... telecommunications industry and materi-als science, for example It would not be far-fetched to say that Rayleigh’s study of surface waves upon an elastic half-space has had fundamental and far-reaching ... orthotropic elastic medium under the influence of gravity Appl Math Comput 135:187–200 18 Abd-Alla AM, Hammad HAH (2004) Rayleigh waves in a magnetoelastic half-space of orthotropic material under ... the domain 0 < x3≤ h (see Fig. 1) The elastic half-space and the water layer is separated by the plane x3= 0 Both the elastic half-space and the water layer are assumed to be under the gravity...
Ngày tải lên: 15/12/2017, 23:56
... mm wide and 49 mm high polarized proton target') The target material was pentanol, with a typical proton polarization of 85% The relaxation time of the target was -30 days at 38 mK in a holding ... telescopes locatedleft and right at 6° away from the neutron beam Nothaving the possibility, with our apparatus, to measure the charge exchange reaction p(n, p)n which is one usual way to calibrate neutron ... scattering at small transfer This sectiondeals with themeasurements ofdifferential crosssectionandanalysing powerfor np elastic scattering Partial results concerning the analysing power have already...
Ngày tải lên: 16/12/2017, 17:46
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... the medaka, Oryzias latipes Proc Natl Acad Sci USA 99, 11778–11783 9 Matsuda M, Nagahama Y, Shinomiya A, Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N et al (2002) ... Suzuki A, Kobayashi T, Paul-Prasanth B, Lau EL, Hamaguchi S, Sakaizumi M & Nagahama Y (2007) DMY gene induces male development in genetically female (XX) medaka fish Proc Natl Acad Sci USA 104, ... 31 Liarte S, Chaves-Pozo E, Garcia-Alcazar A, Mulero V, Meseguer J & Garcia-Ayala A (2007) Testicular involu-tion prior to sex change in gilthead seabream is charac-terized by a decrease in...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Đề tài "Pseudodifferential operators on manifolds with a Lie structure at infinity " doc
... pseudodifferential opera-tors canonically associated to a noncompact, Riemannian manifold M0 whosegeometry at infinity is described by a Lie algebra of vector fieldsV on a com- pactification M of M0 to a compact ... codimension 1 are also-called hyperfaces For simplicity, we always assume that each hyperface H of a manifold with corners M is an embedded submanifold and has a defining function, that is, that there ... Preliminaries In the sequel, by a manifold we shall always understand a C ∞ -manifold possibly with corners, whereas a smooth manifold is a C ∞ -manifold without corners (and without boundary) By...
Ngày tải lên: 16/02/2014, 06:20
CASE STUDY OF COST SAVINGS WITH A NEW CHEMICAL MIXING SYSTEM AT MITSUBISHI PAPER HACHINOHE MILL PM7 potx
... Installation in October, 2008. Trang 46Conclusion of installation in PM7 for CPAM & AKDCPAM and AKD Trang 48Optimization of wet-end at PM7A) Optimization of retention systemB) Stabilization ... machine flow, PM7P C-PAM + AKD Trang 43Concept of laboratory test, PM7Drainage Simulation of present mixing points (*) Tested at Mütec DFS retention analyzer C-PAM + AKD after machine screen A-PAM ... emission Trang 20Jet Injection Mixing for papermaking additivesTotal Annual Water and Energy Saving with 250 installations: BTU) energy saving corresponding to more than 800.000 oil barrels PATENTED...
Ngày tải lên: 24/03/2014, 05:20
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" docx
... kind of applications [1] Communications at 60 GHz have some advantages as well as some disadvantages The main advantages are three-fold The large unlicensed bandwidth around 60 GHz (more than 3 ... y(t) are the baseband equivalent PA input and output, respectively,a1anda3are real polynomial coef-ficients We assume an amplifier with a unity gain (a1 =1) and an input amplitude at 1-dB compression ... wavelength in free space is only 5 mm, the analog components can be made small Therefore, on a small area, one can design an array of antennas, which steers the beam in a given target direction This...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo y học: " Relationship of compartment-specific structural knee status at baseline with change in cartilage morphology: a prospective observational study using data from the osteoarthritis initiative" pps
... femoro-tibial cartilages are labeled with the same colors as in (c), the patellar cartilage is labeled magenta and the trochlear (femoral) cartilage in turquoise. Figure 2 Cartilage plates and subregions ... significantly associated Table 2 Change in cartilage thickness (ThCtAB) over one year in all participants and in participants with and without medial femoro-tibial joint space narrowing (mJSN) at baseline ... on the baseline radiograph based on the Oste-oarthritis Research Society International atlas: medial and lat-eral JSN (graded 0 to 3) [15,16]; medial and latlat-eral tibial and femoral osteophytes...
Ngày tải lên: 09/08/2014, 14:21
Designing a supplementary reading syllabus with a view to improving reading skills for the first-year English majors at Hai Phong Private University
... performance data and look at the competence that underlies the performance Nonetheless, this approach still regards the learner as a language user rather than a language learner and it is concerned with ... motivate learners‟ study more than other skills because it is much easier and can be done at any time, anywhere with a lot of available materials The main purpose of any reading program is “to enable ... at least feel comfortable with) reading in the foreign language, and to read without help of unfamiliar authentic texts, at appropriate speed, silently and with adequate understanding” (Nuttal,...
Ngày tải lên: 19/03/2015, 10:28
DSpace at VNU: p-harmonic l-forms on Riemannian manifolds with a weighted Poincare inequality
... Trang 1Contents lists available at ScienceDirect Nonlinear Analysis www.elsevier.com/locate/na p-harmonic ℓ-forms on Riemannian manifolds with a weighted Poincar´e inequality Nguyen Thac Dung ... complete Riemannian manifolds satisfying a weighted Poincar´e inequality and having a certain lower bound of the curvature His theorems improve Li–Wang’s and Lam’s results Moreover, some applications ... structures of minimal hypersurfaces are also given Therefore, it is very natural for us to study p-harmonic ℓ-forms on Riemannian manifolds with a weighted Poincar´e inequality Recall that an ℓ-form ω...
Ngày tải lên: 12/12/2017, 06:43
DSpace at VNU: Syntheses, structures and biological evaluation of some transition metal complexes with a tetradentate benzamidine thiosemicarbazone ligand
... class of potentially bioactive hybrid ligands, studies with other derivatives of this class are recommended and are in preparation in our laboratories 4 Experimental 4.1 Materials All reagents ... Trang 1Accepted ManuscriptSyntheses, Structures and Biological Evaluation of some Transition Metal Com-plexes with a Tetradentate Benzamidine/Thiosemicarbazone Ligand Thi Bao Yen Nguyen, ... organic ligand in a distorted square-planar coordination environment The molecular planes defined by the metal atoms and the four donor atoms S1, N5, N8 and S11 are slightly distorted with maximum...
Ngày tải lên: 12/12/2017, 06:47
DSpace at VNU: Direct production of highly conductive graphene with a low oxygen content by a microwave-assisted solvothermal method
... graphite (EG) as a starting material EG was subjected to solvothermal treatment, followed by microwave radiation The FLG had an average thickness in the range of 1.8-2 nm with a lateral size of ... atoms arranged in a dimensional hexagonal lattice Due to their outstanding physical and chemical properties, graphene and its derivatives have attracted tremendous attention for both fundamental ... the sealed reaction vessel and containment of volatile products, solvothermal techniques are well suited for the preparation of metastable phases Nethravathi and Rajamathi [18] and Dubin et al [19]...
Ngày tải lên: 12/12/2017, 06:53
DSpace at VNU: On a Riesz-Feller space fractional backward diffusion problem with a nonlinear source
... substance [10].The space-fractional diffusion equation (SFDE) has been arisen from replacing the standard space partialderivative in the diffusion equation with a space fractional partial derivative ... Department of Mathematics, Faculty of Science, King Abdulaziz University, P.O Box 80203, Jeddah 21589, Saudi Arabia Abstract In this paper, a backward diffusion problem for a space-fractional ... Feller space fractional backward diffusion problemwith a nonlinear source Nguyen Huy Tuana, Dinh Nguyen Duy Haib, Le Dinh Longc, Van Thinh Nguyend, Mokhtar Kiranee,f, ∗ a Applied Analysis Research...
Ngày tải lên: 12/12/2017, 08:15
DSpace at VNU: On a class of singular integral equation with the linear fractional Carleman shift and the degenerate kernel
... gave ageneral formula of linear-fractional Carleman shifts on the unit circle and solved bymeans of Riemann boundary value problem for a class of singular integral equations with a linear-fractional ... http://www.tandf.co.uk/journals Trang 3Downloaded By: [Tuan, Nguyen Minh] At: 18:21 23 January 2008 linear-fractional Carleman shift In our view, the singular integral equations with alinear-fractional Carleman shift ... Variables and Elliptic Equations Le Huy Chuana; Nguyen Van Maub; Nguyen Minh Tuanb a Department of Applied Physics, Graduate School of Engineering, Osaka University, Japan b Faculty of Mathematics...
Ngày tải lên: 15/12/2017, 12:37
Fisheries science JSFS , tập 76, số 4, 2010 7
... TCCTTCAACAACTTGCTCTAT ned R: AACTAGCAGCCAGGGGTAT F: ATGGGCTCAGTTCATAAACAT ned R: CCAGGGCAGGAGTCTGT F: AATGTGCAAGTAAGCGTATGT ned R: CGGAGACGGGCACATAATCAG F: TCATAGGACGAGGCGATGGTG fam R: CAACAAACACCCAGATGCT ... CAGAAGCTTAATTGGCCTAAT ned R: GCACACAGGCACACAGAATA F: ACGCACCTTAAGAACAAATGT fam 52 54 F: GAGCGGTATCATCTCACTCA hex R: CACATGTTTTTCTTGCGTTAT Ta (°C) Primer sequence (50 ? 30 ) Exact tests of Hardy-Weinberg ... CAACAAACACCCAGATGCT F: TTATCATTTGCAGACTCAAGG ned R: AGAAGCTAGGCCATAACATTA F: TCCTTCAACAACTTGCTCTAT fam 52 54 52 55 52 54 54 R: GATATGCGGATACGGACAC F: GCAGTGTGTATCGGTGTGT ned R: CATGTGTTCTGATTCGAGTTA 56...
Ngày tải lên: 19/07/2016, 19:43
Báo cáo khoa học nông nghiệp " Effects of Stocking Biomass on Growth, Survival and Production of the Two Sizes of Clam Meretrix lyrata Cultured in the Intertidal Areas And Notes on Hatchery Production of Clam Spat " pot
... of fatty acid of clam Ruditapes decussatus reared in sea water and effluent from a fish farm in Galicia (JaraJara et al., 1997) The fatty acid variation and the factors affecting to this variation ... intertidal areas, the natural feed and environmental factors are uncontrollable and are dependent of nature Dynamic of tide, wave and current create the availability of algae, organic matter that ... important factors affecting growth and survival of clam larvae The results indicated that clam larvae can tolerate a salinity range from 10ppt to 30ppt At a salinity of 35ppt, all larvae had died...
Ngày tải lên: 21/06/2014, 05:20
Undaria pinnatifida Habitat Loss in Relation to Sea Urchin Grazing and Water Flow Conditions, and Their Restoration Effort in Ogatsu Bay, Japan
... Percentage covers of algae and seagrass (%) Sargassum fusiforme Calliarthron yessoense Serraticardia maxima Corallina pilulifera Gigartinales Codium fragile Phyllospadix iwatensis Undaria pinnatifida ... between January and March, while natural U pinnatifida plants maturated after spring (Taniguchi et al., 1981; Akiyama et al., 1982; Tokuda et al., 1987; Saitoh et al., 1999) Thus, prematurity and withering ... Percentage covers of algae and seagrass (%) Sargassum fusiforme Calliarthron yessoense Sargassum horneri Grateloupia turuturu Phyllospadix iwatensis Undaria pinnatifida Crustose coralline algae Cladophora...
Ngày tải lên: 05/09/2013, 09:38
Studying Aesthetics in Photographic Images Using a Computational Approach pot
... classification 100 80 Overall Accuracy Class Low accuracy Class High accuracy 78 76 90 Accuracy (in percentage) Accuracy (in percentage) 95 85 80 75 70 74 Overall Accuracy Class Low accuracy Class ... the group averages are within the same range and hence are treated fairly when posed as a classification problem On the other hand, the ‘ideal’ case is when a machine can replicate the task of robustly ... regions, and performing a robust region-based matching with other images Primarily meant for image retrieval applications, we use it here to quantify familiarity Given a pre-determined anchor database...
Ngày tải lên: 07/03/2014, 17:20
Paper Manufacture in Central and Eastern Europe Before the Introduction of Paper-making Machines pptx
... Italy.2 As early as in 1350, the Fabriano paper was applied as far as in Finland for writing a document.3 Also the Fabriano art of papermaking spread from Italy to other European countries, starting ... Vantaa 1998 (IPH Monograph Series, Vol 2), pp 81ff José C Balmaceda: La Contribución Genovesa al Desarrollo de la Manufactura Papelera Española Fuengirola 2004 (Collecion Apapiris) of Fabriano ... Vlad Atanasiu: Assessing Paper Origin and Quality by Means of Large-Scale Laid Lines Density Measurements In: Rosella Graziaplena, Mark Livesey (eds.): Paper as a Medium of Cultural Heritage Archaeology...
Ngày tải lên: 01/04/2014, 00:20
Báo cáo khoa học: "haracterizing base-cation immobilization in the stem of six hardwoods of eastern Canada" ppsx
... 10 a a b b b b c ab a b abc abc a a a a a a a Mg (mg g -1) 1.5 a b a b c 0.5 b b b c heartwood a a a a a a transitional ab b a a a sapwood c c b bark Figure Interspecific comparisons of mean ... immobilization and DBH and tree age Homogeneity of variance for ANOVA analysis was assessed with the Bartlett test and logarithmic transformations were used when required No variable transformations ... In a recent study, soil pH decreases in a sequence starting with sugar maple (Acer saccharum Marsh.) > white ash (Fraxinus americana L.) > red maple (Acer rubrum L.) > beech (Fagus grandifolia...
Ngày tải lên: 08/08/2014, 14:21
studying histamine in seafood products by high performance liquid chromatography
... extract was made alkaline by adding 200 µl of 2N NaOH A 300 µl saturated sodium bicarbonate and ml Dns-Cl was added to the alkaline extract The reaction mixture was transferred to a 40°C incubator ... histamine and microbial analyses in tuna muscle by time and temperature - Preparation of samples: Fresh tuna (Thunnus albacares) was preserved at 4oC and 0°C Samples were taken at the appropriate ... indicate that the quality of these samples may be a serious problem for public health In Asia and in particular those areas with an extensive coastline and high ambient temperatures such as Vietnam,...
Ngày tải lên: 06/10/2015, 13:05