fi ciency the red blood cell as a model

... Yata, Hidekazu Nakanishi, Yoshimasa Suetsugu, Makoto Mikami, Takayuki Tsujioka, and Shinichiro Suemori, Ms Mayumi Aizawa (Takahara), Chie Kawasaki and Sakura Eda Kawasaki Medical School (Research ... Yoshinobu Takemoto, Masahiro Yoshimoto, Kazuyuki Mitani, Kosuke Miyashima, Masakiyo Mannoji, Takashi Sugihara, Nobumasa Inoue, Masaoo Shimoda, Akio Kanzaki, Masashi Hashimoto, Hiroo Mori, Takemi Otsuki, ... T., Kanzaki, A. , Kaku, M., Yawata, A. , Takezono, M., Okamoto, N., Wada, H., Sugihara, T., Yamada, O., Katayama, Y., Nagata, N., Yawata, Y (1998) Homozygous missense mutation (band Fukuoka: G130R):...

Ngày tải lên: 29/06/2014, 11:20

... discharge Statistical analysis Categorical variables are presented as values (percentage) and continuous variables as mean ± standard deviation The odds ratios (OR), 95% confidence intervals (CI) ... the study and drafted the manuscript Vincent Olivier Mallet, Frédéric Pene, Jean-Paul Mira and Jean-François Dhainaut obtained the data Sophie Marque, Alain Cariou and Yann-Erick Claessens participated ... age was strongly associated with anaemia in the critically ill In the ABC study [1] the mean haemoglobin level at admission was significantly lower in patients older than 90 years than in patients...

Ngày tải lên: 13/08/2014, 03:20

... support the spread of the vasculature These factors, which are preferentially attracted to the heparin, increase the proliferation and migration of cells associated with neovascularization In as much ... of attempts at therapy The myriad sinusoidal vessels and their proximity to one another indicate that the intraosseous conduits support an exaggerated revascularization of the formerly avascular ... Pressure Taking for granted the accuracy of the paradigm of the pathogenetic role of vascular deprivation and anoxia in bringing about necrosis of the femoral head, revascularization and oxygenation...

Ngày tải lên: 13/08/2014, 23:20

... risk factors Transfusion was independently associated with ARDS (Table 2) When transfusion was considered as a dichotomous variable (yes/no), there was a significant association between pRBC transfusion ... Continuous data were summarized as mean and standard deviation, and the Student t test was employed when comparisons of means between the case and control groups were made Categorical variables were ... approximately one third of the population Adjusting for several covariates indicated that pRBC transfusion was significantly related to a diagnosis of ARDS and, importantly, was also associated...

Ngày tải lên: 13/08/2014, 03:21

... towards the patient's end is then closed The sample site is cleaned and a syringe with a custom-made cannula (Edwards Lifesciences) is attached A vacuum tube is attached to the syringe and the ... findings are applicable to other blood conservation devices Conclusions Since anaemia is the main reason for transfusion in the ICU, and a blood conservation device is associated with better preservation ... provide a statistically significant result for a difference of at least 0.05 unit PRBC/patient/day with a standard deviation of 0.15 units PRBC/patient/day Statistical analysis We expressed variables...

Ngày tải lên: 13/08/2014, 20:21

... never reach a mathematical steady state Thus, a model that can tolerate long-term simulation for analyzing the pathology of human diseases should not approximate the "mathematical steady state" ... solve the problems associated with developing a model that simulates all the cellular metabolic pathways The mathematical steady state may not be the normal state of real cells During this simulation ... oxidantinduced decrease of hexokinase and pyruvate kinase, and the maximum activity of these enzymes was allowed to change according to the ratio of GSH and GSSG The equations and parameters used are derived...

Ngày tải lên: 13/08/2014, 22:22

... denaturation, any change at these positions was destabilizing G37 6A and G376E had identical Tm values At position 157, alanine had a smaller effect than aspartate, but even alanine decreased the ... using jasco software For temperature denaturation studies, the sample was monitored at 222 nm The temperature was increased at a rate of 15 °C per hour The CD signal was used to calculate the fraction ... the QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC...

Ngày tải lên: 16/03/2014, 06:20

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... further investigated Although the AGM region is considered the first site of definitive hematopoiesis, recent studies have indicated that the placenta acts as an additional extramedullary hematopoietic ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have...

Ngày tải lên: 22/03/2014, 17:20

... of pyruvate kinase, and 2.5 lgámL)1 LDH in a total volume of mL The reaction was initiated by an addition of 50 ng of Na+/K+-ATPase Na+-dependent ATPase activity was also measured using the coupled ... Na+/K+-ATPase, K+-activated phosphatase, and Na+-dependent ATPase at 0.1 MPa were 1240, 110, and 29 lmoláh)1ámg)1, respectively Na+/K+-ATPase activity was determined h later after the pressurization at ... Yokoyama, T., Kaya, S., Abe, K., Taniguchi, K., Katoh, T., Ê Yazawa, M., Hayashi, Y & Mardh, S (1999) Acid-labile ATP and/or ADP/Pi binding to the tetraprotomeric form of Na/KATPase accompanying...

Ngày tải lên: 24/03/2014, 00:21

... will aid in assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program is an ideal test site for such new translational research approaches, ... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as...

Ngày tải lên: 18/06/2014, 19:20

... acquiring and managing the data, revising the manuscript, and approving the manuscript in its final form EA contributed to performing statistical analysis, acquiring and managing the data, revising the ... acquiring and managing the data, analyzing the data and interpreting the results, drafting and revising the manuscript, and approving the manuscript in its final form RA, KK, and JO contributed to acquiring ... the same direction, suggesting that an improvement or worsening in microvascular reactivity, microvascular perfusion, and microvascular blood flow may be associated with an increase or decrease...

Ngày tải lên: 20/06/2014, 22:20

... both tachycardia and increased ventricle contractility may increase myocardial oxygen demand Because myocardial oxygen extraction is already almost maximal at rest, every increase in myocardial ... decreased blood viscosity (especially relevant in severe anemia) and increased adrenergic response, allowing tachycardia and increased myocardial contractility Other phenomena include blood flow redistribution ... decreased deformability), and changes in the storage medium (decreased pH, increased potassium, release of proinflammatory cytokines) These stored RBCs also have an increased tendency to adhere...

Ngày tải lên: 20/06/2014, 23:20

... visualized as dots on metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to ... consider them as ancestral chromosomes although they are very rare in fish and batracians Indeed, they could have been inherited from a common ancestor of the vertebrates, as they can be encountered ... such as cartilaginous fish [59, 75], salamanders [55] or monotreme [79] Moreover, general features of bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance...

Ngày tải lên: 09/08/2014, 18:21

... mate-pair library sequencing will mark the end of the data collection phase and the start of assembly and analysis The end of this phase will be marked clearly on the snake genomics website [21], as ... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... with other comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral...

Ngày tải lên: 09/08/2014, 23:20

... extracorporeal flow (surgery of ascending aorta) or circulatory arrest All patients received standardized anesthesia and intraoperative care, and were operated by the same team (same surgeon, assistant and ... statistical analysis We also thank the cardiac surgeon N Tsilimingas, the assistants A Hevas and G Kalafati, our chief perfusionist V Mitilis and the nursing personnel of the University Hospital ... time; AOX: aortic cross-clamping; ASD: atrial septal defect; AVR: aortic valve replacement; BIS: bispectral index; BMI: body mass index; BSA: body surface area; CABG: coronary artery bypass grafting;...

Ngày tải lên: 10/08/2014, 10:20

... regression analysis Survival time was measured from the date of transplant to the date of death or last known follow-up All data was censored as of July 1st 2007 The following clinical and demographic ... represents a or AML indicates acute myeloid leukemia; ALL, acute lymphoblastic leukemia; MDS myelodysplastic syndrome; AA, aplastic anemia plant echocardiogram or MUGA scan All measures of EF ... were measured using a commercially available sandwich enzyme immunoassay (EIA) (Ramco Laboratories, Inc Stafford, TX) C-reactive protein was measured using an enzyme-linked immunosorbent assay (high...

Ngày tải lên: 10/08/2014, 22:20

... monitors) Statistical analysis was performed using SAS version 9.1 software (SAS Inc., Cary, NC, USA) and MedCalc version 11.3 software (MedCalc, Mariakerke, Belgium) The normality of data was assessed ... of the data as well as the drafting and revision of the manuscript JIS, AMN and RLM assisted in designing the survey, interpreting the data and revising the manuscript All authors approved the ... imaging of the brain year after aneurysmal subarachnoid hemorrage: randomized study comparing surgical with endovascular treatment Radiology 2008, 246:543-552 Kramer AH, Zygun DA: Anemia and red...

Ngày tải lên: 14/08/2014, 07:21

Ngày tải lên: 13/11/2014, 10:36

... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... On the other hand, DMSO was the only chemical which reduced larval activity in the dark and was among the two substances (the other was SB) that exhibited the same effect in the light phase The...

Ngày tải lên: 15/05/2015, 00:37