Detection of -28 (A>G) beta-thalassemia mutations by AMRS-PCR

Sequence of the beta globin gene in β thalassemia patient indicates the presence of the -28 (A>G) mutation (red box) that was detected by the ARMS-PCR using primer set desi[r]

Detection of -28 (A>G) beta-thalassemia mutations by

AMRS-PCR

Bui Thi Thu Anh1, Nguyen Thuy Ngan1, Vo Thi Thuong Lan1*

1 Faculty of Biology, VNU University of Science, 334 Nguyen Trai, Hanoi, Vietnam.

Abstracts Beta (β)-thalassaemia is the most common genetic disease of anemia caused by mutations

on beta globin gene In Vietnam, there is a high frequency of β -thalassemia carriers with a prevalence

ranging from 1.5 % to 25.0 % in the different ethnic groups To date, nine β thal mutations have been identified in the Vietnamese population from which the -28 (A>G) mutation exhibits variant frequency among different region of the country In this study, we designed ARMS primer sets specific to the -28 (A>G) mutation and used them to obtimize ARMS-PCR conditions for detecting this mutation in 263 β-thalassaemia patients Out of 263 patient, the -28 (A>G) mutation was found in 9 patients, accounting for 3.4 % This result was consistent with a range of this mutation (2.8 % -7.3 %), which has been previously described to North and South regions in the country The results of this study provide indicative data for preventive and control strategies concerning the genetic diagnosis of thalassemia in Vietnam.

Keywords: beta globin gene, beta thalassemia disease, -28 (A>G) mutation, polymerase chain

reaction-amplification refractory mutation system ARMS-PCR.

1 Introduction

Thalassemias, the commonest monogenic

disorders among the people living in

Southeast Asia, result from mutations on

anpha (α)- and beta (β) globin genes encoding)- and beta (β) globin genes encoding

globin proteins [1] Beta-thalassemia (β thal)

is caused by the most common point

mutations on the beta globin gene At

molecular level, beta-thalassemia represents a

great heterogeneity as more than 200

mutations have been identified for the

beta-globin gene responsible for this disease [2]

Based on the reduced (β+) or absent (beta0)

synthesis of the beta globin chains, clinical

consequences increase from mild to severe

anemia that require regular blood transfusion

[2] The major methods for mutation

detection of beta thalassemia are PCR-based

techniques such as amplification refractory

mutation system (ARMS) and allele specific

oligonucleotide probes (ASO) or reverse dot blot assay (RDB) [2] The ARMS is a simple method in which two primers identical in sequence except for 3' terminal nucleotide; one complementary to normal DNA and the other to mutant DNA at 3' terminal nucleotide In the ARMS-PCR, mutations were confirmed based on the presence/absence of PCR products on the electrophoresis gel This PCR based method has been extensively applied to detect β thalassemia point mutations [3-6]

In Vietnam, the carrier rate for β thalassemia varies from 1.5 % to 25 % depending on the ethnic groups of the population [5] The ARMS method has been routinely applied for detection of mutations in small samples of β thalassemia in Vietnam [7, 8] To date, nine β thal mutations have been identified in the Vietnamese population The substitute

mutations at CD17 (A>T), CD26 (G>A) and

frameshift mutation at CD41/42(–TTCT) are

the most common mutations detected among

large scale β thalassemia populations in

different parts of the country [9-12]

However, previous reports on the other

mutations including -28 (A>G) has been

conducted in small number of β thalassemia

patients so far [9, 12] Therefore, in this

study, 263 β thalassemia patients living in the

North part were recruited for analyzing the

-28 (A>G) mutations using the ARMS-PCR

method

2 Materials and methods

Tissue samples: A subset of 263 patients

suffering from β thalassaemia disease with

the HbA2 value above 3.5 % was enrolled for

β-thal mutation screening These patients

were hospitalled at the National Institute of

Hematology and Blood Transfusion The

anticoagulant blood samples collected in

tubes containing EDTA as anticoagulant from

patients were obtained in period from the

August, 2013 to the September, 2015 The

patients were not transfused before blood

collection The study was approved by the

guidelines of the local ethical committee in

Vietnam (QG.18-15, Vietnam National

University, Hanoi, Vietnam)

DNA Isolation: DNA was isolated from blood

samples by using QIAamp DNA Blood Mini

Kit (Qiagen) Concentration of DNA was

quantified by determination of OD260 and

quality of DNA was estimated on

electrophoresis agarose gel 1% and

visualized by ultraviolet illumination

Primers and PCR: Primer sets for

AMRS-PCR were designed from the nucleotide

sequence of the beta globin gene (GeneBank

version: U01317.1) They were designed on

basis of FastPCR programme and supplied

from IDT (USA) Primer positions, primer

sequences and PCR conditions were

presented in Figure 1 and Table 1 To obtimize the ARMS-PCR conditions, DNA extracted from patient containing the -28 (A>G) mutation that was detected by the StripTest Assay (Vienna Lab) was used as positive control and DNA extracted from health people was used as negative control The ARMS products were subjected to electrophoresis on 2% agarose gel containing ethidium bromide and were visualized by ultraviolet illumination

Fig.1 Primer positions in the beta globin

sequence

Table 1 Primer sequences and PCR

conditions Mutation nucleotides were

underlined

(bp) Control F ttgtactgatggtatggggccaag

580 Asobeta R actcctgatgctgttatggg

Control F ttgtactgatggtatggggccaag

224 -28(A/G) R atagatggctctgccctgacttC

PCR conditions: 95 0 C 3 min, 30 cycles ( 95 0 C 30s,

70 0 C 1 min), 72 0 C 5 min, 20 0 C ∞

3 Results

Genomic DNA was extracted from blood samples of 263 samples using QIAamp DNA Blood Mini Kit (Qiagen) and quality of DNA was checked on 1 % electrophoresis agarose gel Figure 2 indicated that genomic DNA has good quality and was suitable for analysis further

Figure 2 Genomic DNA extracted from blood

samples of β thalassemia patients (1-14) L: DNA

ladder 100 bp

The ARMS-PCR conditions were optimized

using a various range of primer

concentrations, time and temperature

anealling The obtimized condition allow to

amplify the ARMS-PCR product specific to

the -28 (A>G) mutation from positive control

only Subsequently, the PCR product was

amplified from povitive control with the

primer set (Control F/Asobeta R) and cloned

into pTZ57 plasmid Recombinant plasmid

was sequenced to confirm the presence of the

-28 (A>G) mutation (Fig 3) The result

indicated that the primer set designed by this

study was specific to the A>G mutation only

Thus, the optimized ARMS-PCR contidions

using this primer set allow to detect this

mutation in β thalassemia patients

Fig 3 Sequence of the beta globin gene in β

thalassemia patient indicates the presence of the

-28 (A>G) mutation (red box) that was detected by

the ARMS-PCR using primer set designed by this

study.

The distribution of the -28 (A>G) mutation

among 263 unrelated thalassemia patients

living in the Northern part of Vietnam was

analyzed using the optimized ARMS-PCR

The mutation was deteted in 9/263 patients

(3.4 %) The presentative result was shown in

Figure 4

Fig 4 Representative products of the

ARMS-PCR for screening the -28 (A>G) mutation in the

β thalassemia patients (1-26) NC: negative control, PC: positive control, L: DNA ladder 100 bp.

4 Discussion and conclusion

Beta thalassemia disease results from

mutations on the β globin gene, which were

most point mutations [2] Different approaches were performed to screening and determination of mutation carrier of β thalassemia [13] Among these approaches, the ARMS-PCR was the most common method due to its sensitivity and specificity [13] Indeed, three point mutations IVS-I-5(G>C), CD8/9(+G) and CD41/42(-TTCT) that constituted approximately 86 % of the all

21 β-globin mutations causing thalassemia in

Pakistani population were detected using the PCR [14] In Vietnam, the ARMS-PCR has been extensively applied to screening β thalassemia mutations For instance, Ha et al (2011) perfomed the ARMS-PCR for prenatal diagnosis of beta thalassemia at Vietnam National Hospital of Pediatrics [8] Recently, Trang et al (2016) developed in house the ARMS-PCR and Reverse Dot Blot Hybridization (RDB) assays to detect three most common beta thalassemia mutations [15]

The -28 (A>G) mutation is one of nine beta thalassemia mutations detected in Vietnamese patients so far [10] Its frequency is 3.0 % in

North part and more than 7 % in South part

of Vietnam [9, 12] However, this frequency

was estimated based on the small number of

screened patients (n<50) It is noteworthy that

a remarkable degree of variation in the gene

frequencies, even over relatively short

geographical distances has been described

[16] Thus, ascertaining beta globin

mutations in a population and at different part

of a country is necessary to build up suitable

preventive and control strategies concerning

genetic diagnosis [17]

In this study, 263 β thalassemia patients were

enrolled in screening of the -28 (A>G)

mutation We found the mutation in 9/263

patients, indicating that its frequency is not

more than 3.4 % depending on

homozygous/heterozygous state of this

mutation in these 9 patients As highlighted in

this study, the frequency of this mutation

provides more basic information for the

implementation of appropriate preventive and

control approaches since the complexity and

high cost of screening program could be

overcome by focusing on the most common β

thal mutations in the population instead of

screening a wide range of rare alleles [17]

Conclusion: We have created primer set and

applied them to the ARMS-PCR assay for

successful detection of the -28 (A>G)

mutation concerning to β thalassemia disease

Developing the ARMS-PCR for detection of

more than rare mutations at once was needed

in further, that will support for government

plan controlling inherited thalassemia in

resource-limited settings

Acknowledgements

The research was financially supported from Vietnam National University for the project QG.15.18

References

[1] S Fucharoen, P Winichagoon

Haemoglobinopathies in Southeast Asia Indian J Med 134 (2011) 498.

[2] A Cao, R Galanello Beta-thalassemia

Genet Med 12 (2010) 61.

[3] K.L Tan, J.A Tan, Y.C Wong, Y.C Wee, M.K Thong, S.F Yap Combine-ARMS: a rapid

and cost-effective protocol for molecular characterization of beta-thalassemia in Malaysia

Genet Test 5(1) ( 2001) 17.

[4] E.H Jiffri, N Bogari, K.H Zidan, S Teama, N.A Elhawary Molecular updating of

β-thalassemia mutations in the Upper Egyptian

population Hemoglobin, 34(6) (2010) 538.

[5] M Lin, J.J Zhu, Q Wang, L.X Xie, M Lu, J.L Wang, C.F Wang, T.Y Zhong, L Zheng, M.C Pan, J.R Wu, Y.F Wen, G.R Liu, X.F Zhan, F Lin, L.Y Yang Development and evaluation of a reverse dot blot assay for the simultaneous detection of common alpha and beta

thalassemia in Chinese Blood Cells Mol Dis, 48

(2012) 86.

[6] S Hassan, R Ahmad, Z Zakaria, Z Zulkafli, W.Z Abdullah Detection of β-globin gene mutations among β-thalassaemia carriers and patients in Malaysia: Application of multiplex amplification refractory mutation system–

Polymerase chain reaction Malays J Med Sci,

20(1) (2013) 13.

[7] B.K Hoa, N.Q Cuong Screening of mutations causing beta thalassemia in Northern

region of Vietnam TCNCYH, 40 (2006) 53.

[8] L.T.T Ha, N.T.P Mai, N.T.M Hương, N.D Ngọc, D.B.Trực, N.T Liêm, N.T.T Sinh Application of ARMS-PCR for prenatal diagnosis

of beta thalassemia at Vietnam National Hospital

of Pediatrics 2011, http://www thuvienykhoa.vn/

[9] L.T Hảo, S Pissard, P.H Van, C Lacobe,

T.D Hanh, M Goossens, T.D Kiet Molecular

analysis of beta thalassemia in South Viet Nam

Hemoglobin, 25 (2001) 305.

[10] M.G Doro, G Casu, L Frogheri, I Persico,

L.P.M Triet, P.T.T Hoa, N.H Hoang, M

Pirastru, P Mereu, F Cucca, B Masala

Molecular characterization of β-thalassemia

mutations in central Vietnam Hemoglobin, 41(2)

(2017) 96.

[11] D Filon, A Oppenheim, E.A Rachmilewitz,

R Kot, D.B Truc Molecular analysis of β

thalassemia in Vietnam Hemoglobin, 24(2)

(2000) 99.

[12] M.L.S Svasti, T.M Hieu, T Munkongdee,

P Winichagoon, T.V Be, T.V Binh, S

Fucharoen Molecular analysis of β-thalassemia

in South Vietnam American Journal of

Hematology, 71 (2002) 85.

[13] A.A Settin, M.M Al-Haggar, M

Neamatallah, A.M Al-Said, M.M Hafez

Detection of beta-thalassaemia mutations using

primer-specific amplification compared to

reversed dot blot hybridization technique in

Egyptian cases Haema, 9 (2006) 401.

[14] S.M Baig, F Rabbi, U Hameed, J.A Qureshi, Z Mahmood, S.H Bokhari, A Kiani, H Hassan, J.M Baig, A Azhar, T Zaman

Molecular characterization of mutations causing β-thalassemia in Faisalabad Pakistan using the amplification refractory mutation system

(ARMS-PCR) Ind J Hum Genet, 11(2) (2005) 80.

[15] N.T Trang, L.T.T Ha, N.T Ngan, T.T Sang, P.A.T Duong, V.T.T Lan Detection of common Beta-thalassemia mutations by reverse

Dot Blot analysis VNU Journal of Science: Natural Sciences and Technology, 32(1) (2016)

398.

[16] S de Silva, C.A Fisher, A Premawardhena, S.P Lamabadusuriya, T.E Peto, G Perera, J.M Old, J.B Clegg, N.F Olivieri, D.J Weatherall Thalassaemia in SriLanka: implications for the future health burden of Asian populations

Lancet, 355 (2000) 786.

[17] S Sinha, M L Black, S Agarwal, R Colah,

R Das, K Ryan, M Bellgard, A.H Bittles Profiling β-thalassaemia mutations in India at state and regional levels: implications for genetic education, screening and counseling programmes.

Hugo J, 3(4) (2009) 51

Phát hiện đột biến -28 (A>G) gây bệnh beta-thalassemia bằng

kỹ thuật AMRS-PCR

Bùi Thị Thu Anh1, Nguyễn Thùy Ngân1, Võ Thị Thương Lan1*

1 Khoa Sinh học, Trường Đại học Khoa học Tự nhiên, Đại học Quốc gia Hà Nội

Tóm tắt Bệnh thiếu máu beta (β)-thalassaemia là bệnh di truyền phổ biến do đột biến trên gen mã hóa

chuỗi beta globin gây ra Ở Việt Nam, tần suất người mang gen bệnh β-thalassaemia thay đổi từ 1,5 %

đến 25,0 % tùy thuộc vào dân tộc, vùng địa lý Đến nay đã có 9 loại đột biến trên gen beta globin gây

ra bệnh β-thalassaemia được phát hiện ở Việt Nam Bên cạnh các đột biến xảy ra với tần suất cao đã được nghiên cứu ở 3 miền Bắc, Trung, Nam; đột biến ở nucleotide -28 biến đổi A thành G có tần suất thay đổi giữa các vùng miền trong cả nước Trong nghiên cứu này, các cặp mồi được thiết kế và điều kiện của kỹ thuật ARMS-PCR (Amplification Refractory Mutation System-PCR) được tối ưu để phát hiện đột biến này trong 263 bệnh nhân thalassemia Đột biến -28 (A>G) được phát hiện trong 9/263 bệnh nhân chiếm tỷ lệ 3,4 % Kết quả này phù hợp với số liệu đã công bố cho bệnh nhân thalassemia ở

miền Bắc (2,8 %) Kết quả này là dữ liệu phục vụ cho định hướng triển khai các xét nghiệm sàng lọc đột biến gây bệnh thiếu máu thalassemia trong chương trình tư vấn, tầm soát bệnh

Từ khóa: gen beta globin, bệnh thiếu máu beta thalassemia, đột biến -28 (A>G), phản ứng chuỗi trùng hợp đặc

hiệu allen ARMS-PCR.