creating and using a custom data item xml file

Tài liệu Creating and Using a DataRelation Object doc

Tài liệu Creating and Using a DataRelation Object doc

... DataRelation(string dataRelationName, DataColumn[] parentDataColumns, DataColumn[] childDataColumns) DataRelation(string dataRelationName, DataColumn parentDataColumn, DataColumn childDataColumn, bool createConstraints) ... createConstraints) DataRelation(string dataRelationName, DataColumn[] parentDataColumns, DataColumn[] childDataColumns, bool createConstraints) DataRelation(string dataRelationName, string parentDataTableName, ... program Creating the DataRelation The DataRelation constructor is overloaded as follows: DataRelation(string dataRelationName, DataColumn parentDataColumn, DataColumn childDataColumn) DataRelation(string...

Ngày tải lên: 26/01/2014, 07:20

7 326 1
Tài liệu Creating and Using a DataView Object doc

Tài liệu Creating and Using a DataView Object doc

... mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); mySqlDataAdapter.Fill(myDataSet, "Customers"); mySqlConnection.Close(); ... DESC"; DataViewRowState rowStateFilter = DataViewRowState.OriginalRows; // create a DataView object named customersDV DataView customersDV = new DataView(); customersDV.Table = customersDT; customersDV.RowFilter ... "server=localhost;database=Northwind;uid=sa;pwd=sa" ); SqlCommand mySqlCommand = mySqlConnection.CreateCommand(); mySqlCommand.CommandText = "SELECT CustomerID, CompanyName, Country " + "FROM Customers"; SqlDataAdapter mySqlDataAdapter...

Ngày tải lên: 26/01/2014, 07:20

5 331 0
Tài liệu Creating and Using a DataViewManager Object pdf

Tài liệu Creating and Using a DataViewManager Object pdf

... SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); mySqlDataAdapter.Fill(myDataSet, ... "Customers"); mySqlConnection.Close(); DataTable customersDT = myDataSet.Tables["Customers"]; // create a DataViewManager object named myDVM DataViewManager myDVM = new DataViewManager(myDataSet); ... UsingDataViewManager.cs illustrates the use of a DataViewManager object */ using System; using System .Data; using System .Data. SqlClient; class UsingDataViewManager { public static void Main()...

Ngày tải lên: 26/01/2014, 07:20

4 351 0
Tài liệu Making and Using a Viewfinder Frame - Lập và Sử dụng một khung ngắm ppt

Tài liệu Making and Using a Viewfinder Frame - Lập và Sử dụng một khung ngắm ppt

... design, and teaching recreational drawing and painting classes As supervisor of her community’s recreational art department, Brenda hired and trained teachers, and designed curriculum for several ... planning a composition, and can be used for portraits, figures, landscapes, or any other drawing subjects You can easily make a viewfinder frame with some matt board or cardboard (preferably acidfree), ... “portrait”) or a horizontal (called “landscape”) drawing format Through the adjustable opening, you can examine and evaluate the relationships between the lines, values, and shapes of your subject...

Ngày tải lên: 14/12/2013, 15:15

7 501 0
Tài liệu Defining and Using a Class pdf

Tài liệu Defining and Using a Class pdf

... just as you can create many int variables in a program Each instance of the Circle class is an object that occupies its own space in memory, and runs independently of all the other instances ... accept that the new keyword creates a new instance of a class (more commonly called an object) IMPORTANT Don't get confused between the terms class and object A class is the definition of a ... type An object is an instance of that type, created when the program runs For example, it is possible to create many instances of the Circle class in a program by using the new keyword, just as...

Ngày tải lên: 15/12/2013, 00:15

2 437 0
Tài liệu Lab A: Creating and Configuring a Management Agent pdf

Tài liệu Lab A: Creating and Configuring a Management Agent pdf

... Management Agent box, click Tutorial HR (LDIF) Management Agent, and then click Create The Configure the Management Agent dialog box appears Configure HR MA to place metaverse namespace data ... mmsadmin@nwtraders.msft with a password of password Create an instance of the HR tutorial management agent called HR MA a In the control pane of MMS Compass, click Bookmarks, click Management Agents, and ... 2 Lab A: Creating and Configuring a Management Agent Exercise Creating an HR Management Agent In this exercise, you will use MMS Compass to create and configure the HR tutorial management agent...

Ngày tải lên: 18/01/2014, 05:20

5 438 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

... reader that our two algorithms are aimed at small datasets We randomly split each dataset into 10 subsets where each subset was a test set and the corresponding remaining sets were merged to a ... the mathematical model and performed experiments on language data of the morphologically complex language Zulu We compared the performance on increasing training set sizes and analysed for each ... 2006) They used a natural language tagger which was trained on the output of ParaMor and Morfessor The goal was to mimic each algorithm since ParaMor is rule-based and there is no access to Morfessor’s...

Ngày tải lên: 20/02/2014, 04:20

9 558 0
Báo cáo khoa học: "Stomatal and non stomatal limitation of photosynthesis by leaf water deficits in three oak species: a comparison of gas exchange and chlorophyll a fluorescence data" potx

Báo cáo khoa học: "Stomatal and non stomatal limitation of photosynthesis by leaf water deficits in three oak species: a comparison of gas exchange and chlorophyll a fluorescence data" potx

... maximal rate of net CO assimilation at high C (A was first af) i max fected According to von Caemmerer and Farquhar (1981) and Farquhar and Sharkey (1982), this could mean a decrease in the rate ... attained ≈ -3.0 MPa in Q petraea, and ≈ -4.0 MPa in Q pubescens and Q ilex During drought, A and g decreased in parallel, which led to a linear relationship and was an indication of a close ... was not wp due to variations in water status Stomatal closure and inhibition of A started between -1.0 and -2.0 MPa in all tested species A and g reached values near to zero when wp ψ attained...

Ngày tải lên: 09/08/2014, 03:24

16 232 0
Báo cáo y học: "Combined left hepatectomy with fenestration and using a harmonic scalpel, fibrin glue and closed suction drainage to prevent bile leakage and ascites in the management of symptomatic polycystic liver disease: a case report" pps

Báo cáo y học: "Combined left hepatectomy with fenestration and using a harmonic scalpel, fibrin glue and closed suction drainage to prevent bile leakage and ascites in the management of symptomatic polycystic liver disease: a case report" pps

... and small cysts at the anterior surface of the pancreas The hepatoduodenal ligament was exposed to provide access for vascular clamping and identification of major vascular Figure Intra-operative ... chronic and unrelenting right upper quadrant pain, epigastric fullness, early satiety, nausea, vomiting and dysphagia On physical examination, hepatomegaly and tenderness in the right upper quadrant ... related to large cysts or complications Associated medical problems, especially intracranial aneurysms and valvular heart disease need to be evaluated in patients with PLD [1,2] Surgical management...

Ngày tải lên: 11/08/2014, 14:20

5 355 0
CREATING AND USING BUFFERS IN ARCGIS  10.1

CREATING AND USING BUFFERS IN ARCGIS 10.1

... the Spatial Analyst check box and click Close Add your source features layer and your study area layer to your map Before you start to perform analyses on your data you should set the relevant ... an area up and allocates each cell to the nearest input feature The Euclidean Allocation tool creates raster zones that show the locations that are closest to a given point If you specify a maximum ... layer Processing Extent > set to same as your study area layer Raster Analysis > Cell Size > Maximum of Inputs In ArcToolbox, expand Spatial Analyst Tools > Distance > double-click on Euclidean...

Ngày tải lên: 17/03/2015, 09:34

2 416 0
Tài liệu Writing and Reading XML Using a DataSet Object ppt

Tài liệu Writing and Reading XML Using a DataSet Object ppt

... myDataSet.ReadXml("myXmlFile .xml" ); DataTable myDataTable = myDataSet.Tables["Customers"]; foreach (DataRow myDataRow in myDataTable.Rows) { Console.WriteLine("CustomerID = " + myDataRow["CustomerID"]); ... Address " + "FROM Customers " + "ORDER BY CustomerID"; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); ... WRITEANDREADXML.CS /* WriteAndReadXml.cs illustrates how to write and read XML files */ using System; using System .Data; using System .Data. SqlClient; class WriteAndReadXML { public static void Main()...

Ngày tải lên: 24/12/2013, 01:17

8 361 0
báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' Site : Fli1 3’ UTR pos 490-497 3' UUCCCUAAGGACCCUUUUGACCUG || ||||||| 5' UGAAGUUUUUUGCCC-AACUGGAA 5' UGAAG-UUUUCACCC-AACUGGAA ... |||||| 5' UUAAAUAUUUAGGUU ACUGGAA 5' UUGCAUAUUAAGAUU ACUGGAA 5' UUAAAUAUUUAGGUU ACUGGAA 5' CUGAAUCUUUAGAUU ACUGGAA Volume 1, Issue 11, Article 108 control No significant reduction was observed...

Ngày tải lên: 11/08/2014, 12:20

12 243 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA...

Ngày tải lên: 12/08/2014, 03:20

10 252 0
Creating and Management Data Base

Creating and Management Data Base

... tạo Cú pháp: CREATE DATABASE database_snapshot_name ON ( NAME = logical _file_ name, FILENAME = ‘os _file_ name’ ) [ , n ] AS SNAPSHOT OF source_database_name [;]  RDBMS and Data Management/ Session ... giao dịch  Thêm nhóm tập tin vào CSDL có: Cú pháp ALTER DATABASE database_name { | | | MODIFY NAME = new_database_name ... là: CREATE DATABASE database_name [ ON [ PRIMARY ] [ [ , n ] [ , [ , n ] ] [ LOG ON { [ , n ] } ] ] [ COLLATE collation_name ] ] [;] RDBMS and Data Management/...

Ngày tải lên: 01/09/2012, 09:09

25 766 0
Natural botanical products have a long history in the world and are featured in using a complex

Natural botanical products have a long history in the world and are featured in using a complex

... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... and 28 days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the shortest and the ... treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), followed by Dunnett t-test and post-hoc analysis when necessary Results Effect of CKBM treatment on gastric tumor...

Ngày tải lên: 03/11/2012, 09:54

9 713 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension analysis [13] This method recorded COP data and ... from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns in gait and posture data may serve as an indicator ... data were obtained using a k-max value of 60 for A/ P analysis and 30 for M/L analysis (cf [17]) The fractal dimension was calculated over the entire two minute epoch using all data points Traditional...

Ngày tải lên: 03/11/2012, 10:09

10 460 0
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

... Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this study was mainly compared the start-up ... to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are Chemical Oxygen Demand (COD), Total Nitrogen (TN), Total Phosphorus ... classical UASB and hybrid UASB-filter reactor Water Science and Technology 2004;49(11):295–301 [3] Rajakumar R, Meenambal T Comparative Study on Start – Up Performance of HUASB and AF Reactors Treating...

Ngày tải lên: 05/09/2013, 16:11

8 411 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... William Palm Professor of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...

Ngày tải lên: 05/09/2013, 17:03

12 636 1
w