Screening of chitinolytic bacteria from freshwater lake and analysis of chitinase system of the isolated bacteria

SUMMARY To develop a novel type of biocontrol agent, this study was focused on bacteria that are characterized by both high chitinase activity and high biofilm development because such b

SCREENING OF CHITINOLYTIC

BACTERIA FROM FRESHWATER LAKE AND ANALYSIS OF CHITINASE SYSTEM

OF THE ISOLATED BACTERIA

DINH MINH TRAN

SCREENING OF CHITINOLYTIC

BACTERIA FROM FRESHWATER LAKE AND ANALYSIS OF CHITINASE SYSTEM

OF THE ISOLATED BACTERIA

DINH MINH TRAN

Doctoral Program in Life and Food Sciences,

Graduate School of Science and Technology,

NIIGATA UNIVERSITY, 2018

CONTENTS

Abbreviations 3

Summary 5

Chapter 1 General introduction 8

1 1 Background of research 8

1.2 Occurrence, form, and application of chitin 10

1.3 Chitinases, classification, and application of bacterial chitinases 13

1.4 Bacterial AA10 proteins and potential application 15

1.5 Chitinolytic bacteria and application in biocontrol 16

1.6 Biofilm-forming bacteria and potential application in agriculture 17

1.7 Aeromonas species and their chitinases 18

1.8 Aeromonas salmonicida subsp salmonicida 20

1.9 Sakata, a sand dune lake 21

1.10 The aim of this study 21 Chapter 2 Screening and characterization of chitinolytic bacteria from a freshwater lake

2.2 Introduction 23

2.3 Materials and Methods 26

2.4 Results 36

2.5 Discussion 60

2.6 Conclusion 66

Chapter 3 Identification and sequence analysis of chitinase genes from Aeromonas salmonicida subsp salmonicida SWSY-1.411 67

3.1 Abstract 67

3.2 Introduction 68

3.3 Materials and Methods 71

3.4 Results 81

3.5 Discussion 121

3.6 Conclusion 134

References 135

List of tables 159

List of figures 160

Acknowledgments 163

ABBREVIATIONS

GlcNAc: N-acetylglucosamine

GH: Glycoside hydrolase

YEM medium: Yeast extract-supplemented minimal medium

LB medium: Luria-Bertani medium

PCR: Polymerase chain reaction

SDS–PAGE: Sodium dodecyl sulfate–polyacrylamide gel electrophoresis PDA: Potato dextrose agar

DDBJ: The DNA Data Bank of Japan

AA10: Auxiliary activities family 10

CBM: Carbohydrate-binding module

OD: Optical density

ORF: Open reading frame

IPTG: Isopropyl β-D-thiogalactopyranoside

aa: Amino acid

SUMMARY

To develop a novel type of biocontrol agent, this study was focused on bacteria that are characterized by both high chitinase activity and high biofilm development because such bacteria are thought to be secreted and concentrated chitinases in biofilms when adhered to chitin in fungal cell walls Samples, sediments and chitin flakes immersed in the water were collected from a sand dune lake, Sakata, in Niigata, Japan Chitin flakes are thought to be useful for collecting bacteria that have high chitinase activity and also form biofilms from freshwater environments Chitinolytic bacteria were isolated from the sediments and immersed chitin flakes using solid media containing colloidal chitin with or without subsequent subculturing in fresh liquid medium containing chitin flakes Thirty-one isolates from more than 5,100 isolated strains were selected to examine chitinase activity and biofilm formation Phylogenetic analysis of these isolates based on the 16S rRNA gene sequences revealed that most

isolates belonged to the family Aeromonadaceae, followed by the families

Paenibacillaceae, Enterobacteriaceae, and Neisseriaceae Based on the chitinase

activity, biofilm formation, and phylogenetic analysis, four strains, one each of Serratia and Andreprevotia and two strains of Aeromonas, were selected for further investigation

Total chitinase activity of each strain in a medium containing chitin powder was lower

than that of a reference, Serratia marcescens 2170 However, the specific activity of

chitinases of each strain was higher than that of the reference The molecular size of one

chitinase produced by Andreprevotia (~121 kDa) was greater than that of typical

growth of Trichoderma reesei These results indicate that these four strains are good

candidates for biocontrol agents

A nearly full-length segment of 16S rRNA gene nucleotides of isolate, A

salmonicida SWSY 1.411 shows 100% identity to that of A salmonicida A449

(CP000644) available in the CAZy database In the database, A salmonicida A449

(CP000644) is shown to be possessed one GH18 chitinase, two GH19 chitinases, and one AA10 protein Based on the nucleotide sequence of each gene and the surrounding

regions of that gene in A salmonicida A449 genome, primers were designed for the identifying and cloning of chitinase genes in our isolate, A salmonicida SWSY 1.411 Three genes involved in chitin-degradation were identified in the genomic DNA of A

salmonicida SWSY 1.411 by the polymerase chain reaction Among them, one gene

encodes a GH18 chitinase, one gene encodes a GH19 chitinase, and one gene encodes

an AA10 protein These genes were then cloned, sequenced, and analyzed deduced amino acid sequences Primary structures of all deduced enzymes contain a number of functional domains; among them, one chitin-binding domain belongs to a recently classified family of carbohydrate-binding modules, CBM73 ChiA contains a CBM5, a CBM73, and belongs to subfamily A of GH18 chitinases The catalytic domain of ChiB belongs to GH19 chitinases; ChiB contains a CBM5, a CBM73, and a PKD domain In addition, various works have been reported that bacterial GH18 chitinases commonly play high chitinase activity toward insoluble chitins, bacterial GH19 chitinases are primary enzymes involved in the antifungal activity, and bacterial AA10 proteins in combination with chitinases play an important role on hydrolysis of chitin These

analyses indicate that the chitinase system of A salmonicida SWSY 1.411 possibly

plays an important role on chitin-degradation and inhibition of hyphal growth of fungi

CHAPTER 1 GENERAL INTRODUCTION

1 1 Background of research

Chitin is an insoluble linear β-1,4-linked homopolymer of N-acetylglucosamine

(GlcNAc) and is widely distributed in nature such as a constituent of insect exoskeletons, shells of crustaceans, cell walls of fungi Chitinases (EC 3.2.1.14) are

enzymes that hydrolyze chitin by hydrolyzing β-1,4-glycosidic linkages These enzymes

are found in a variety of organisms, for instance, bacteria, fungi, insects, plants, and animals

Chitinase genes from a large number of chitinolytic bacteria have been cloned, analyzed, and their biochemical properties have been examined (Watanabe et al 1997, 1997; Tanaka et al 1999; Hashimoto et al 2000) So far, it is clear that various bacterial chitinases play a critical role in the digestion of chitin in fungal cell walls Among the chitinases, the enzymes belonging to family 19 of glycoside hydrolases (GH) have been shown to be primary enzymes involved in the antifungal activity (Ohno et al 1996; Watanabe et al 1999; Tsujibo et al 2000; Kawase et al 2006) These chitinases are mainly distributed in plant and a number of prokaryotic organisms have been shown to

be possessed such chitinases (Ohno et al 1996; Tsujibo et al 2000; Kong et al 2001; Ueda et al 2003; García-Fraga et al 2015) Therefore, chitinolytic bacteria which produce such chitinases could be widely applied as environmentally friendly agents for biocontrol of agricultural phytopathogens (Kamensky et al 2003; Meziane et al 2006; Bhattacharya et al 2007)

In addition, most of the chitinolytic bacteria and their chitinases that have been studied on phytopathogenic control have been isolated from soil and marine environments, while only a few of them have been isolated from freshwater environments (Huang et al 2012a) Therefore, the freshwater environment is a promising place to isolate new species or different types of chitinolytic bacteria which show high chitinase activity and high antifungal activity against pathogenic fungi and nematodes, among others, in agriculture

Recently, biofilm-forming bacteria that produce chitinases are thought to be important for biocontrol Chitinolytic bacteria that form biofilms can stably attach to the mycelia of fungi Chitin in fungal cell walls can then induce chitinase expression in chitinolytic bacteria, and the expressed chitinases can degrade chitin in the cell walls of such fungi for their nutrition sources, resulting in fungal death Thus, chitinolytic bacteria that form biofilms could be more efficient at degrading chitin in fungal cell walls than bacteria with no or low ability to form biofilms (Kjelleberg and Givskov 2007; Seneviratne et al 2008) However, to the best of our knowledge, no studies on prokaryotic organisms that form biofilms and produce chitinases and their applications

in agricultural fungal control have been described

Against this background, to develop a novel type of biocontrol agent, the current thesis was focused on chitinolytic bacteria that show high chitinase activity and form biofilms from a freshwater lake in Niigata, Japan

1.2 Occurrence, form, and application of chitin

insoluble linear β-1,4-linked homopolymer of N-acetylglucosamine (GlcNAc) (Figure

1.1) Chitin is widely distributed in nature such as the constituent of insect exoskeletons,

shells of crustaceans, cell walls of fungi, and so on The annual production of chitin has been estimated to be 1011 tons in aquatic systems alone (Yu et al 1993); therefore, chitin is thought to be the second most abundant biomass in nature after cellulose

Figure 1.1 Structure of chitin

1.2.3 Form of chitin

Chitin occurs in nature in one of the three crystalline forms, α-chitin, β-chitin, and γ-chitin, respectively α-Chitin is mainly present in shells of crabs, lobsters, shrimps,

fungal and yeast cell walls, as well as in insect cuticle, in which the chains are arranged

antiparallel to each other β-Chitin is found from squid pens, in which the chains are arranged in a parallel fashion γ-Chitin found in cocoon fibers of the Ptinus beetle and the stomach of Loligo (Rudall 1962, 1963), in which the molecules are arranged in both

parallel and antiparallel manners (Figure 1.2) However, it has been suggested that

γ-chitin may be a distorted version of either α- or β-γ-chitin rather than a true third

polymorphic form (Roberts 1998) Jang et al demonstrated that crystalline structure of

γ-chitin is closer to that of α-chitin (Jang et al 2004) Recently, Kaya et al revealed that

structure of γ-chitin is much closer to that of α-chitin than that of β-chitin (Kaya et al 2017) Among the forms of chitin, α-chitin is the most abundant form in nature

(Rinaudo 2006; Anitha et al 2014; Kim 2014)

1.2.4 Application of chitin

Chitin has various applications for a broad range of medicine, agriculture, industry, and

so on Chitin is widely used to immobilize enzymes and whole cells; enzyme immobilization has applications in food industry such as clarification of fruit juices and

processing of milk when invertase or α- and β-amylases are grafted on chitin

(Krajewska 2004) In addition, on the basis of biodegradability, nontoxicity, physiological inertness, antibacterial properties, hydrophilicity, gel-forming properties and affinity for proteins, chitin has also applications in many areas other than food such

as in biosensors (Krajewska 2004) Chitin-based materials are used for the treatment of industrial pollutants and absorb silver thiosulfate complexes (Songkroah et al 2004) Chitin can be processed in the form of films and fibers and used in medicine and pharmacy such as wound-dressing materials (Yusof et al 2003) and controlled drug release (Kato et al 2003) Chitin oligomers (chitohexaose and chitoheptaose) were reported to have an antitumor activity (Suzuki et al 1986) and thus they could be used

as antitumor drugs for human In agriculture, chitin has been used to enhance the efficiency of natural biocontrol agents (Kishore et al 2005) In the soil environment, there are many microorganisms acting as antagonists that produce chitinases against plant diseases caused by fungi When the soil is supplemented chitin, these enzymes are produced together with other hydrolases, resulting in increasing the efficiency of phytopathogenic control by such microorganisms

1.3 Chitinases, classification, and application of bacterial chitinases

1.3.1 Chitinases and classification

Chitinases (EC 3.2.1.14) are enzymes that catalyze the degradation of chitin, a

linear β-1,4-linked homopolymer of N-acetylglucosamine These enzymes are found in

a variety of organisms including organisms that do not contain chitin as their structural component, for instance, bacteria, fungi, insects, plants, and animals To date, most chitinases are classified into two different families of glycoside hydrolases (GH), families 18 and 19, on the basis of their amino acid sequences in the catalytic domain (Henrissat 1991; Henrissat and Bairoch 1993) Other chitinases belonging to families 23 and 48 were rarely found in some organisms For instance, a family 23 chitinase was

found in the moderately thermophilic bacterium, Ralstonia sp strain A-471 (Ueda et al

2009; Arimori et al 2013), whereas a family 48 chitinase was found in the leaf beetle,

Gastrophysa atrocyanea (Fujita et al 2006)

Bacterial chitinases are mainly from family 18 chitinases, whereas family 19 chitinases are only found in a relatively limited group of prokaryotic organisms (Ohno

et al 1996; Tsujibo et al 2000; García-Fraga et al 2015) The chitinases of these two families do not share sequence similarity and differ in their three-dimensional (3D) structures (Davies and Henrissat 1995), they are thus considered to have different

evolutionary origins The catalytic domains of family 18 chitinases have (β/α)8 barrel folds (Perrakis et al 1994; van Aalten et al 2000), whereas those of family 19

anomer product by a retaining mechanism (Tews et al 1997), while family 19 chitinases

produce an α-anomer product via an inverting mechanism (Brameld and Goddard 1998)

Bacterial GH18 chitinases are classified into three subfamilies, A, B, and C

Subfamily A chitinases have an extra domain with a small α + β domain inserted into

the seventh and eighth (α/β)8 barrel, while subfamilies B and C have no such domain (Suzuki et al 1999)

1.3.2 Application of bacterial chitinases

For yeast cells which contain constituent chitin, chitinase is shown to be

required for cells separation during growth of Saccharomyces cerevisiae (Kuranda and

Robbins 1991) Various bacteria which do not contain constituent chitin produce chitinases for degradation and utilization of chitin as carbon and nitrogen sources for their growth Therefore, chitinase-producing bacteria play an important role in the closing of carbon and nitrogen cycles of the biosphere Bacterial chitinases can be used

to treat chitinous biomass of marine organisms such as shrimp and crab shells; hence they play an important role in reducing water pollution and waste management The degraded chitinous wastes (seafood) can be used as biofertilizers for agriculture (Sakai

et al 1998)

Chitinases have also been used in various other fields including health care, food,

chemical, and agriculture For example, a chitinase from Vibrio alginolyticus was used

to prepare chitopentaose and chitotriose from colloidal chitin (Murao et al 1992) and these products could be used for medicine as antitumor drugs (Suzuki et al 1986) For human health care, chitinases can be used as antifungal creams (Dahiya et al 2006)

To date, one of the most important applications of bacterial chitinases is biocontrol of plant pathogenic fungi Various chitinases from chitinolytic bacteria have been shown to be inhibited phytopathogenic fungi (Chernin et al 1995; Kamensky et al 2003; Itoh et al 2006) and these chitinase-producing bacteria have been widely applied for crop production as biocontrol agents (Kurze et al 2001; Kamensky et al 2003; Meziane et al 2006; Bhattacharya et al 2007)

1.4 Bacterial AA10 proteins and potential application

Bacterial chitinases often work synergistically with chitin-binding proteins (CBP) Chitin-binding proteins that were previously classified into carbohydrate-binding modules (CBM) in family 33 have been reclassified into the auxiliary activities family 10 (AA10) of lytic polysaccharide monooxygenases (LPMO), according to the CAZy database (Levasseur et al 2013) A number of bacterial AA10 proteins have been

described previously in detail such as CHB1 from Streptomyces olivaceoviridis ATCC

11238 (Schnellmann et al 1994) and CBP21 from Serratia marcescens 2170 (Suzuki et

al 1998) These proteins showed no enzymatic and antifungal activities but they

strongly bound to chitinous substrates Vaaje-Kolstad et al reported that an AA10 protein from Serratia marcescens BJL200, SmLPMO10A (formerly CBP21), strongly promoted hydrolysis of crystalline β-chitin by chitinase A and C produced by the bacterium Thus, binding was not sufficient for SmLPMO10A functionality, it assisted

in the enzymatic degradation of an insoluble carbohydrate via non-hydrolytic disruption

of the substrate (Vaaje-Kolstad et al 2005a) Recently, SmLPMO10A was reported

(Vaaje-Kolstad et al 2010) Moreover, a synergistic effect of the chitinases and an AA10 protein produced by S marcescens CFFSUR-B2 has been investigated and

revealed that the AA10 protein enhanced the chitinase activity of the chitinases on chitin degradation (Gutiérrez-Román et al 2014) Therefore, the bacterial AA10 proteins in combination with chitinases play an important role on hydrolysis of chitin and therefore possibly have a contribution in the antifungal activity

1.5 Chitinolytic bacteria and application in biocontrol

Chitinolytic bacteria usually produce a number of chitinases and/or AA10 proteins in order to degrade chitin for their carbon and nitrogen sources Various genes encoding chitinases and AA10 proteins have been cloned, analyzed, and characterized

from a variety of bacteria such as Serratia marcescens 2170 (Watanabe et al 1997; Suzuki et al 1998; Suzuki et al 1999), Bacillus circulans WL-12 (Watanabe et al 1990, 1992; Alam et al 1995), Alteromonas sp O-7 (Tsujibo et al 1993, 2002; Orikoshi et al 2003), Chitiniphilus shinanonensis SAY3 (Huang et al 2012a, 2012b), Paenibacillus sp FPU-7 (Itoh et al 2013, 2014) A large number of bacteria have been reported to be

produced chitinases with antifungal activity by both GH18 and GH19 chitinases Among them, family 19 chitinases are primary enzymes involved in inhibitory activity

against fungi (Watanabe et al 1999; Kawase et al 2006), while only a few family 18 chitinases have such activity (Chernin et al 1997) The bacterial AA10 proteins in

combination with chitinases play an important role in the hydrolysis of chitin and may display a role in the inhibition of hyphal growth of fungi Therefore, various studies have been revealed that chitinases and chitinolytic bacteria display an important role for

biocontrol of various pathogenic fungi and chitinolytic bacteria could be widely applied

as environmentally friendly agents for biocontrol of fungal phytopathogens in agriculture (Kurze et al 2001; Kamensky et al 2003; Meziane et al 2006; Bhattacharya

et al 2007)

1.6 Biofilm-forming bacteria and potential application in agriculture

Microbial cells attach to biotic or abiotic surfaces and develop biofilms One of the functions of biofilms is to protect microorganisms against stress conditions of their living environments (Singh et al 2006) Recently, it was reported that biofilm-forming bacteria play a role for controlling fungi by secreting and concentrating secondary metabolites compounds as antifungal antibiotics in the biofilms (Kjelleberg and Givskov 2007; Seneviratne et al 2008) In addition, Hover et al demonstrated that a

soil chitinolytic bacterium, Serratia marcescens 1, has an ability to bind to, migrate

along, form biofilms on, and kill the hyphae of several zygomycete molds, such as

Absidia, Rhizopus sp, Rhizopus oryzae, Rhizopus microspores, and Mucor circinelloides

(Hover et al 2016) However, this strain is causative of diseases in animals including humans, so it has been difficult to apply the strain for fungal biocontrol in crop production Until now, no studies on prokaryotic organisms that form biofilms and produce chitinases and their applications in agricultural fungal control have been reported From the above descriptions of biofilm-forming bacteria, it is a high probability that chitinolytic bacteria that form biofilms and produce chitinases can secrete and concentrate secondary metabolites and chitinases in the biofilms and these

bacteria that show high chitinase activity are thought to be played a promising role on fungal biocontrol as well as can be applied as a novel type of biocontrol agents in agricultural production

1.7 Aeromonas species and their chitinases

Members of the genus Aeromonas are Gram-negative bacteria and widespread in

aquatic environments They can grow from 0 to 45 ℃ depending on each species The optimum temperature for growth varies from 20 to 37 ℃ and some species do not grow

at 35 ℃ The genus Aeromonas comprises at least fourteen species, among them, some species have several subspecies The species of Aeromonas include A hydrophila, A

allosaccharophila, A bestiarum, A caviae, A encheleia, A eucrenophila, A jandaei, A media, A popoffii, A salmonicida, A schubertii, A sobria, A trota, and A veronii

Some species of Aeromonas are the primary cause of extra-intestinal illness and are

strongly associated with gastrointestinal disease in a wide variety of warm-blooded and cold-blooded animals, including humans, frogs, freshwater and saltwater fishes, and

invertebrates (Staley et al 2005) For example, A hydrophila, A veronii biovar sobria,

A caviae, A jandaei, A veronii biovar veronii, A schubertii and A trota have

associated with various human infections including gastroenteritis, wound infections and septicemia

Various chitinase genes have been cloned, analyzed, and the chitinases have

been characterized from members in the genus Aeromonas Interestingly, some reports have demonstrated that several GH18 chitinases from Aeromonas possess some forms

of chitinases indicating an adaptation of chitinolytic bacteria to utilize extracellular

insoluble chitin efficiently when a distribution of chitin is limited A detailed model of

chitinases from the genus Aeromonas is Aeromonas sp 10S-24, a soil chitinolytic

bacterium This bacterium produces a number of GH18 chitinases (Shiro et al 1996; Ueda et al 1996; Sutrisno et al 2001), one GH19 chitinase (Ueda et al 2003), and one

β-N-acetylglucosaminidase (Ueda et al 2000) A freshwater chitinolytic bacterium,

A hydrophila SUWA-9 was reported to be possessed three different forms (90, 70, and

60 kDa) of a GH18 chitinase, ChiA, in the periplasm of the bacterium but only one form (60 kDa) was secreted in the culture supernatant when the bacterium was grown in the

presence of colloidal chitin (Lan et al 2006) Strain SUWA-9 also produces two

β-N-acetylglucosaminidases in order to participate in the chitin degradation (Lan et al 2004,

2008) On the other hand, a marine bacterium, A caviae CB101 produces a GH18

chitinase with four different forms (92, 82, 70, and 55 kDa) in culture supernatant and

these forms are encoded by a single gene, chi1 (Mehmood et al 2010) In addition, a freshwater chitinolytic bacterium, A veronii CD3 produces ChiCD3 belonging to family

18 chitinases with a molecular size of ~110 kDa ChiCD3 shows the highest activity of chitinase against colloidal chitin and has a capacity to control myxozoa infection in the fish cultivation by degradation of chitin in the shell valve of myxospores (Liu et al 2011)

In the CAZy database, Aeromonas species are shown to be possessed a number

of GH18 chitinases, GH19 chitinases, and AA10 proteins To date, most studies have

been focused on GH18 chitinases from Aeromonas, only one GH19 chitinase has been

1.8 Aeromonas salmonicida subsp salmonicida

A salmonicida, a non-motile aeromonad, is the aetiological agent of a bacterial

septicemia in fish called furunculosis (Reith et al 2008) The bacterium grows

optimally at temperatures between 22 and 25 ℃ (Staley et al 2005) A salmonicida

isolated from human fecal specimens was reported to be unable to grow at 37 ℃, and therefore, it is not pathogenic in humans (Altwegg et al 1990) In natural environments, this bacterium can grow at 37 ℃; however, when grown at high temperatures, i.e., 25–

37 ℃, it leads to the loss or inactivation of some virulence genes that cause furunculosis

of non- and salmonid fishes (Ishiguro et al 1981; McIntosh and Austin 1991; Stuber et

al 2003; Daher et al 2011)

To date, A salmonicida is composed of five subspecies: salmonicida,

achromogenes, masoucida, smithia, and pectinolytica Among them, A salmonicida

subsp salmonicida is the causative agent of furunculosis for only salmonid fish while

other subspecies are the causative agents of such disease for non-salmonid fish as well

as salmonids (Staley et al 2005; Reith et al 2008) So far, almost works related to these subspecies have been focused on controlling the disease and developing vaccines to

control the disease caused by A salmonicida (Rømer Villumsen et al 2012; Romstad et

al 2013; Kim et al 2015), no reports of characterization of chitinases and AA10 proteins have been published

In the CAZy database, the genome sequence of only one strain of the subspecies,

A salmonicida subsp salmonicida A449 is available and the chitinase system of the

subspecies is revealed Strain A449 possesses one GH18 chitinase, two GH19 chitinases,

and one AA10 protein However, these proteins have not been experimentally done yet Consequently, it is interesting to study the chitinase system from this subspecies in order to elucidate the role of its chitinases and AA10 protein on chitin-degradation and biocontrol ability

1.9 Sakata, a sand dune lake

Sakata is a sand dune lake in Niigata, Japan It is located at 37°49′N, 138°52′E,

at 5 m above sea level, and has an area of 0.76 km2 The lake water is mainly provided

by groundwater running under the dunes Sakata has only one small stream, along which the lake water flows into a river, which does not freeze in the winter Various aquatic species live in the lake, such as shrimp, crabs, and fishes Because no rivers flow into the lake, the chitin sources accumulated in Sakata are hardly altered by the action of flowing water, so different types of chitinolytic bacteria may remain at this site Therefore, Sakata is thought to be a particularly promising place to isolate new species or different types of chitinolytic bacteria

1.10 The aim of this study

The aims of this study were as follows:

1) Screen novel species or different types of bacteria that possess high chitinase activity and generate biofilms for biocontrol agent

2) Analyze chitinase and antifungal activities of the selected bacteria

CHAPTER 2 SCREENING AND CHARACTERIZATION OF CHITINOLYTIC BACTERIA

FROM A FRESHWATER LAKE 2.1 Abstract

To develop a novel type of biocontrol agent, we focus on bacteria that are characterized by both chitinase activity and biofilm development Chitinolytic bacteria were isolated from sediments and chitin flakes immersed in the water of a sand dune lake, Sakata, in Niigata, Japan Thirty-one isolates from more than 5,100 isolated strains were examined chitinase activity and biofilm formation Phylogenetic analysis of these isolates based on the 16S rRNA gene sequences revealed that most isolates belonged to

the family Aeromonadaceae, followed by Paenibacillaceae, Enterobacteriaceae, and

Neisseriaceae The specific activity of chitinase of four selected strains was higher than

that of a reference strain The molecular size of one chitinase produced by

Andreprevotia was greater than that of typical bacterial chitinases The dialyzed culture

supernatant containing chitinases of the four strains suppressed the hyphal growth of

Trichoderma reesei These results indicate that these four strains are good candidates

for biocontrol agents

2.2 Introduction

Chitin, an insoluble linear β-1,4-linked homopolymer of

N-acetyl-D-glucosamine (GlcNAc), is the second most abundant polysaccharide in nature after cellulose, with an annual production of 100 billion tons (Yu et al 1993), and is a common constituent of fungal cell walls, exoskeletons of insects, and shells of crustaceans Chitinases (EC 3.2.1.14) are glycoside hydrolases that degrade chitin by

hydrolyzing β-1,4-glycosidic linkages These enzymes occur in a variety of organisms

On the basis of amino acid sequence similarity in the catalytic domain, most chitinases are classified into two different families of glycoside hydrolases, families 18 and 19 (Henrissat 1991; Henrissat and Bairoch 1993) Family 18 chitinases are distributed in a wide range of organisms including bacteria, fungi, viruses, plants, and animals, whereas family 19 chitinases are mostly found in plants and a relatively limited group of prokaryotic organisms (Ohno et al 1996; Tsujibo et al 2000; Kong et al 2001; Ueda et

al 2003; Hoell et al 2006; Huang et al 2012a; García-Fraga et al 2015)

Chitinase genes from various chitinolytic bacteria have been cloned, analyzed, and their biochemical properties have been examined in detail (Watanabe et al 1997, 1997; Tanaka et al 1999; Hashimoto et al 2000; Howard et al 2004) A large number

of studies have reported that chitinases and chitinolytic bacteria play an important role

in inhibiting the mycelial extension of various pathogenic fungi (Chernin et al 1995; Kamensky et al 2003; Itoh et al 2006; Prasanna et al 2013) Therefore, bacterial chitinases play a critical role in the digestion of chitin in fungal cell walls, and

biocontrol of agricultural phytopathogens (Kurze et al 2001; Kamensky et al 2003; Meziane et al 2006; Bhattacharya et al 2007; Rahman et al 2016) Of the bacterial chitinases, family 19 chitinases have been found to be primary enzymes involved in inhibitory activity against fungi (Ohno et al 1996; Watanabe et al 1999; Tsujibo et al 2000; Kawase et al 2006; Huang et al 2012a; García-Fraga et al 2015), while only a few family 18 chitinases have been reported to exhibit such activity (Chernin et al 1997; Prasanna et al 2013) Most of the chitinolytic bacteria and their chitinases that have been studied in the context of phytopathogenic control have been isolated from soil and marine environments, while only a few of them have been isolated from freshwater environments (Huang et al 2012a) Thus, analyses of chitinolytic bacteria isolated from freshwater environments and characterization of their chitinases are important for understanding their function and efficiency against pathogenic fungi and nematodes, among others, in agriculture

Microbial cells attach to biotic or abiotic surfaces and develop biofilms A biofilm can be formed by a single bacterial species or can contain numerous species of bacteria, fungi, algae, and/or protozoa Biofilms have been shown to protect microorganisms against environmental stresses (Singh et al 2006) Chitinolytic bacteria that form biofilms can stably attach to the mycelia of fungi Chitin in fungal cell walls can induce chitinase expression in chitinolytic bacteria, and then the expressed chitinases can degrade such chitin as a source of nutrition, resulting in fungal death Chitinolytic bacteria that form biofilms could be more efficient at degrading chitin in fungal cell walls than bacteria with no or low ability to form biofilms (Kjelleberg and Givskov 2007; Seneviratne et al 2008) However, to the best of our knowledge, no

studies on prokaryotic organisms that form biofilms and produce chitinases and their applications in agricultural fungal control have been reported The attachment of some bacteria to fungi and the role of this process in destroying fungi has been reported For

example, Pseudomonas aeruginosa has been shown to be a bacterium that attaches to, spreads on, and kills the dimorphic pathogenic fungus Candida albicans via its filamentous form (Hogan and Kolter 2002) In addition, Salmonella enterica Typhimurium SL1344 has the ability to form biofilms on the hyphae of Aspergillus

niger (Brandl et al 2011) Moreover, recently, Hover et al demonstrated that a soil

chitinolytic bacterium, Serratia marcescens 1, bound to, migrated along, formed biofilms on, and killed the hyphae of several zygomycete molds, such as Absidia,

Rhizopus sp, Rhizopus oryzae, Rhizopus microspores, and Mucor circinelloides (Hover

et al 2016) Unfortunately, these bacteria are causative of diseases in animals including humans, so it has been difficult to apply them for fungal biocontrol in crop production

Against this background, in this report, we describe the screening of freshwater bacteria for those that possess high chitinase activity and generate biofilms from Sakata,

a sand dune lake, in Niigata, Japan, and we analyzed the chitinase and antifungal activities of the selected bacteria and the culture supernatant Sakata has no inflow, with the lake water instead being provided by groundwater Hence, Sakata is thought to be a particularly promising place to identify new species or different types of chitinolytic bacteria

2.3 Materials and Methods

2.3.1 Sampling and isolation of chitinolytic bacteria

Sakata is a sand dune lake in Niigata, Japan It is located at 37°49′N, 138°52′E,

at 5 m above sea level, and has an area of 0.76 km2 The lake water is mainly provided

by groundwater running under the dunes Sakata has only one small stream, along which the lake water flows into a river, which does not freeze in the winter To isolate chitinolytic bacteria, the sediments from five sites in the lake were collected Two nylon nets containing crab shell chitin flakes (Tokyo Chemical Industry, Tokyo, Japan) and two nylon nets containing shrimp shell chitin flakes (Sigma-Aldrich, USA), 10 g per bag, were placed in the lake water at two different sites in Sakata Seven days later, the chitin flakes were recovered and any bacteria bound to them were isolated

For isolating bacteria from the sediments, 1 g (wet weight) of each sediment was suspended in 9.0 mL of sterile water One hundred microliters of each suspension at an appropriate dilution was spread on yeast extract-supplemented minimal (YEM) agar medium (w/v, 0.05% yeast extract, 0.1% (NH4)2SO4, 0.136% KH2PO4, 0.03% MgSO4·7H2O, pH 8.5, 1.5% agar) and synthetic agar medium (w/v, 0.5% (NH4)2SO4, 0.085% KH2PO4, 0.015% K2HPO4, 0.05% MgSO4, 0.01% NaCl, 0.01% CaCl2, pH 6.1, 1.5% agar) containing 0.2% (w/v) colloidal chitin and incubated at 30 °C for 2 days Then, chitinolytic bacteria grown on the plates were isolated

To isolate chitinolytic bacteria strongly adhering to the chitin flakes, a portion of the chitin flakes was inoculated into fresh synthetic medium containing chitin and subcultured several times, as previously described (Sato et al 2009) This work involves

a sub-screening step to select the dominant bacteria that have high chitinase activity after subculturing Briefly, 0.2 g of chitin flakes was inoculated in 100 mL of synthetic medium containing 0.2% chitin flakes as the sole carbon source and incubated at 30 °C and 150 rpm until the culture showed significant turbidity caused by bacterial growth Then, 100 µL of the culture was transferred into a fresh synthetic medium After five cycles of cultivation, chitinase-producing bacteria in the culture medium at appropriate dilutions were spread and purified on synthetic agar plates containing 0.2% colloidal chitin at 30 °C

In addition, to collect a different type of chitinolytic bacteria forming biofilms

on the chitin flakes, 1 g of chitin flakes was vigorously washed with 9.0 mL of sterile water, and bacterial cells from the water were inoculated and purified on the YEM solid medium supplemented with 0.2% colloidal chitin at 30 °C The isolation procedures are

illustrated in Figure 2.1

2.3.2 Chitinase activity in the culture supernatant

Isolated chitinolytic bacteria were grown in YEM medium containing 0.2% colloidal chitin for 3 days (30 °C, 150 rpm) Cells were separated by centrifugation

(8,000 × g, 5 min, 4 °C) and the supernatant was dialyzed against 20 mM sodium

phosphate buffer (pH 6.0) overnight at 4 °C The dialyzed protein solution was used for measuring chitinase activity and protein concentration The chitinase activity assay was conducted in a reaction mixture (total volume, 600 µL) containing 0.1% colloidal chitin

as the substrate and an appropriate volume of crude enzyme in 20 mM sodium phosphate buffer (pH 6.0) The reaction mixture was incubated for 15 min at 37 °C, and the amount of reducing sugars released in the reaction was then measured by a modified

version of Schales’ procedure using N-acetyl-D-glucosamine (GlcNAc) as a standard

(Imoto and Yagishita 1971) One unit of chitinase activity was defined as the amount of enzyme that released 1 µmol of reducing sugar per min

Protein concentration in the culture supernatants was measured using a BCA Protein Assay Kit (Thermal Scientific, USA) with bovine serum albumin as a standard

2.3.3 Quantitative biofilm assay

The biofilm formation of the isolates was estimated using a 96-well microtiter plate, in accordance with a previously described procedure (Jackson et al 2002) Overnight cultures of bacterial strains were inoculated at 1:100 in 200 μL of Luria-Bertani (LB) medium Inoculated cultures were grown in the 96-well polystyrene microtiter plate for a further 24 h at 26 °C, without shaking After cultivation, the unbound cells were removed by discarding the medium and rinsing the wells with water

three times, after which the bound cells were stained with 1.0% (w/v) crystal violet for

at least 1 min and then rinsed three times with water Then, the dye was solubilized with 33% (v/v) acetic acid Finally, the biofilm formation was quantified by measuring the absorbance at 630 nm using a microtiter plate reader (Model 680; Bio-Rad, USA)

2.3.4 PCR amplification, sequencing, and phylogenetic analysis of the 16S rRNA gene

Genomic DNA from an overnight culture of each isolate was extracted by boiling for 5 min, followed by centrifugation (13,000 rpm, 1 min, 4 °C) to remove debris and unbroken cells The genomic DNA in the supernatant was used as a template for amplification by the polymerase chain reaction (PCR) A nearly full-length segment

of 16S rRNA gene nucleotides was amplified in a 50-µL reaction tube using universal

primers, 27f-YM and 1492r (Table 1), and a KOD-Plus-Neo Kit (Toyobo Co., Ltd.,

Osaka, Japan), in accordance with the manufacturer’s instructions The reaction mixtures were incubated in an iCycler thermal cycler (Bio-Rad, USA) under a schedule consisting of predenaturation at 94 °C for 2 min, followed by 35 cycles of denaturation

at 98 °C for 10 sec, annealing at 48 °C for 30 sec, and extension at 68 °C for 1 min The amplified products were then separated by electrophoresis on agarose (1.5%, w/v) gel The target bands in the agarose gel were cut out and purified using a Wizard SV Gel and Clean-Up Kit (Promega Co., USA) Sequencing reactions were conducted in a CEQ8000 Genetic Analysis System (Beckman Coulter Inc., USA) by using a CEQ Dye Terminator Cycle Sequencing Kit (Beckman Coulter Inc., USA) based on the supplier’s

Table 2.1 Oligonucleotides used in this study

Primers Primer sequences (5ʹ – 3ʹ) Description References

27f-YM AGAGTTTGATYMTGGCTCAG amplification, sequencing Frank et al

2008 1492r TACCTTGTTACGACTT amplification, sequencing

338f ACTCCTACGGGAGGCAGC sequencing Youssef et al

2009 805f GGATTAGATACCCTGGTAGTC sequencing

1238r GTAGCRCGTGTGTMGCCC sequencing

Note: f, forward primer; r, reverse primer M, A or C; R, A or G; Y, C or T

The nucleotide sequences of the 16S rRNA genes obtained by the sequencing were compared with the known 16S rRNA gene sequences available in the DDBJ/Genbank/EMBL databases using BLAST (https://blast.ncbi.nlm.nih.gov/) to determine the taxonomic positions of the isolates A phylogenetic tree was produced by using the MEGA version 6.0 software (Tamura et al 2013) after multiple alignments of data by CLUSTAL W (Larkin et al 2007) The tree was constructed using the neighbor-joining method (Saitou and Nei 1987), and evolutionary distances were computed using

the Kimura two-parameter method (Kimura 1980) A bootstrap analysis (1000 replications) was carried out to evaluate the topology of the resulting tree (Felsenstein 1985)

2.3.5 Chitinase production in culture supernatant and chitinase detection by SDS– PAGE and zymography

Serratia marcescens 2170 was used as a reference strain to compare the

production of chitinases of the isolates because S marcescens is well-known to be a

high-chitinase-producing bacterium and is one of the most extensively studied chitinolytic bacteria (Watanabe et al 1997; Vaaje-Kolstad et al 2013) Each isolate was aerobically cultivated in YEM medium containing 0.5% chitin powder (Junsei Chemical Co., Tokyo, Japan) at 30 °C and 150 rpm At each time point, a portion of the culture

was sampled After centrifugation (8000×g, 5 min, 4 °C) to remove the cells and debris,

the supernatant was dialyzed against 20 mM sodium phosphate buffer (pH 6.0) at 4 °C overnight The chitinase activity and protein concentration of the dialyzed protein solution were measured and the protein solution was analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and zymography

SDS–PAGE was carried out as described by Laemmli (Laemmli 1970) using 12.5% polyacrylamide gels Sample proteins were suspended in the loading buffer solution (62.5mM Tris-HCl [pH 6.8], 2% SDS, 5% β-mercaptoethanol, 10% glycerol, and 0.5% bromophenol blue), boiled for 3 min, and applied to SDS–PAGE analysis

detection of chitinase activity were performed as previously described (Watanabe et al 1990) using an agarose gel sheet containing 0.03% glycol chitin as the substrate

2.3.6 Antifungal activity assay

The antifungal activity of the isolated bacteria was determined by measuring the

inhibition of the growth of Trichoderma reesei IFO 31329 using a dual-culture plate

assay, by a modified version of a previously described method (Rahman et al 2016) A single colony (at day 2 of incubation) of the SWCS-3.14 isolate was streaked in a straight line (2.0 cm in length) at a distance of 2.5 cm from the center of agar plates containing a 1:1 (v/v) ratio of potato dextrose agar (PDA) and YEM supplemented with 0.2% glycol chitin The plates were incubated at 30 °C for 24 h to grow the bacteria Then, each single bacterial colony (at day 2 of incubation) of other isolates was inoculated in a straight line as described above After 24 h of incubation, a mycelial

plug (0.5 cm in diameter) of T reesei previously grown on the plate containing the same

medium components was placed on the plate center Plates without the inoculation of bacterial cells were employed as a control The plates were then incubated at 30 °C for 3 days and the antagonistic activity of the isolates was evaluated by visual inspection

Crude proteins prepared from a culture supernatant of the bacteria were also

analyzed for their inhibition of the extension of T reesei mycelia, via a modified

version of a previously described procedure (Watanabe et al 1999) The selected isolates were individually cultured in YEM medium containing 0.2% colloidal chitin for

3 days (30 °C, 150 rpm) After removing the cells and debris by centrifugation (9,000 rpm, 4 °C, 20 min), ammonium sulfate was added to the supernatants to achieve 80%

saturation The precipitates formed were dialyzed in 20 mM sodium phosphate buffer (pH 6.0) at 4 °C overnight to remove low-molecular-mass substances such as antibiotics Protein concentration and chitinase activity in the dialyzed sample were measured A blank paper disk (8 mm in diameter; Toyo Roshi Kaisha, Ltd., Tokyo, Japan) was placed in the center of a PDA plate (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan), onto which 40 µL of fungal conidial suspension (2.5–5 × 105 conidia/mL) was then inoculated After 24 h of incubation at 25 °C, wells (5.5 mm in diameter) were subsequently punched into the agar at a distance of 15 mm from the plate center A solution containing 0.4 mg of protein was applied to a well As a control, sterile water was added to the well To confirm the inhibition of hyphal growth caused by the crude chitinases or other components, the protein solutions (0.4 mg of protein per well) were boiled for 10 min to inactivate all chitinases Then, the protein solutions were applied to the wells as described above Finally, the plates were incubated for 1–3 days at 25 °C and the inhibition of mycelial extension was determined by visual inspection

2.3.7 Nucleotide sequence accession numbers

The sequences of the 16S rRNA gene of the 16 isolates determined in this study were deposited in the DNA Data Bank of Japan (DDBJ) database under accession numbers LC326488–LC326503

2.3.8 Colloidal chitin and glycol chitin preparation

Colloidal chitin was prepared from powdered chitin (code 038-13635, Wako

with 20 mL acetone to form a paste and then slowly added 200 mL concentrated HCl while grinding in a mortar After 2 h keeping at room temperature, the liquid was filtered through glass wool and poured into vigorously stirred with 50% ethanol to precipitate colloidal chitin The colloidal chitin formed was collected by centrifugation

(10,000 × g, 10 min, 4 ℃) and resuspended in deionized water several times to remove

excess acid and alcohol (until the pH of the solution was about 4), then dialyzed against running tap-water for 3 days and deionized water for 2 days The dialysate was

centrifuged (10,000 × g, 10 min, 4 oC) and concentration of colloidal chitin was measured by drying the sample at 60 oC

Glycol chitin was prepared from powdered chitin (code 038-13635, Wako Pure Chemical Industries, Ltd., Osaka, Japan) by the method of Jeuniaux (Jeuniaux 1966) Powdered chitin (5 g) was suspended in 42% (w/w) NaOH solution (100 mL) and the suspension was kept for 4 h at room temperature with occasional swirling The alkaline chitin thus obtained was filtered, washed with 42% NaOH solution, and pressed well until the weight of the cake of alkaline chitin was lower than 15 g The cake was transferred to a beaker and vigorously mixed with finely crushed ice (~50–70 g, precooled in a freezer) After mixing for 20 to 30 min, a highly viscous, alkaline chitin solution was obtained The solution was diluted to 250 mL with NaOH solution and the concentration of NaOH was adjusted to 14% (w/w) The alkaline-chitin solution was cooled in an ice bath and an appropriate amount of ethylene chlorohydrin was added dropwise with mixing for 30 min The ice bath was then removed and the mixture was allowed to stand overnight at room temperature The mixture was recooled in an ice bath and acetic anhydride (10 mL) was added dropwise with stirring After 30 min, the

mixture was then dialyzed against running tap-water for 3 days and deionized water for

2 days The dialysate was centrifuged (10,000 × g, 10 min, 4 oC) and concentration of glycol chitin was measured by drying the sample at 60 oC

2.4 Results

2.4.1 Isolation of chitinolytic bacteria

More than 5,100 isolates formed clearing zones caused by colloidal chitin degradation by chitinases on the agar plates Based on the size of the clearing zones and the morphological characteristics of their colonies, 31 isolates were selected for further examination Most colonies of these isolates were circular or irregular, smooth or slotted, translucent, umbonal, and entire when grown on the plates containing colloidal chitin

(Figure 2.2, Table 2.2) As shown in Table 2.2, seven bacteria isolated from sediments

formed smaller clearing zones than the other isolates Eleven strains, which were isolated from the chitin flakes after subculturing several times, showed large clearing zones on the colloidal chitin plate In particular, among the 31 isolates, 13 bacteria isolated from the chitin flakes without subculturing formed larger clearing zones than the other strains

Figure 2.2 The clearing zone formed by the isolates and references on the YEM agar

plates containing colloidal chitin The isolates and references were cultured on the YEM agar plates containing 0.5% colloidal chitin at 30 °C for 5 days (1), SWSY-3.47; (2),

SWSY-3.27; (3), SWCY-1.31; (4), SWSY-3.11; (5), Bacillus circulans WL-12; and (6),

Serratia marcescens 2170 B circulans WL-12 and S marcescens 2170 were used as

Table 2.2 Clearing zone and colony characteristics of the isolates

No Strain Isolation source

Halo zone

Shape Surface Color Elevation Edge

1 SSY-1.41 sediments ++ circular smooth opaque convex lobate

2 SSY-5.22 sediments ++ circular smooth opaque convex entire

3 SSY-1.17 sediments ++ circular smooth opaque convex entire

4 SSY-1.319 sediments ++ circular smooth opaque convex lobate

5 SSY-5.321 sediments ++ circular smooth opaque convex lobate