「めく」 to indicate an atmosphere of a state

... translation, and practice using specific English flexibly, creatively and accurately.- To show off my translation skills as well as document analysis.- To translate document quickly and smoothly.- To analyze ... chapters, because of limitation of time, I have translated only 2 chapters. -Chapter 1: Stephanie’s life as a child with her mother and grandmother. -Chapter 2: Stephanie’s life as an adult and ... substituting the grammar and vocabulary of the source language (SL) with corresponding grammar and vocabulary of the target language (TL), while also changing the phonology and graphology from SL to TL,

Ngày tải lên: 29/03/2022, 12:50

... texts You may translate the name of the law if an appropriate translation exists Add the German name and its official abbreviation in parenthesis You may then reference on the abbreviation The ... Literature American Psychological Association (Ed.) (2009): Publication Manual of the American Psychological Association (APA, 2009) 6th Edition Washington D.C American Psychological Association ... journal specifications) Either use vol., no., and pp., or omit all these abbreviations Example: Bhattacharyya, A., Harris, T.R., Narayanan, R., and Raffiee, K (1995): Specification and Estimation

Ngày tải lên: 18/10/2022, 19:09

... Using the standards documents of the National Council of Teachers of Mathematics and The Mathematical Association of 40 R H ADAMS and G L STRINGER America, mathematics and education faculty developed ... chemistry, and physics also have developed similar reform-based standards at various levels The National Science Education Standards and other reform projects were initially 37 Toe Journal of Mathematics ... million, and the state provides a matching $2.75 million over five years All Louisiana public and independent colleges that prepare mathematics and science teachers are eligible to submit a proposal

Ngày tải lên: 26/10/2022, 15:44

... meaningCommunicative translation is an accurate translation of the contextual meaning of the original text that the reader can easily accept and understand both the content and the language of it. For example: ... writer's intent and textual realization. For example : He was a fast as a kangaroo. Translated version : Anh ấy nhanh như một con kangaroo.The word “kangaroo” is a cultural word and it was picked directly ... really appreciate it! This version has the appropriate content and language, helping readers understand the meaning and not think wandering.Adaptation translation is a free form of translation

Ngày tải lên: 25/02/2024, 08:23

... factors affecting deposit of commercial bank of Ethiopia: an empirical study on adama district.Far, A A va Zadeh, R L (2016) Factors Affecting the Success of Iranian banks in mobilizing financial ... 100% of the charter capital Agribank, which has almost 40,000 employees, has nearly 2,300 branches and transaction offices in all areas and is the sole commercial bank present in 9 out of 13 island ... decisive factor to all activities of economic activities in general and commercial banks In particular, the Agribank branch in the North of Yen Bai was officially upgraded to a type I branched in

Ngày tải lên: 19/06/2024, 10:44

... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... V Analyze pilot study data and prepare manuscripts and future grant proposals CAB = community advisory board; PCARE = primary care, access referral and evaluation 1-3 Cabassa et al Implementation ... to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface adaptations are a prerequisite,

Ngày tải lên: 10/08/2014, 11:20

... Elizabeth Health Care, 90 Allstate Parkway, Toronto, ON, Canada, 3 Canadian Institute of Health Research, 160 Elgin Street, 9th Floor, Ottawa, ON, Canada and 4 University of Toronto, Faculty of ... Economic and Industrial Democracy 2004, 25:301-318. 32. Damanpour F: Organizational innovation: A meta-analysis of effects of determinants and moderators Academy of manage-ment journal 1991, ... 20(2):146-163. 113 Canadian Institutes of Health Research Natural Sciences and Engi-neering Research Council of Canada Social Sciences and Humanities Research Council of Canada: Tri-Council Policy Statement:

Ngày tải lên: 11/08/2014, 05:21

... Canada, 3 Canadian Institute of Health Research, 160 Elgin Street, 9th Floor, Ottawa, ON, Canada and 4 University of Toronto, Faculty of Nursing, 155 College Street, Toronto, ON, Canada Email: ... Wendy A Gifford* - wgifford@rogers.com; Barbara Davies - bdavies@uottawa.ca; Ian D Graham - IGraham@cihr-irsc.gc.ca; Nancy Lefebre - knowledge@saintelizabeth.com; Ann Tourangeau - ann.tourangeau@utoronto.ca; ... Economic and Industrial Democracy 2004, 25:301-318. 32. Damanpour F: Organizational innovation: A meta-analysis of effects of determinants and moderators. Academy of manage- ment journal 1991,

Ngày tải lên: 11/08/2014, 16:21

... present data from an analysis of a database arising from a national audit of patient outcomes from critical care units in England, Wales and Northern Ireland Data from this database have previously ... important to know not only baseline data, such as the incidence of severe sepsis and associated mortality, but also trends in these data over time, so that any change can be evaluated relative to ... Programme The Pro-gramme provides a national comparative audit of critical care for England, Wales and Northern Ireland and is co-ordinated by the Intensive Care National Audit & Research

Ngày tải lên: 12/08/2014, 23:22

... TGGCGACCTTTGTATTTCTATTTT) and reverse primer AAGGCTCCGATTCTCGTAAACGTTTGGAT) To construct the pRC004 plasmid, the plasmid AD002 was used as template and primers 97AF2 (5’-GGGATGGCAGG- (5’-AAAATAGAAATACA-CTTTGTATTGCTATTTTACACCAAAGTGGG) ... nourseothricin N-acetyltransferase gene (Goldstein & McCusker, 1999) was amplified with adaptamer primers CDC34F2 (5’- ACTTTTTTCAAGGCTGAGAA-TCCATCGACAGATTGTAACGAAGCAGCTGAAGCTTCGTACGC- 3’) and CDC34R2 ... (5’-AAAATAGAAATACA-CTTTGTATTGCTATTTTACACCAAAGTGGG) and 97AF2 (5’-CCCACTTTG-GTGTAAAATAGCAATACAAAGCCTGCCATCCC) were used Following PCR amplification, 1 µl of the Dpn I restriction enzyme was added to the reaction mix to digest

Ngày tải lên: 24/08/2014, 12:03

... continuous and frequent learning and practice 1.2 Reading comprehension Reading comprehension plays an important role in teaching and learning reading a foreign language It can be understood as the ... by M.A.K Halliday‘s functional approach to language Halliday‘s framework emphasized the social Trang 13As can be seen, the term ―discourse analysis‖ is very ambiguous However, according to Nguyen ... ideological meanings) and lower-order forms of language that contribute to patterning the meaning In layman‘s terms reader cannot neglect the role of individual words or grammatical makers in

Ngày tải lên: 28/03/2015, 09:26

... Hassan Navqi, Dr. Srinivasan Sankaraguruswamy, Dr. Anand Srinivasan, Dr. Nan Li, Dr. Michael Shih, and Dr. Jun Koo Kang for their helpful suggestions and comments. I thank my classmates and friends, ... AN ANALYSIS OF CHINESE STATE-OWNED ENTITIES AND FINANCIAL MARKETS: MARKET VERSUS POLITICAL INCENTIVES LI, ZHAOHUA NATIONAL UNIVERSITY OF SINGAPORE 2007 AN ANALYSIS OF CHINESE STATE-OWNED ... structure and firm value in China’s privatized firms: 1991-2001. Journal of Financial and Quantitative Analysis 40(1): 87-108. Zang, Junkuo. 2001. China’s state assets management system: How the state

Ngày tải lên: 14/09/2015, 09:27

... ADAPTATION AND APPLICATION OF A STATE-OFTHE-ART IMPEDANCE ANALYZER FOR CHARACTERIZATION OF SILICON P-I-N DIODES PANJI G. I. SURYACANDRA NATIONAL UNIVERSITY OF SINGAPORE 2011 ADAPTATION AND ... resistor and µF standard capacitor at measurement frequency of 0.1 Hz. As a consequence of this small phase angle standard deviation, the capacitance of standard semiconductor samples can be determined ... standard deviations of the measured phase angles of impedance of the samples are significantly smaller than phase angles of impedance of the sample. Due to significant noise caused by recombination

Ngày tải lên: 26/09/2015, 10:59

... one hand and actions of the Myanmar state on the other hand The rhetoric of the state often is a good expression of the state’s mindset and analysing it helps understand reasoning or argumentation ... historical trajectories that particular nation-states took Nation-state formations need to be analysed within greater political orders, but remain a useful and necessary unit of analysis 4 Anthony ... repressive and authoritarian This name controversy has sparked manifold discussions and angry exchanges I distance myself from any political implications that either name has and use the name Burma when

Ngày tải lên: 28/09/2015, 13:28

... poet a whole series of poems to realise. By the end of Ararat, the poet has arrived at an acceptance of a fundamental human desire to attain stillness in one’s life. This stillness is akin to what Paul ... instantly touch a universal anguish as no confessional poems can, for Strand has the fortune of writing…out of the involuntary near-solipsism that always marks a central poetic imagination in America.”17 ... personal introspection in Ararat, the poems in this book manage to allow for readers’ participation in this way; as the poet arrives at revelations about her own past, readers can also share and

Ngày tải lên: 06/10/2015, 21:22

... alternative can be the least cost advanced wastewater treatment and disposal alternative In locations where poorly drained land that is unsuitable for land application is available, wetlands can often ... Nguyen Tuan Anh - K55 Advanced Program of FES Le Nam Thanh - K55 Advanced Program of FES Instructor: Associated Professor Nguyen Thi Loan, Faculty of Environmental Science, Hanoi University of ... Plants create and maintain the litter/humus layer that may be likened to a thin biofilm As plants grow and die, leaves and stems falling to the surface of the substrate create multiple layers of

Ngày tải lên: 13/05/2016, 17:44

... can be taken to form an axioms system of HAs These algebras form an algebraic foundation to study a type of fuzzy logic, called linguistic-valued logic, and provide a good mathematical tool to ... ‘semantization’ was defined and accepted in Ho et al (2008) The semantizations for each state variable are defined by the transformations given in Figures 10 and 11 The semantization and desemantization ... versa The transformation (linear interpolation) of the interval [a, b] into [0, 1] is called a semantization and its converse transformation from [0, 1] into [a, b] is called a desemantization

Ngày tải lên: 16/12/2017, 10:44

... Bayesian methods of estimation, then discusses various methods of statistical analysis for a queuing system, and finally investigates the advantages and adaptability of empirical Bayesian estimation ... of losing customers, and to meet the variation of demand For instance, the operations of Postal Remittances and Savings Banks (PRSB) in Taiwan face fierce competition under the trends of financial ... the empirical Bayesian approach on parameter estimation in queuing systems and concluded that the empirical Bayesian approach seeks to combine the logical advantages of the Bayesian techniques

Ngày tải lên: 03/02/2020, 16:57

... is that there is a lack of organs and organ donors who make organ transplantation possible a The need is many organs and tissues such as the heart, lungs, liver, kidneys, pancreas, corneas, bone, ... kidney wasn’t a good match He had to wait again The third time was a charm A small adult was in an accident and his kidney was a good match This story had a happy ending but so many not B Tie to the ... a solution that will satisfy the need you have created This step can have as many as five parts: Statement-Briefly state the attitude, belief, or action you want the audience to adopt Explanation-Make

Ngày tải lên: 08/07/2020, 13:51

... using national tariffs [23] All participants will also be asked to report out-of-pocket expenses on travel to any appointments and on prostate cancer related care products and medi-cations, and any ... funding body have no role in the design of the Trang 9study, collection, analysis, and interpretation of data nor in writing themanuscript. Availability of data and materials Not applicable. Authors ... 2016. 4 American Cancer Society Survival rates for prostate cancer 2016 http:// www.cancer.org/cancer/prostatecancer/detailedguide/prostate-cancer-survival-rates Accessed 25 Nov 2016. 5 Davies

Ngày tải lên: 06/08/2020, 04:07