... COQ1 -a COQ1-b dps1 -a dps1-b Description (5¢- to 3¢) CCGGATCCCATGTTTCAAAGGTCTGGC GCCCCCGGGTTACTTTCTTCTTGTTAGTA TAC CCGGATCCATGTTTCAAAGGTCTGGC CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC ... Okada K, Kamiya Y, Zhu X, Tanaka K, Nakagawa T, Kawamukai M & Matsuda H (1997) Analysis of the decaprenyl diphosphate synthase (dps) gene in fission yeast suggests a role of ubiquinone as an antioxidant ... Arabidopsis thaliana Plant Mol Biol 55, 567–577 14 Saiki R, Nagata A, Kainou T, Matsuda H & Kawamukai M (2005) Characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans FEBS...
Ngày tải lên: 30/03/2014, 04:20
... collection, analysis and interpretation of data ST, MTM and ARD: Design and critically revising of the manuscript All authors read and approved the final manuscript Acknowledgements AFIP, CNPq, CAPES, ... measure of self-evaluated change in health status in the past year [19] 3) BSQ- Body Shape Questionnaire – Translated into Portuguese and validated for the Brazilian population A 34item measure ... binge eating, body image dissatisfaction, as well as domains of QOL This is particularly important once several studies indicate that obese adolescents have a higher incidence of mental health...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that ... immediate reimplantation of resected bone J Craniomaxillofac Surg 1991, 19:31-39 Ehara S, Nishida J, Shiraishi H, Tamakawa Y: Pasteurized intercalary autogenous bone graft: radiographic and scintigraphic ... Kawaguchi N, Matsumoto S, Matsushita Y: Radiographic analysis of pasteurized autologous bone graft Skeletal Radiol 2003, 32:454-461 Rong Y, Sato K, Sugiura H, Ito T, Sakano S, Iwata H, Kimata...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: " Osteoid osteoma of a metacarpal bone: a case report and review of the literature" docx
... head of the third metacarpal bone in the left hand The patient was operated on 30 days later, by a dorsal approach (Fig 3a) , under a brachial plexus block An en bloc excision of the nidus was ... Bednar et al [18] was 11 out of 46 cases Baron et al [19] described 15 patients with post-traumatic osteoid osteoma Uda et al [14] reported a case of an osteoid osteoma of the metacarpal bone ... osteoma in a metacarpal J Hand Surg [Br] 1999, 24:133-134 Kallio E: Osteoid osteoma of the metacarpal and metatarsal bones Acta Orthop Scand 1963, 33:246-252 Kendrick JI, Evarts CM: Osteoid-osteoma:...
Ngày tải lên: 11/08/2014, 21:22
Development of a bioresorbable bone graft alternative for bone engineering applications
... cartilage act as articular cartilage and epiphyseal plate 24 Chapter Literature Review 2.2 Bone Regeneration, Repair and Healing Defects in bone can occur as a result of injury, disease and surgical ... of the collagen-hydroxyapatite packing density, degree of porosity and organisation Cortical bones are found mainly in the shafts of long bones, in majority of flat bones and in the ends of long ... vascularised for bone red marrow storage and activities Trabecular bone is always surrounded by cortical bone [71, 72] The combination of cortical and trabecular bone varies according to the bone...
Ngày tải lên: 11/09/2015, 09:58
Tissue engineering of a vascularized bone graft
... Subcutaneous, intramuscular, and intraperitoneal implantation of a graft has been reported similar vascular patterns [83] Although generation of vascularized graft is feasible, this tissue is vascularized ... whereas an allograft is taken from a cadaver In spite of many available treatment modalities for tissue loss, currently, the gold standard is the autograft transplant; for bone, it is taken from ... scaffold-matrix is vascularized to make a viable graft Optimization of the interplay of cells and growth factors in the scaffolds might eventually allow generation of different axially vascularized...
Ngày tải lên: 14/09/2015, 08:48
báo cáo hóa học:" Development of an in vitro three dimensional loading-measurement system for long bone fixation under multiple loading conditions: a technical description" potx
... compliment application of ASIF devices along the distal aspect of the lateral and cranial (anterior) radius surfaces with at least a 0.5 cm distance from potting material, and to have sufficient bone- potting ... external constraints on proximal relative to distal end of radius: axial, LM and CrCa translation; axial rotation, and bending rotation transverse to the plane of loading Figure spheres Axial compression ... supports to a maximum at the central load application point Panjabi et al [16] reported that cortical bone longitudinal modulus of elasticity increases with increase in strain rate by a factor of 1.5...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf
... triangular fibrocartilage and the distal end of the ulna[1] The limitation of external fixation to achieve articular Table Grading of Radiocarpal arthritis Grade Arthritis Bone graft was harvested ... http://www.josr-online.com/content/6/1/23 Page 10 of 10 14 Kapoor H, Agarwal A, Dhaon B: Displaced intraarticular fractures of distal radius: a comparative evaluation of results following closed reduction, external fixation and open ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"
... Oral Maxillofac Surg 1994;23:19-21 Haas R, Watzak G, Baron M, Tepper G, Mailath G, Watzek G A preliminary study of monocortical bone grafts for oroantral fistula closure Oral Surg Oral Med Oral ... technique after surgical failure The aim of the present case report is to analyze the healing of OAF with the associated use of an autologous bone graft, integrated by xenologous particulate bone graft, ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic...
Ngày tải lên: 25/10/2012, 11:48
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from ... cells may cause a dysfunctional cardiac flow and cause the sudden death of the transgenic mice, although it remains to be determined whether T antigen-expressing cardiac valves are functionally affected...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx
... CA-repeat and CA-rich elements: a new class of regulators of mammalian alternative splicing EMBO J 24, 1988–1998 41 Waldman AS, Tran H, Goldsmith EC & Resnick MA (1999) Long inverted repeats are an ... implicated as the mediator of constitutional t(11;22) translocation in humans [38] Although there are also a large number of (CA)n and (GA)n repeats in the human genome, the frequency of their ... procollagen exon is regulated by the combination of a weak 5¢ splice site and an adjacent intronic stem-loop cis element J Biol Chem 280, 32700–32711 Baraniak AP, Lasda EL, Wagner EJ & Garcia-Blanco...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx
... incubated for min, and a 5-lL aliquot of each sample was withdrawn and assayed for activity by the DTNB method using stearoyl-CoA as substrate (c) In an analogous manner, when stearoyl-CoA was ... stearoyl-CoA was used as 2379 Thioesterase of Alcaligenes faecalis P Shahi et al Table Thioesterase catalyzed hydrolysis of acyl-CoA derivatives A solution of acyl-CoA derivative was prepared in 100 mM ... 8.67 – – 2380 acetate propanoate butanoate hexanoate dodecanoate palmitate stearate FEBS Journal 273 (2006) 2374–2387 ª 2006 IMTECH P Shahi et al Thioesterase of Alcaligenes faecalis Reagent (1 mM)...
Ngày tải lên: 16/03/2014, 13:20
A simple large scale synthesis of very long aligned silica nanowires
... center of the tube and the other end was near the tubeÕs downstream end), the tube was evacuated by a mechanical rotary pump to a base pressure of  10À2 Torr The furnace was heated at a rate of ... them have thinner diameters of 5–10 nm A high-magnification TEM image (Fig 1c) shows that the nanowires are remarkably clean and smooth, and there are no particles at its surface An SAED pattern ... image), which is the location of the wafer (indicated by a two-way arrow) It can be seen that the as-grown nanowires on the wafer display well-aligned nature and have length of up to several...
Ngày tải lên: 16/03/2014, 15:03
The raman effect a unified treatment of the theory of raman scattering by molecules derek a long
... 564 A2 1 Polarization of Electromagnetic Radiation A2 1.1 Introduction A2 1.2 States of Polarization: Monochromatic Radiation A2 1.2.1 Linear polarization A2 1.2.2 Elliptical and circular polarization ... polarization A2 1.2.3 Stokes parameters A2 1.2.4 Stokes parameters for scattered radiation A2 1.3 States of Polarization: Quasi-Monochromatic Radiation A2 1.4 Change of Polarization: Depolarization Ratios, ... rotational constant, vibrational dependence of 197–198 rotational degeneracy 172–173, 214 rotational invariants, isotropic averages and 487–498 rotational matrix, diagonalization of 406 rotational matrix...
Ngày tải lên: 17/03/2014, 14:46
Low Occurrence of Tuberculosis Drug Resistance among Pulmonary Tuberculosis Patients froman Urban Setting, with a Long-Running DOTS Programin Zambia docx
... contributions made to this paper by Webster Kasongo and David Mwakazanga at the Tropical Diseases Research Centre, Zambia in study coordination and data analysis, respectively Finally, the authors thank ... strains from Sierra Leone,” BMC Microbiology, vol 8, article no 103, 2008 [22] J S Jarallah, A K Elias, M S Al Hajjaj, M S Bukhari, A H M Al Shareef, and S A Al-Shammari, “High rate of rifampicin ... American Journal of Respiratory and Critical Care Medicine, vol 152, no 3, pp 1067–1071, 1995 G Ramachandran, A K H Kumar, C Padmapriyadarsini, et al., “Urine levels of rifampicin & isoniazid in asymptomatic...
Ngày tải lên: 22/03/2014, 18:20
CrazY ''''08 How a Cast of Cranks, Rogues, Boneheads, and Magnates Created the Greatest Year in Baseball History ppt
... from trying—baseball people in particular The game has a sense of tradition as stern as that of the Royal Navy, and tradition demands that the armchair admirals must consult their charts In 1908, ... mandate, a legal victory that created a practical stalemate.28 Spalding could take no action; but neither could anyone else Finally, the parties cut a deal Freedman agreed to leave the game as ... to fire At the February 1908 annual meeting of the National League, the air at the Waldorf-Astoria fairly reeks of smoke and self-congratulation Baseball is “in a most prosperous and healthy condition,”...
Ngày tải lên: 23/03/2014, 22:20
Reproductive Senescence in a Long-Lived Seabird: Rates of Decline in Late-Life Performance Are Associated with Varying Costs of Early Reproduction pot
... Uria aalge, razorbill Alca torda, puffin Fratercula arctica and kittiwake Rissa tridactyla on the Isle of May 1986–96 Atlantic Seabirds 2:133–150 Holmes, D J., and S N Austad 1995 The evolution of ... effects may be subtle and may affect other aspects of performance such as foraging, as highlighted by a recent study on gray-headed albatrosses (Thalassarche chrysostoma) by Catry et al (2006), and ... performance in the years leading up to the death of an individual The use of YBD as an alternative to age or age proxies has two main advantages, since it (1) allows for the reliable detection of...
Ngày tải lên: 28/03/2014, 16:20
báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx
... degeneration and olecranon fracture Elbow degeneration and olecranon fracture Mayo Type IIA fracture of the left olecranon after a fall in a 52-year-old woman (A) Lateral (B) and anteroposterior radiographs ... Mayo Scale (VAS) patient satisfaction score (b) Visual AnaFigure logue Elbow Performance score (MEPS) (a) and Mayo Elbow Performance score (MEPS) (a) and Visual Analogue Scale (VAS) patient satisfaction ... 35 After Removal (a) 10 Patients 30 20 18 0 10 Grade of Pain Excellent Figure before and after hardware removal Visual Analogue Scale (VAS) subjective pain score in patients Visual Analogue Scale...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis and the preparation of the manuscript ... study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The authors would like to thank the surgical veterinary team of ... viability of non-treated days cultured bone demonstrated a central area of decreased marrow survival Macroscopically, all treatment groups, cultured on for days, showed almost no detectable marrow...
Ngày tải lên: 20/06/2014, 04:20