barbara R Hinojosa, Montaleé

Ngày tải lên: 21/06/2014, 02:20

... a rapid organisational appraisal utilising formal and informal interviews, focus groups, observation of meetings and clinical practice to identify organisational barriers for change Wensing and ... identified a complex mix of organisational, teamwork, and specific assessment-related factors as barriers and facilitators for change Organisational factors are acknowledged to be influential in determining ... Christian S: Achieving change in health care prac-tice Journal of Evaluation in Clinical Practice 2003, 9:225-238. 14. Armenakis A, Bedeian A: Organizational change: a review of theory and research

Ngày tải lên: 11/08/2014, 05:22

... methods are used to validate conceptual meaning using phenomenological data (an inductive approach) and quantitative validation activities focus on measurement and operational activities associated ... individuals willing to take part in market research These databases are maintained by market research companies specifically for such purposes Some additional participants were recruited by asking database ... or moderate acne • Seen a dermatologist in the past years for their acne • An oily scalp and were also balding (males only) • Represented Asian, Black, Latino/Hispanic, White/ Caucasian peoples...

Ngày tải lên: 20/06/2014, 15:20

... throughout a year, an average of 6,485 bacteria per cc The daily analyses made of the WalkerGordon supply sold in Philadelphia for an entire year, showed that the milk almost always contained less than ... condition and are known as facultative or optional forms The great majority of milk bacteria are either obligate or facultative aerobes Rate of growth The rate of bacterial development is naturally ... differentiated, and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere...

Ngày tải lên: 16/02/2014, 22:20

... information for their project The three types of lead users are: 1) lead users in the target application and market; 2) lead users of similar applications in advanced “analog” markets; 3) lead ... substantial amount of their work time to a lead user project One practical payoff for managers is that it will enable new products and Page 30 Lead User Project Handbook: A practical guide for lead ... main activities in each phase of a typical lead user project Page 24 Lead User Project Handbook: A practical guide for lead user project teams A special note to those readers who plan to “read...

Ngày tải lên: 18/02/2014, 21:20