Casein kinase 1α has a non-redundant and dominant role within the CK1 family in melanoma progression

We previously identified CK1α as a novel tumor suppressor in melanoma and reported that the loss of CK1α leads to increased proliferation and invasive growth of melanoma cells by strong activation of the Wnt/βcatenin signaling pathway.

R E S E A R C H A R T I C L E Open Access

dominant role within the CK1 family in

melanoma progression

Tobias Sinnberg, Jun Wang, Birgit Sauer and Birgit Schittek*

Abstract

of CK1α leads to increased proliferation and invasive growth of melanoma cells by strong activation of the Wnt/β-catenin signaling pathway

Methods: In this study we analyzed expression and the functional effects of the dominantly expressed CK1- isoformsα,

δ and ε in melanoma cells by quantitative real-time PCR, western blot and immunohistochemistry We down-regulated CK1 kinase activity with isoform specific siRNAs and small molecule inhibitors Vice versa we overexpressed the CK1 isoformsα, δ and ε using viral vectors and tested the biological effects on melanoma cell proliferation, migration and invasion

Results: We show that protein expression of all three CK1-isoforms is downregulated in metastatic melanoma cells compared to benign melanocytic cells Furthermore, the CK1δ and ε isoforms are able to negatively regulate expression

of each other, whereas CK1α expression is independently regulated in melanoma cells Inhibition of the expression and activity of CK1δ or CK1ε by specific inhibitors or siRNAs had no significant effect on the growth and survival of

metastatic melanoma cells Moreover, the over-expression of CK1δ or CK1ε in melanoma cells failed to induce cell death and cell cycle arrest although p53 signaling was activated This is in contrast to the effects of CK1α where up-regulated expression induces cell death and apoptosis in metastatic melanoma cells

Conclusion: These data indicate that CK1α has a dominant and non-redundant function in melanoma cells and that the CK1δ and ε isoforms are not substantially involved in melanoma progression

Keywords: CK1, Melanoma, Beta-catenin, p53

Background

Malignant melanoma is the most aggressive form of skin

cancer whose incidence still increases worldwide

Mela-nomas arise from the transformation of benign

melano-cytes or nevi which can develop into dysplastic lesions

before progressing into primary melanomas that can

fur-ther invade into the dermis and metastasize via

hematogenous or lymphogenic routes to distant sites [1]

Initiation and progression of melanoma have been

asso-ciated with activation of key signaling pathways involved

in proliferation, survival and dissemination These

include the Ras/Raf/MEK/ERK (MAPK) and PI3K/AKT signaling pathways as well as the Wnt/beta-catenin sig-naling pathway [2]

Protein kinases play a central role in signal transduction

By reversible phosphorylation of its substrate proteins, they exert influence on their activity, localization and function and thus are involved in almost all cellular pro-cesses and functions The casein kinases (CK) belong to the serine/threonine kinases that are involved in a variety

of cellular processes Isoforms of the casein kinase 1 (CK1) family have been shown to phosphorylate key regu-latory molecules involved in cell cycle, transcription and translation, the structure of the cytoskeleton, cell-cell ad-hesion and in receptor-coupled signal transduction CK1 isoforms are key regulators of several cellular growth and

* Correspondence: birgit.schittek@med.uni-tuebingen.de

Department of Dermatology, Division of Dermatooncology,

Eberhard-Karls-University Tübingen, Liebermeisterstr 25, D-72076 Tübingen,

Germany

© 2016 The Author(s) Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made The Creative Commons Public Domain Dedication waiver

survival processes, including Wnt, Hedgehog and p53

sig-naling, cell cycle control, DNA repair and apoptosis [3, 4]

In humans, six CK1 isoforms exist (α, γ1, γ2, γ3, δ and

ε) and several splice variants for CK1α, δ, ε and γ3 have

been identified All CK1 isoforms possess a highly

con-served kinase domain, but differ in length and sequence

of the N-terminal and especially the C-terminal

non-catalytic domains CK1α plays a role in the mitotic

spin-dle formation during cell division and in DNA repair

mechanisms and further participates in RNA metabolism

[3, 4] The CK1 isoforms δ and ε are known to be

im-portant regulators in the circadian rhythm of eukaryotic

cells CK1α regulates apoptotic signaling pathways,

how-ever, there seem to be cell type-specific differences In

addition to the involvement in apoptotic signaling

path-ways, the CK1 isoformsα, δ and ε have important

regu-latory functions in the Wnt/β-catenin signaling pathway

and seems to act in a concerted manner [5, 6]

Dishev-elled (Dvl) is a key component in the Wnt/β-catenin

sig-naling pathway Upon pathway activation by Wnts, Dvl

becomes phosphorylated by CK1δ/ε [7] CK1α acts as a

negative regulator of the the Wnt/β-catenin signaling

pathway by acting as a priming kinase for β-catenin

phosphorylation on Ser45 which is a pre-requisite for

further phosphorylations by GSK3β at the Ser/Thr

resi-dues 33, 37 and 41 [6, 8] Without this priming

stabilized A down-regulation of CK1α thus leads - due

to the lack of “priming” phosphorylation - to an

accu-mulation of cytoplasmic β-catenin Indeed, we could

show in metastatic melanoma cells that CK1α is

down-regulated which correlated with increased β-catenin

stability [9]

The tumor suppressor protein p53 as well as the p53

interacting proteins MDM2 and MDMX are substrates of

the three CK1 isoforms CK1α, CK1δ and CK1ε In

differ-ent cell systems CK1α and CK1δ are described to regulate

p53 activity by phosphorylation of p53 itself or the p53

interacting proteins MDM2 and MDMX [3, 4, 10, 11]

Furthermore, the activity of p53 correlates with CK1α and

CK1δ expression under stress conditions which points to

an autoregulatory loop between CK1 isoforms and p53

[10, 11]

Some evidence points to an altered expression or

ac-tivity of different CK1 isoforms in tumor cells Database

analyses from tumor cell lines and tissues indicated that

the CK1δ and CK1ε isoforms might be slightly

overex-pressed on RNA level in some tumor types including

melanoma, whereas RNA expression of CK1α is more

variable but low in melanoma [4] The CK1γ1-3

iso-forms seem to be rather low in different cancers types

Expression analysis of CK1α in melanoma datasets

clearly revealed a reduction in mRNA expression during

melanoma progression and we could confirm the

reduction of CK1α expression in metastatic melanoma cells on RNA and protein level [4, 9] However, expres-sion of the other CK1 isoforms has not been systematic-ally analyzed in melanoma cells until now Furthermore,

it is not known whether there is a functional redundancy

of the CK1 isoforms in the regulation of cell survival and tumorigenesis since several substrates are shared within the CK1 family such asβ-catenin in the canonical Wnt pathway and p53 or Mdm-2 in the p53 signaling pathway [3, 4]

To identify the role of the different CK1 isoforms dur-ing melanoma progression we analyzed in this study a) the expression of the CK1 isoforms in melanoma cells of different progression stages in vitro and in vivo, b) the reciprocal influence of CK1 isoform expression for the

α, δ and ε family members and c) the functional effects

of gene expression modulation of individual CK1-isoforms (alpha, delta and epsilon) on melanoma cell survival, proliferation, migration and invasion

Methods

Cell culture

Human melanoma cell lines were cultured for this study

in RPMI 1640 medium with 2 mM L-Glutamine and

10 % fetal bovine serum (FBS; Biochrom, Berlin, Germany), penicillin, and streptomycin They were sub-cultured 1–2 times a week when they reached 80 % con-fluency using Trypsin/EDTA (0.05 %/0.02 %) for detachment [9, 12] The melanoma cell lines

Malme-3 M, MDAMB4Malme-35, M14, UACC62, SKMel28 and AMalme-375 originated from the NCI60 cell panel of the National Cancer Institute (NCI-DCTD repository) The melan-oma cell lines WM35, WM115, WM793, WM3734, WM266-4, WM1366, 1205 LU, and 451 LU were gener-ously provided by M Herlyn (Philadelphia, USA) SbCl2 and SKMel19 were provided by C Garbe (Tübingen, Germany) SKMEL30 was obtained from the DSMZ (Braunschweig, Germany) and SKMel147 was a kind gift

of M Soengas (Madrid, Spain) Melanocytes, primary fi-broblasts and keratinocytes were isolated from human foreskin as described previously [13–15] All of the cell lines used in our study were authenticated by sequence analysis of defined genes

siRNA mediated CK1 knockdown

2.5 × 105melanoma cells in 6well cavities were transfected with 50 pmol siRNA using RNAiMAX (Invitrogen, Darm-stadt, Germany) according to the manufacturers protocol The following siRNAs were used: siCSNK1A1 sense gaauuugcgauguacuuaa-dTdT, siCSNK1A1 antisense uuaa guacaucgcaaauuc-dTdG; siCSNK1D sense ugaucagucgca

ugauca-dTdT; siCSNK1E sense ccuccgaauucucaacaua-dTdT, siCSNK1E antisense uauguugagaauucggagg-dGdA;

siNONSIL sense acaacauucauauagcugccccc, siNONSIL

antisense gggggcagcuauaugaauguugu (all synthesized by

biomers.net, Ulm, Germany)

Overexpression of CK1α/ δ/ ε

Wild type CK1 isoform cDNA was amplified using the

Human Multiple Tissue cDNA (MTC) Panel II

(Clon-tech, Saint-Germain-en-Laye, France) and isoform

spe-cific primers CK1 cDNAs were cloned into the

inducible lentiviral vector PLVX-tight-PURO (Clontech)

by using In-fusion-HD Liquid Kits (Clontech) according

to the manufacturer’s protocol Sanger-sequencing was

performed for verification of the correct cloned cDNA

Lentiviral particles were produced in HEK293T cells

using the second-generation packing and envelope

plas-mids pCMVΔR8.2 and pMD2.G Cells were transduced

with lentiviruses as described previously [16] and

doxy-cycline inducible melanoma cells were generated

accord-ing to the manufacturer’s instructions (Tet-on Advanced

System, Clontech) For overexpression of CK1α the

pre-viously described adenovirus was used [9]

Inhibitor and doxycycline treatments

Small molecules were dissolved in DMSO and

treat-ments were carried out using the indicated

concentra-tions with vehicle controls The following substances

were used: Pyrvinium pamoate (Sigma, Taufkirchen,

Germany), IC261 (Sigma), D4476 (Sigma), PF670462

(Sigma) Doxycycline hyclate (Applichem, Darmstadt,

Germany) was dissolved in ddH2O and used at the

indi-cated concentrations

4-Methylumbelliferyl heptanoate (MUH) viability assay

For the analysis of proliferation and survival of

mel-anoma cells, 2.5x103 cells were seeded into 96-well

plates and cultured with the indicated inhibitors for

the indicated periods of time After washing of the

cells with PBS, 100 μg/ml 4-methylumbelliferyl

hep-tanoate (Sigma, Taufkirchen, Germany) in PBS were

added and incubated for 1 h at 37 °C Microplates

were measured in a fluorescence microplate reader

(Berthold, Bad Wildbad, Germany) with Ex355/Em460

nm in sixtuplicates Dose–response curves were

gen-erated using GraphPad Prism version 6 (GraphPad

Prism Software Inc.)

Cell cycle assay

2 x105melanoma cells per 6-well cavity were seeded and

either transfected using siRNA or treated with 4 μg/ ml

doxycycline to induce the overexpression of CK1δ and ε

or transduced with the adenovirus (CK1α

permeabilization and fixation of the cells in 70 %

ice-cold ethanol for at least 1 h Then they were

re-suspended in PBS with 100μg/ml RNAseA (Applichem, Darmstadt, Germany) and 50 μg/ml propidium iodide (Sigma, Taufkirchen, Germany) and stained for 30 min FACS analysis for the detection of the distribution of the cells in the each cell cycle phase was performed with a LSRII FACS (BD, Heidelberg, Germany) using the FACSDiva software

3D Melanoma spheroid culture

2.5 × 103SKMel19 cells were cultured on 1.5 % noble agar (Difco/BD, Heidelberg, Germany) coated 96well plates to form spheroids within 3 days For overexpression of CK1 isoforms either 2 μg/ml doxycycline were added on the second day or the medium was supplemented with the adenovirus After 3 days spheroids were embedded into

1 mg/ml collagen I (Corning/BD, Heidelberg, Germany) diluted in complete growth medium and cultured for four more days In case of treatment inhibitors were added to the medium Daily microphotographs were taken and the area of the spheroids was measured using ImageJ and nor-malized to the size at day 0 after collagen embedding for the evaluation of tumor cell invasion into the collagen matrix After 4 days spheroids were stained using 1 μM calcein-AM (Life technologies, Darmstadt, Germany) and

100 ng/ml propidium iodide (Sigma, Taufkirchen, Germany) for fluorescence live-dead staining of the mel-anoma cells Fluorescence was detected with an Axiovert fluorescence microscope (Zeiss, Jena, Germany) Mean fluorescence intensities of the red channel were used to determine relative cell death induction

Quantitative PCR

Total RNA was extracted from cells using the NucleoSpin RNA kit (Machery-Nagel, Dueren, Germany) Complemen-tary DNA was made out of 1 μg total RNA using Super-Script II reverse Transcriptase (Invitrogen, Darmstadt, Germany) according to the manufacturer’s protocol Quan-titative real-time PCR (qRT-PCR) was performed with the SYBR green mix LightCycler 480 (Roche, Mannheim Germany) The relative expression levels of CK1 isoforms were determined using the ΔΔCt-method method with ACTINB or 18S rRNA as reference genes The primer se-quences were as follows: CSNK1A1 forward 5’-aatgttaaag-cagaaagcagcac-3’ and reverse 5’-tcctcaattcatgcttagaaacc-3’ CSNK1D forward acaacgtcatggtgatggag-3’ and reverse 5’-gaatgtattcgatgcgactgat-3’ CSNK1E forward 5’-tgagtat-gaggctgcacagg-3’ and reverse 5’-tcaaatggcacacttgtctgt-3’ CSNK1G1 forward 5’-ctgtgaccgaacatttactttga-3’ and reverse 5’-tgcacgtattccattcgaga-3’ CSNK1G2 forward 5’-gacctt-cacgctcaagacg-3’ and reverse 5’-ccggtagattaggctcttggt-3’ CSNK1G3 forward 5’-tgcaacaatccaaaaaccagt-3’ and reverse 5’-ctgcaaggtgagctctcaaa-3’ ACTINB forward 5’-ttgttacag-gaagtcccttgcc-3’ and reverse 5’-atgctatcacctcccctgtgtg-3’

18S rRNA forward 5’-cggctaccacatccaaggaa-3’ and reverse

5’-gctggaattaccgcggct-3’

Western blot

Protein lysates (30μg) were subjected to SDS-PAGE and

semi-dry blotting onto PVDF membranes (Roche,

Mannheim, Germany) The antibodies used were as

fol-lows: anti-CK1α (Santa Cruz Biot., Heidelberg,

Germany), anti-CK1δ (Santa Cruz Biot.), anti-CK1ε

(Santa Cruz Biot), anti-p53 (Santa Cruz Biot), anti-p21

(Cell Signalling, Heidelberg, Germany), anti-β-catenin

(Cell Signalling), anti p-S45-β-catenin (Cell Signalling)

anti-β-actin (Cell Signalling) HRP conjugated secondary

antibodies were used (Cell Signalling and Santa Cruz)

and ECL substrates for chemoluminiscent detection

Densitometric semi-quantification was done by

normal-izing the band intensities of the target protein to the

sig-nal ofβ-actin with Scion Image

Luciferase reporter assay

2.5 × 105melanoma cells were seeded into 6well plates

and transfected with 2μg Super8xTOPFlash 16 h porst

seeding using ScreenFectA (Genaxxon, Ulm, Germany)

as recommended by the manufacturer Twenty-four

hours later cells were reseeded into 96 well cavities and

the expression of isoforms was induced by the addition

of doxycycline or of the adenovirus for 48 h Then cells

were lysed with 50 μl of passive lysis buffer (Promega,

Mannheim, Germany) and luciferase activity was

ana-lyzed using D-luciferin as a substrate (Sigma) in a

TriS-tar luminometer (Berthold, Bad Wildbad, Germany)

Immunofluorescence analysis of melanocytic biopsies

Nevi, primary and metastatic melanoma FFPE biopsies

were sectioned, heat induced epitope retrieval (HIER)

was performed using citrate buffer pH6 and the sections

were stained using 1:100 rabbit anti-CK1α (Abcam ab

136052), 1:1000 mouse anti-CK1δ (Abcam ab85320) and

1:100 goat anti-CK1ε (Santa Cruz sc-6471) As

second-ary antibodies donkey goat(Cy3), donkey

anti-mouse(Cy2) and donkey anti-rabbit(Cy5) were used (all

Germany) before staining the nuclei with 1μg/ml DAPI

(Sigma, Taufkirchen, Germany) Biopsies were

micro-scopically analyzed using a confocal microscope system

(Leica TCS SP2, Heidelberg, Germany) and the mean

fluorescence intensity of representative cells was

semi-quantification the mean fluorescent intensities of at least

30 cells per sample were background subtracted and

presented as relative fluorescence units

Kinase assay (K-LISA)

A 23mer peptide containing the exon 3 phosphorylation sites of β-catenin was synthesized as previously described [9] and the NH2 terminus was labeled with biotin Melanoma cells were lysed using passive lysis buffer (Promega, Mannheim, Germany), and 5μg of the protein lysates were incubated in kinase buffer (Cell Sig-nalling, Heidelberg, Germany) together with 10 μg of

streptavidin-coated 96well plates (Life technologies, Darmstadt, Germany) Plates were washed with PBS-T and anti–phospho-Ser45-β-catenin antibody (Cell Sig-naling) was added (1:500) HRP-conjugated secondary antibody (Cell Signalling) was used to detect the phos-phorylated substrate measuring TMB substrate (Cell Sig-nalling) at 450 nm in a microplate reader (Berthold, Bad Wildbad, Germany)

Migration and invasion assay Skin reconstructs

Organotypic skin reconstructs were prepared as de-scribed previously [13, 17, 18] SbCl2 melanoma cells were transfected with the indicated siRNAs 24 h before epidermal reconstruction Ten days after air-lifting the model reconstructs were fixed, paraffine embedded, sec-tioned, and H&E staining revealed the invasive capacity after knockdown of CK1α

Boyden chamber experiments

Invasion was assayed using invasion chambers coated with or without Matrigel basement membrane matrix (BD Biocoat Matrigel invasion chambers, BD Biosciences, Heidelberg, Germany) as described previously [9, 16] After incubation for 20 h at 37 °C the invaded cells were fixed and counted after cell staining with hematoxilin-eosin The assays were performed in tripli-cates, six fields were counted per transwell filter and the invasion index was calculated according to the manufacturerer’s protocol

Real-time migration assay

The kinetics of cell migration was assayed using the xCELLigence Real-Time Cell Analyzer (RTCA DP; Roche) CIM-plate 16 wells used and 10,000cells were plated in each well using serum-free DMEM The lower medium chamber contained DMEM with 10 % FCS Cells were allowed to settle for 30 min at room temperature before being placed in the RTCA DP in a humidified incubator at 37 °C with 5 % CO2 Data were recorded every 15 min for 24 h Plotted curves represent the averages from three independent measurements

Fig 1 (See legend on next page.)

Expression levels of the CK1- isoformsα, δ and ε are

downregulated in metastatic melanoma cells in vivo

We analyzed expression of the CK1- isoformsα, δ and ε

on RNA and protein level in normal human melanocytes

(NHM) and melanoma cell lines representing the

differ-ent progression stages in melanoma from radial growth

phase (RGP), vertical growth phase (VGP) and

meta-static melanoma (MM) (Fig 1a-c) We found a

consist-ent downregulation of CK1α expression on RNA and

protein level in RGP, VGP and metastatic melanoma cell

lines compared to NHMs NHMs expressed significantly

more CK1δ RNA compared to the melanoma cell lines

However, CK1δ protein expression was variable without

significant differences in the analyzed melanoma cell

lines CK1ε expression was low in all cell lines analyzed

and could not be detected in NHMs on protein level

(Fig 1a-c) CK1 γ1, γ2 and γ3 RNA expression was

al-most not detectable in the cell lines analyzed (Additional

file 1: Figure S1A) Therefore, we focused in the

follow-ing experiments on the CK1 isoformsα, δ and ε

Next, we analyzed RNA and protein expression of the

CK1 isoformsα, δ and ε in vivo in tissue samples of

be-nign nevi, primary melanomas and metastatic

melano-mas using real-time PCR and immunofluorescence

analyses, respectively RNA expression of all three CK1

isoforms did not differ significantly in the different tissue

types (Fig 1c) By trend, CK1α RNA levels were reduced

in preparations of metastatic melanoma In contrast, on

protein level we found a significant downregulation of

all three CK1- isoforms in metastatic melanomas

com-pared to primary melanoma cells (Fig 1d) In summary,

we found in melanoma cell lines in vitro and in

melan-oma cells in vivo a consistent downregulation of CK1α

RNA and protein expression in metastatic melanoma

cells Furthermore, we detected a downregulation of

CK1δ and ε protein expression in metastatic melanoma

cells in vivo compared to primary melanoma cells This

did not correlate with RNA expression and with the

ex-pression levels of melanoma cells in vitro

CK1δ and ε expression is partially reciprocally regulated

by a posttranscriptional mechanism in melanoma cells

So far it remains unknown whether the individual CK1 isoforms can regulate expression of the other isoforms

in melanoma cells Therefore, we downregulated expres-sion of the CK1 isoforms α, δ or ε in the two human melanoma cell lines SbCl2 and SKMEL19 using isoform-specific siRNAs and analyzed RNA and protein expres-sion of all three CK1 isoforms As shown in Fig 2a, downregulation of CK1α or CK1δ did not affect protein expression of the other isoforms in both cell lines How-ever, downregulation of CK1ε expression induced CK1δ expression most strongly in SKMEL19 cells (Fig 2a)

slightly affect CK1ε protein expression in SKMEL19 cells However, downregulation of CK1α and CK1ε in-creased CK1δ protein expression, again most strongly in SKMEL19 cells Downregulation of CK1δ and CK1ε had

no effect on CK1α expression These data suggest that CK1δ and ε regulate each other in a compensatory way and the expression is not or only mildly influenced by CK1α, whereas CK1α expression is independently regu-lated from CK1δ and ε

To analyze whether overexpression of the specific iso-forms resulted in similar effects we upregulated specifically CK1α expression by adenoviral gene transfer as previously reported [9] and CK1δ and CK1ε by a doxycycline-inducible lentiviral system in the two human melanoma cell lines SbCl2 and SKMEL19 (Fig 2b) Overexpression of CK1α diminished only expression levels of CK1ε in SbCl2 and only at the highest induced expression level of CK1α Induction of CK1δ reduced CK1ε protein levels in SKMel19 cells whereas elevated CK1ε levels were associ-ated with lower CK1δ protein expression in SbCl2 cells (Fig 2b) CK1α expression was not significantly affected by upregulation of the other CK1- isoforms These data indi-cate that theδ and ε isoforms negatively regulate expression

of each other Analysis of RNA expression of the individual CK1 isoforms after induction of gene expression using real-time PCR indicated that overexpression of CK1α, CK1δ or

(See figure on previous page.)

Fig 1 Expression of CK1 - isoforms during melanoma progression a Relative mRNA expression (SYBR green real-time PCR) of three CK1 isoforms

in melanocytic cells, namely normal human melanocytes (NHM), cell lines derived from primary radial growth phase (RGP) plus vertical growth phase melanoma (VGP) and cell lines from metastatic melanoma (MM) Normalized data (to ACTINB) are presented as scatter plot (mean with SEM) Kuskal-Wallis statistics with Dunn ’s multiple comparison was used to test for significant differences (* p < 0.05; ** p < 0.01) b CK1α, δ and ε protein expression was determined by western blot analyses Semi-quantification (ratios CK1/ β-actin) are shown as scatter plots Kuskal-Wallis statistics with Dunn ’s multiple comparison was used to test for significant differences (* p < 0.05; ** p < 0.01) c Relative mRNA expression of three CK1- isoforms of patient-derived tissue samples The analysis of CK-1 isoform expression was performed using benign melanocytic nevi (n = 4), primary malignant melanomas (n = 9), and metastatic melanoma (n = 13) by quantitative real-time PCR Normalized data are presented as scatter plot (mean with SEM) and Kuskal-Wallis statistics with Dunn ’s multiple comparison was used to test for significant differences (* p < 0.05; ** p < 0.01).

d CK1 α (blue), δ (green) and ε (red) expression in tissue sections of benign nevi (n = 11), primary melanomas (n = 11) or melanoma metastases (n = 16) was determined by immunofluorescence staining followed by confocal analysis Kuskal-Wallis statistics with Dunn ’s multiple comparison was used to test for significant differences (* p < 0.05; ** p < 0.01)

CK1ε did not significantly influence RNA expression of the

other CK1- isoforms (Fig 2c) In summary, our data show

that CK1δ and CK1ε negatively regulate expression of the

respective other CK1 isoforms on a post-transcriptional

level, whereas CK1α expression is not significantly affected

by the other CK1- isoforms in melanoma cells

Modulation of CK1δ and CK1ε expression does not significantly influence melanoma cell viability and proliferation

Next, we looked for the functional effects of modulation

of CK1- isoform specific gene expression on survival and proliferation of melanoma cells First, we knocked

Fig 2 CK1 δ and ε reciprocally regulate their expression by a post-transcriptional mechanism a Specific siRNA mediated knockdown of CK1- iso-forms in SbCl2 (left panel) and SKMEL19 (right panel) melanoma cells The influence of the corresponding isoiso-forms on the other two isoiso-forms was evaluated by western blotting 48 h post siRNA transfection Beta-actin detection served as a loading control b Overexpression of CK1 α, δ and ε in SbCl2 and SKMEL19 melanoma cells by viral transduction Lysates were prepared 48 h after overexpression and western blots were probed with isoform specific antibodies and β-actin as a loading control c Relative mRNA expression analysis of the three CK1 isoforms α, δ and

ε after overexpression of the respective isoforms 48 h post induction/ transduction 18S rRNA was used as reference gene Ad5-LacZ transduced cells served as control for CK1 α overexpression Non-induced (Dox -) cells were used as control for overexpression of CK1δ and ε All values were referenced to untreated SbCL2 and SKMEL19 control cells Mutliple t-test was used to calculate statistically significant (* p < 0.05) expression differences after overexpression

Fig 3 Modulation of CK1 δ and CK1ε expression does not significantly influence melanoma cell viability and proliferation a Inhibition of isoform specific CK1- activity via siRNA mediated knockdown of CK1 α, CK1δ and CK1ε SbCl2 (left diagram) and SKMEL19 (right diagram) cells were used and cell growth was monitored for 4 days using the MUH viability assay Shown is the mean with SD of hexatuplicates b Inhibition of CK1-activity via different small molecules (upper left and right plus lower left diagram) with predominant efficacy for CK1 δ and CK1ε Dose response curves using viability measurements (MUH assay) 72 h after treatment with the inhibitors are shown Mean values with SD values of

hexatuplicates are shown The fourth diagram (lower right) shows dose response curves of melanoma cell lines treated with the allosteric CK1 α activator pyrvinium at 72 h post start of treatment c Effects of CK1 specific small molecules on 3D spheroid SKMel19 cultures Spheroids were treated with the indicated concentrations of small molecules for CK1- inhibition or CK1 α activation for 4 days Live-dead staining with calcein-AM (1 μM) and propidium iodide (100 ng/ml) and size measurements are shown Mean with SEM values of five spheroids are used Multiple t-tests against vehicle controls were used for statistical analysis (* p < 0.05) d Effect of overexpression of the isoforms CK1 α, CK1δ and CK1ε in SbCL2 and SKMEL19 melanoma cells Isoforms were overexpressed as previously (Fig 2b, c) and viability was assessed 72 h after overexpression of the respective CK1- isoforms by MUH assays Shown are changes in viability after overexpression as mean values with SD of hexatuplicates are shown (*** p < 0.001)

down CK1α, CK1δ or CK1ε expression in SbCl2 and

(Fig 2a) Ninety-six hours after transfection we analyzed

survival and proliferation of the cells (Fig 3a, Additional

file 2: Figure S2A) In both cell lines the downregulation

of CK1δ or CK1ε expression alone had no significant

ef-fect on cell growth or cell cycle However,

downregula-tion of CK1α expression retarded cell growth and

increased the number of cell in the G1 phase of the cell

cycle in SbCl2 melanoma cells, but not in SKMEL19

cells (Fig 3a, Additional file 2: Figure S2A, B)

confirm-ing our previous study [9] To further ascertain the effect

of reduced CK1 activity on melanoma cell survival and

proliferation we treated five different human melanoma

cell lines with increasing doses of the CK1δ/CK1ε

dom-inant inhibitors D4476 [19], PF670462 [20] or IC261

[21] and measured cell viability 72 h after treatment As

shown in Fig 3b all three inhibitors did not significantly

reduce melanoma cell viability In a 3D spheroid culture

model using collagen-embedded SKMEL19 spheroids

similar results were obtained (Fig 3c) At the highest

concentration of IC261 a reduction in the size of the

spheroids was observed which, however, was not

accom-panied with cell death induction (Fig 3c) Only

treat-ment of the cells with the CK1α activator pyrvinium

resulted in propidium iodide positive dead cells (Fig 3c)

Also, overexpression of CK1δ or CK1ε in SbCl2 or

SKMEL19 melanoma cells did not change melanoma cell

viability and cell cycle (Fig 3d, Additional file 2: Figure

S2C) In contrast, activation of CK1α by pyrvinium [22]

(Fig 3b, c) or overexpression of CK1α in SbCl2 or

SKMel19 melanoma cells (Fig 3d) significantly reduced

melanoma cell viability and induced apoptosis (Figs

3b-d, Additional file 2: Figure S2C) These data indicate that

CK1δ and CK1ε are not essential for melanoma cell

sur-vival and proliferation, whereas overexpression of CK1α

reduces viability of melanoma cells This suggests that

CK1α is the most important CK1 isoform in melanoma

cells with a non-redundant function in tumorigenesis

CK1α but not CK1δ and ε functionally affects melanoma

cell migration and invasion

In order to evaluate a further putative function of the

CK1 isoforms in tumorigenesis - an increase in the

migratory behavior of the tumor cells - we induced

the expression of CK1α, δ and ε isoforms in

SKMEL19 melanoma cells by doxycycline treatment

and measured the migratory potential of the cells

over time using the XCelligence system

Overexpres-sion of CK1δ or ε in the melanoma cells led to no

difference in the migratory behavior compared to the

non-induced cells (Fig 4a) However, overexpression

of CK1α significantly decreased migration of the

mel-anoma cells 3D spheroid assays confirmed the results

revealing no influence of the CK1- isoforms δ and ε

on melanoma cell invasion of SKMEL19 cells into a collagen I matrix (Fig 4b) CK1α overexpression sig-nificantly reduced the invasive growth within the monitored 4 days and again induced cell death To further evaluate the effect of the CK1- isoforms on the invasive potential of melanoma cells we used an organotypic skin reconstruct using SbCL2 cells with siRNA mediated knockdown of the three CK1- iso-forms which were seeded together with primary hu-man keratinocytes as an epidermal layer Since SbCL2 cells originate from an RGP melanoma they do not have the capacity to invade deep into the dermal part

by breaking through the basal membrane which sepa-rates epidermal from dermal parts Knockdown of CK1α resulted in a pro-invasive phenotype indicated

by dermally invading melanoma cell nests as we showed before [9] Knockdown of the other two CK1-isoforms δ or ε had no detectable effects on the growth characteristics in the skin reconstruct model (Fig 4c) Our data indicate that CK1δ and ε do not affect survival and migration/invasion of melanoma cells in contrast to CK1α which seems to be the dominant active CK1- isoform in melanoma cells

CK1α, δ and ε differentially influence beta-catenin and p53/p21 signaling in melanoma cells

It is known thatβ-catenin is a substrate of CK1α, δ and

ε [3] Whereas phosphorylation of β-catenin at Ser45 by CK1α results in degradation of β-catenin, CK1 δ/ε are involved in the activation of the Wnt/β-catenin pathway

by the phosphorylation of dishevelled (Dvl) We ana-lyzed whether overexpression of the individual CK1- iso-forms as described above affects expression and activity

ofβ-catenin signaling Interestingly, β-catenin total pro-tein levels did not change 1–2 days after CK1- isoform specific overexpression (Fig 5a) However, as expected phosphorylation of Ser45 of β-catenin was increased after overexpression of CK1α (Additional file 3: Figure S3A) and this directly correlated with the influence of CK1α levels on the capacity to phosphorylate Ser45 in melanoma cells in a kinase assay (Fig 5b) Overexpres-sion of CK1α in SKMEL19 enhanced the kinase activity causing Ser45 phosphorylation, whereas the respective knockdown in SbCl2 decreased this activity The other CK1- isoforms δ and ε did not show significant impact

on the phosphorylation of Ser45 ofβ-catenin (Fig 5b)

In order to measure the general effect of CK1- iso-forms on the canonical Wnt-signaling pathway we used

a firefly reporter system (Super8xTOPFlash) and tested the luciferase activity in lysates of SKMEL19 cells after induction of CK1- isoform specific overexpression As expected, CK1α overexpression decreased the endogen-ous signaling activity, whereas CK1δ and ε enhanced the

Fig 4 (See legend on next page.)