HA NOI NATIONAL UNIVERSITY VU THI BICH HUYEN A STUDY ON CREATING OF ATTENUATED MUTANT Vibrio parahaemolyticus STRAINS TO DEVELOP LIVE ATTENUATED VACCINE AGAINST HEPATIC AND KIDNEY NEC
Trang 1HA NOI NATIONAL UNIVERSITY
VU THI BICH HUYEN
A STUDY ON CREATING OF ATTENUATED MUTANT Vibrio parahaemolyticus
STRAINS TO DEVELOP LIVE ATTENUATED VACCINE AGAINST HEPATIC
AND KIDNEY NECROSIS DISEASE IN SOME MARINE FISH
Specialized: GENETICS Code: 9.42.01.21
SUMMARY OF BIOLOGICAL THESIS
HANOI - 2020
Trang 2The project was completed at: Department of Genetics – Biochemistry, Faculty of Biology,
Ha Noi National University of Education and Biotechnology Laboratory, Faculty of
Biotechnology, Ha Noi Open University
Science instructor: Assoc Prof Dr Nguyen Xuan Viet
Assoc Prof Dr Pham Thi Tam
Critical Reviewer 1: Assoc Prof Dr Khuat Huu Thanh
Hanoi University of Science and Technology
Critical Reviewer 2: Assoc Prof Dr Nguyen Thi Hong Van
VNU University of Science - Vietnam National University, Hanoi
Critical Reviewer 3: Assoc Prof Dr Duong Minh Lam
Hanoi National University of Education
The thesis will be presented before Assessment Council in Hanoi National University
of Education at ………
The thesis can be found at the National Library, Hanoi or Library of Hanoi National
University of Education
Trang 3PUBLISHED BY AUTHOR The articles were published
1 Cao Thi Thanh Huong, Pham Thi Tam, Nguyen Manh Hung, Nguyen Xuan Viet,
Vu Thi Bich Huyen (2015) The characteristics of Vibrio parahaemolyticus isolated from
fish have hepatic and kidney necrosis Science and Technology Journal of Agriculture &
Rural Development 8/2015: 72-78, in Vietnamese
2 Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thị Tam, Man Hong Phuoc,
Nguyen Dang Quang, Do Thanh Van, Dang Thi Hong Tham (2018) A study on creating an
attenuated Vibrio parahaemolyticus mutant strain by treatment with rifampicin The 3nd
National Scientific Conference on Biological Research and Teaching in Vietnam at Quy Nhon, Viet Nam 20th May: 1156 -1163, in Vietnamese
3 Vu Thi Bich Huyen, Nguyen Xuan Viet, Dang Thi Hong Tham, Man Hong Phuoc,
Pham Thi Tam (2018) Assessment of stability and immunization response of Vibrio parahaemolyticus L4650 attenuated strain to support vaccine production against hepatic and
kidney necrosis disease for marine fish, Science and Technology Journal of Agriculture &
Rural Development 21/2018: 79-85, in Vietnamese
4 Vu Thi Bich Huyen, Nguyen Xuan Viet, Huynh Viet Tung, Pham Thi Tam, man
Hong Phuoc (2019) Biochemical characteristics and genetics of Vibrio parahaemolyticus strains caused hepatic necrosis disease for groupers in Cat Ba, Hai Phong Veterinary
Science and Techniques Journal Vol 26 No.7/2019: 62-73, in Vietnamese
5 Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thi Tam, Man Hong Phuoc,
Huynh Viet Tung, Nguyen Dang Quang, Do Thanh Van (2020) Development of attenuated
Vibrio parahaemolyticus mutant strains as potential live vaccines Asia Pacific Journal of Molecular Biology and Biotechnology 28(1): 52-67
Sequences were published in NCBI:
- Gen toxR of A3.3 strain with accession number MH047286
- Gen tlh of A3.3 strain with accession number MH047289
International Conference
Vu Thi Bich Huyen, Chu Dinh Toi, Nguyen Xuan Viet, Man Hong Phuoc, Pham Thi Tam (2019) Isolation and evaluation the potential as live attenuated vaccine candidate of rifampicin-resistant Vibrio parahaemolyticus strains 2019 International Academic Conference for Graduate Student of Nanjing Agricultural University in October 2019, Nanjing, China
Trang 4INTRODUCTION
1 Reason to choose the topic
With the advantage of a long coastline (3,260 km) stretching from North to South, the potential for aquaculture development of our country is huge According to the General Statistics Office, in 2018 the GDP of the whole fishery reached 190.123 billion VND, accounted for 3.43% of the whole economy and 23.57% of the whole agriculture sector, increased 6.46% compared to 2017, reached the highest growth rate in agriculture, contributed 0.22 percentage points to the overall growth of the country's agricultural sector [187] However, the aquaculture industry in Vietnam as well as in the world always faces difficulties and challenges, especially the losses caused by diseases According to the Food and Agriculture Organization of the United Nations (FAO), diseases that cause global aquaculture losses more than USD 6 billion each year, occur in most developing countries
In Vietnam, it is estimated that each year the aquaculture industry has lost nearly USD 1 billion due to the disease [22]
Hepatic and kidney necrosis disease in fish was detected in 14 countries, in 48 species
of fish, is known to be caused by the bacterium Vibrio parahaemolyticus [112] Diseased
fish have symptoms such as red spots, skin sores, flakes, truncated fins, hemorrhagic organs, especially in liver and kidney, diseased fishes can die in mass, with up to 90% mortality
[112, 138] V parahaemolyticus caused hepatic and kidney necrosis disease and made high
percentage mortality in fish annually reported in Quang Ninh, Hai Phong, Quang Ngai, Phu Yen, Khanh Hoa, Ba Ria-Vung Tau provinces [184, 185, 186]
Until now, to control and to treat hepatic and kidney necrosis disease for fish, farmers
has mainly used antibiotics to kill V parahaemolyticus [34, 61] However, that using
regularly and lack strict control of antibiotics led to the antibiotic resistance in many bacterial strains [26] and accumulation of residual antibiotics in fish tissue, which is food for human [107] Therefore, vaccination for aquatic animals is an effective method to control disease and reduce using antibiotics in aquaculture
Bacterial vaccines for fish include inactivated vaccines, live attenuated vaccines, recombinant vaccines, sub-unit vaccines, DNA vaccines [125] Most of the commercially bacterial vaccines for fish in the world are inactivated vaccine because of their high safety However, the inactivated vaccines usually have a short protection period [152] Although there have been a few studies on making inactivated, recombinant or DNA vaccines to
prevent the disease caused by V parahaemolyticus in fish has been published So far, no commercially licensed vaccines against bacterium V parahaemolyticus have been used in
fish A live attenuated vaccines using a attenuated bacteria are a promising research path for commercial vaccine production for fish with high relative survival percent (RPS) and long
Trang 5protection periods
Creating a strain of V parahaemolyticus that has the ability to cause an immune
response for fish is important and decisive for the success or failure of developing a live attenuated vaccine Therefore, the study of creating a attenuated strain for the development
of live attenuated vaccine to prevent necrosis of the liver and kidney in fish is very necessary and consistent with the trend and offers a high potential for prevention hepatic and kidney necrosis disease
Based on the theoretical and practical basis, the project: “A study on creating of
attenuated mutant Vibrio parahaemolyticus strains to develop live atttenuated vaccine
against hepatic and kidney necrosis disease in some marine fish” has been carried out
2 Objectives
2.1 General objectives
Create attenuated mutant Vibrio parahaemolyticus strains causing immune response
for fish to use as candidate of live atttenuated vaccines to prevent hepatic and kidney necrosis disease for some cultured marine fish in cage farms
2.2 Specific objectives
- Create attenuated strains of V parahaemolyticus from the virulent wild-type strains
causing hepatic and kindey necrosis disease by treating with rifampicin
- Determine nucleotide sequence changes in genes that encode virulence proteins (tdh,
trh, tlh, toxR) and rpoB genes in Vibrio attenuated strains
- Determine the protection ability for fish of the attenuated bacteria strain
3 Research content
- Isolation and identification of V parahaemolyticus strains causing hepatic and
kidney necrosis disease for some cultured fish (grouper, snapper, cobia) in sea areas the Northern Viet Nam
- Creating attenuated strains of V parahaemolyticus from virulent wild-type strains by treatment rifampicin and analyzing nucleotide sequence changes in genes (toxR, tdh, trh, tlh
và rpoB) of attenuated strains compare to wild-type strains
- Evaluation of the ability to create an immune response of the potential attenuated
mutant strain in orange-spotted grouper (Epinephelus coioides) and selection V
parahaemolyticus attenuated strains to be vaccine candidate to prevent hepatic and kidney
necrosis disease for some cultured marine fish
4 Objects
Strains of V parahaemolyticus cause hepatic and kidney necrosis disease for marine fish
5 The research scopes
Strains of V parahaemolyticus bacteria isolated from marine fish farmed around Cat
Ba island, Lan Ha bay, Cat Hai (Hai Phong); Dong Chau sea areas (Thai Binh); Hai Thinh
Trang 6sea (Nam Dinh) and the attenuated strains were selected
6 The scientific and practical significance of the topic
6 1 Scientific significance
Thesis provide a database of pathogenic V.parahaemotycus causing hepatic and kidney
necrosis disease for cultured marine fish in some sea areas in the Northern Viet nam for morphological, biochemical and antibiotic resistance characteristics
Detecting mutations in the virulence gene and ropB gene of rifampicn-resistant attenuated V parahaemolyticus strains was of scientific significance for the direction of
further studies to develop live attenuated vaccines to prevente diseases for cultured marine fish
The results of evaluating the protection ability of attenuated V parahaemolyticus
strain in orange-spotted grouper is the scientific basis for immunological research for marine fish
6.2 Practical significance
The mutant attenuated V parahaemolyticus strain causing a protective immune
response will a potential candidate for vaccine development against hepatic and kidney
necrosis disease for orange-spotted grouper as well as some other marine fish
7 New contributions of the thesis
The thesis is one of the first studies on creating attenuated V parahaemolyticus strains
by treatment with rifampicin as potential vaccine candidate against hepatic and kidney necrosis disease in marine fish
The full-length tlh gene was amplified in the first time by PCR Detecting differences
in nucleotide sequences in virulence tlh genes and rpoB genes of attenuated strains
compared to wild-type strains provided the genetic basis for the relationship between
mutation changes in these genes and attenuation of strains V parahaemolyticus
Selecting V paraheamolitycus L4650 strain being potential vaccine candidate for
development live attenuated vaccine for hepatic and kidney necrosis disease in marine fish The L4650 strain was stable virulence level, the survival rate of orange-spotted
grouper (Epinephelus coioides) injected with a dose of 100 µl/fish, 105 CFU/ml reached 100% The relative percent survival (RPS) of L4650 vaccinated groupers reached 96.91
- 100% after 15 days post-vaccination; 93.33 - 100% after 6 months post-vaccination
8 Location and study time
Location: The project was completed at: Department of Genetics - Biochemistry, Faculty of Biology, Ha Noi National University of Education and Biotechnology Laboratory, Faculty Biotechnology, Ha Noi Open University
Study time: from 11/2014 to 4/2019
Trang 7CHAPTER I OVERVIEW OF RESEARCH
1.1 Overview of Vibrio parahaemolyticus cause hepatic and kidney necrosis disease in
marine fish
1.1.1 Morphological, biochemical and growth characteristics of Vibrio
1.1.2 Genome of V parahaemolyticus
1.1.3 Virulence and haemolysin virulence genes
There are three haemolysin protein: TDH (thermostable direct haemolysin), TRH
(TDH-related haemolysin) and TLH (thermolabile haemolysin) are encoded by tdh, trh
and tlh genes, respectively The toxR gene is in the toxRS operon (Vp-toxRS), encodes
for regulatory proteins that play an essential role in regulating the survival and
virulence of bacteria
1.1.4 The rpoB gene and resistance to rifampicin
The rpoB gene coding for b-subunit of RNA polymerase that related to Rifampicin
resistance Rifampicin is a broad-spectrum antibiotic that can hinder DNA-directed RNA
polymerase, and thereby, block the initiation of transcription and kill bacterium
1.1.5 Antigen of V parahaemolyticus
1.2 Hepatic and kidney necrosis disease in marine fish
1.2.1 Symptom
1.2.2 Diagnosis and treatment
1.3 Vaccines and active immune mechanism
1.3.1 Vaccines and vaccine types for fish
1.3.2 Specific immunity in bone fish
1.3.3 Fish vaccine delivery
1.4 Study on creating attenuated strains for development of attenuated vaccines
against hepatic and kidney necrosis disease
1.4.1 Creating attenuated strains with physical agents
1.4.2 Creating attenuated strains with chemical agents
1.4.3 Creating attenuated strains by genetic engineering
1.5 Research situation on vaccine production to prevent hepatic and kidney necrosis
disease in fish
1.5.1 Research situation in the world
1.5.2 Research situation in Vietnam
Currently, studies on creating vaccines against V parahaemolyticus are focusing on
inactivated and recombinant vaccines with the outer membrane proteins and DNA vaccines
However, commercially licensed vaccines against V parahaemolyticus are not available for
fish, including the attenuated vaccines for hepatic and kidney necrosis disease in fish In this
study, we created attenuated strains and assessed the their potential to select some strains to
use as a candidate for the development of attenuated vaccines against V parahaemolyticus
Trang 8CHAPTER II MATERIALS AND RESEARCH METHODS 2.1 Materials
2.1.1 Diseased fish
Marine fish (grouper, snapper, seabass, cobia ) had symptoms of hepatic and kidney necrosis disease were collected in aquaculture areas in Cat Ba Island, Lan Ha Bay, Cat Hai (Hai Phong); Đồng Chau (Thai Binh); Hai Thinh (Nam Dinh) Samples were used to isolate bacteria for 24 hours from the time of sample collection
2.1.2 Experimental fish
Zebrafishes (Danio rerio) having length 3 - 3,5 cm and tilapiaes (Oreochromis
niloticus) having length 6 - 6,5 cm were purchased from Research Institute for Aquaculture
No1 (Tu Son, Bac Ninh) Orange spotted grouper (Epinephelus coioides) having length 5,5 -
6 cm were purchased from Aquatic Breeding Center in Hai Phong
2.1.3 Bacteria: The V parahaemolyticus VTCC 12233 strain was purchased from the
Institute of Microbiology and Biotechnology, Vietnam National University, Hanoi, Vietnam
to be used as a control
2.1.4 Chemicals
2.1.5 Equipment
2.2 Research methods
2.2.1 Diagram of the main steps
Figure 2.1 Diagram of the main steps
2.2.2 Method of isolating Vibrio strain from suspected infected fish
Isolation
Treatment of rifampicin from 10 to 250 μg/ml
Assessment, selection
Disease marine fishes
V parahaemolyticus strains isolated
Rifampicin-resistant V parahaemolyticus strains
Attenuated strains of V parahaemolyticus
Evaluation of stability, ability to create immune response of
potential attenuated strains
Inject into orange-spotted grouper
Selecte potential attenuated strain
Trang 9The liver, kidneys, skin, fins of suspected disease fish are crushed in 1.5% saline solution, dilute this solution, and spread evenly over the surface of the TCBS medium Select colonies with morphology: round, glossy, convex, dark green on TCBS medium
2.2.3 The method to hold bacterial strains
2.2.4 Gram stain method
2.2.5 Method for determining the growth of bacteria
2.2.6 Methods of assessing biochemical characteristics and antibiotic resistance characteristics of strains
(a) Assessing biochemical characteristics: fermentation, indole production, catalase
generation, mobility, gas production and H2S generation and haematopoietic capacity
(b) Antibiotic resistance characteristics: with ampicillin (25 µg), gentamycin (30 µg),
norfloxacin (10 µg), enrofloxacin (5 µg) và erythromycin (15 µg)
2.2.7 Methods of assessing virulence of isolated strains
Groupers were injected with the V parahaemolyticus isolates Determine survival
rates of injected fish
2.2.8 Method of treating bacteria with rifampicin
Bacterial culture on rifampicin-containing media with increasing rifampicin concentration from 10 to 250 µg/ml Selection rifampicin-resistant strains
2.2.9 Methods of assessing virulence of rifampicin-resistant strains
(a) Survival rate of fish after infection: Rifampicin-resistant bacteria strains were
evaluated for virulence by bacterial infection on zebrafish and tilapia Determine survival rate of fish after infection
(b) LD50 value
2.2.10 Molecular biology methods
2.2.10.1 Primer design method
Using CLC Genomics Workbench 8.5 (QIAGEN Bioinformatics) to design primar for
toxR, tdh, trh, tlh genes of V parahaemolyticus
2.2.10.2 Methods of total DNA extraction: Total DNA was extracted by i-genomic BYF
DNA Extraction Mini kit (iNtRON, Korea)
2.2.10.3 PCR, sequencing and analyzing sequences of virulence and rpoB genes
(a) PCR to amplify virulence genes and rpoB gene
Trang 10Bảng 2.1: Sequence and characteristics of primers used in PCR Genes
target Primer Primer sequence (5’ – 3’) Tm (℃)
Size of products (bp) Source
toxR toxR-4 GTCTTCTGACGCAATCGTTG 54,1 368 Kim Y.B et al (1999)
tlh tlh1 TGTCGTGGCCATTTTGCTT tlh3 CCGTGATGCCAAAATCAAAA 55,7 52,0 1484 In this study
tdh tdhF GTAAAGGTCTCTGACTTTTGGAC 53,3 269 Bej A.K et al
(1999)
tdhR TGGAATAGAACCTTCATCTTCACC 54,5
tdh tdh1 ACTGGACTGTGGTTGGT 56,7 865 In this study
tdh2 CCTCGAATTACGCAACAA 50,3
trh trhF TTGGCTTCGATATTTTCAGTATCT trhR TTGGCTTCGATATTTTCAGTATCT 52,2 52,8 500 Bej A.K et al (1999)
trh trh1 TCGCATTTTTTCACCATTCCC 54,2 772 In this study
2.2.11 Bioinformatics method: Results of gene sequencing were analyzed with software
BLAST (https://blast.ncbi.nlm.nih.gov/Blast)
CLC Genomics Workbench 8.5
Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index)
Swiss model (https://swissmodel.expasy.org/interactive)
2.2.12 Methods for evaluating virulence stability and the safety of attenuated strain in orange-spotted grouper
(a) Evaluating virulence stability of attenuated strains
(b) Evaluating the safety of attenuated strains
2.2.13 Method of evaluating the immune response of the attenuated strain on groupers
(a) Assessing the immune response to fish
Relative survival percent (RPS) is calculated by the formula of Amend (1981)
RPS (%) = [1-(% dead vaccinated fish /% dead control fish)] x 100
(b) Evaluate immune time: assess relative survival percent of vaccinated fish after 1, 2,
4, and 6 months
2.2.14 Data processing methods
Data were processed statistically in Excel and Stata 2.0 software
Trang 11CHAPTER III RESULTS AND DISCUSSION 3.1 Isolation of bacteria from marine fish samples suspected to have hepatic and kidney necrosis disease
3.1.1 Isolation of Vibrio bacteria
Isolating 26 bacterial isolates of the Vibrio ssp from fishes suspected to have hepatic
and kidney necrosis disease After that, 11 bacteria isolates were selected: B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3; HH3-34; LBT6 which have the
characteristic of V parahaemolyticus colonies
3.1.2 Biochemical analysis of bacterial isolates
All 11 bacterial isolates had biochemical characteristics similar to the positive control
strains VTCC 12233 and suitable for V parahaemolyticus: the ability to ferment glucose,
not ferment lactose, not produce H2S, not produce gas, to produce indole, to be able to move, to produce catalase, hemolytic type β Antibiotics resistance of isolates was shown in Table 3.3
The antibiotic resistance of V parahaemolyticus strain has also been reported by many
authors [167, 182] It can be noticed that using antibiotics lack of control in the treatment of aquatic diseases was a huge concern for the aquaculture industry Vaccines for aquatic animals is a sustainable solution and is essential to minimize antibiotic resistance in pathogenic bacteria in aquaculture
Table 3.3 Antimicrobial properties with 05 antibiotics of 11 isolates
No
Isolates
Antibiotic resistance
Erythromycin (15 µg)
Gentamycin (30 µg)
Norfloxacin (10 µg)
Ampicillin (25 µg)
Enrofloxacin (5 µg)
Note:S - sensitivity; I - moderate sensitivity; R - resistance
3.1.3 Amplifying and sequencing some virulence genes and rpoB gene bacterial isolates
The bacterial isolates (11 isolates) and control V parahaemolyticus VTCC 12233
strain were extracted total DNA and checked quality on agarose electrophoresis gel Results showed that a total DNA band on the agarose gel was compact and sharp (Figure 3.6) The
OD260/OD280 ratios of 12 total DNA samples were in the range of 1.8 to 2.0 Thus, these total DNA samples were purified, qualified for use in PCR
Trang 12Figure 3.6 Total DNA of bacterial isolates of electrophoresis on agarose gel 1%
Line 1-12: VTCC 12233; B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3;
HH3-34; LBT6; M: Marker 1kb
The toxR and tlh genes were amplified from the total DNA of the 11 bacterial isolates (Figure 3.7; 3.8) However, PCR products of tdh and trh genes were not observed on gel electrophoresis Probably, genomes of 11 isolates did not carry 02 tdh and trh virulence genes The absence of the tdh and trh genes in the V parahaemolyticus genomes has also
The total DNA of the 11 bacterial isolates and the VTCC 12233 control strain had both
DNA bands (~368 bp and ~450 bp) of toxR and tlh genes amplified with two primer pairs
Trang 13(toxR-4, toxR-7 [69] and tlhF-tlhR [29]) Therefore, it can be confirmed precisely that 11
bacterial isolates were V parahaemolyticus From here, the bacterial isolates were called V
parahaemolyticus strains
3.1.4 Evaluation of pathogenicity of V parahaemolyticus strains to groupers
Observing the symptoms of infected fish and recording the survival rate of the
groupers after 14 injection days with V parahaemolyticus strains isolated showed that:
100% of the infected fish manifested hemorrhagic symptoms, hemorrhagic fin, flake of fish scales, skin ulcer, the muscular area around the injection site and skin are darker, severe necrosis of the liver and kidney
The survival rate of grouper after 14 infection days (Table 3.5) ranged from 2.22% to 22.22%, of which, fish injected with B5M3 and N9.2 strains had the lowest survival rate (2.22%) The highest survival rate recorded in fish infected with the B13M1 strain (22.22%) These rates in fishes infected with LBT6, B3.13, A3.3, B5M2, B5M4 strains were 13.33%; 6.67%; 10%; 18.9%; 18.9%, respectively The survival rate 16.67% was observed in fish infected with one of three strains of bacteria B20M2, N13.1.1, HH3-34 High mortality rates was in the first week, especially on day 1 to day 3 after infection In the following week, the mortality rate was lower and the change range of this rate was less among days
Table 3.5 Survival rate (%) of groupers infected with 11 strains
Day 1 Day 3 Day 5 Day 7 Day 9 Day 11 Day 13 Day 14
38.89 ± 0.94
26.67 ± 0.82
20.00 ± 0.00
18.89 ± 0.47
18.89 ± 0.47
18.89 b ± 0.47 B13M1 82.22 ± 0.82 55.56 ± 0.47 35.56 ± 1.25 25.56 ± 0.47 24.44 ± 0.47 22.22 ± 0.47 22.22 ± 0.47 22.220.47 b ±
B20M2 71.11 ± 0.47 55.56 ± 2.05 44.44 ± 2.05 30.00 ± 1.63 21.11 ± 0.47 18.89 ± 0.47 16.67 ± 0.00 16.670.00 ab ±
N9.2 55.56 ±
0.47
45.56 ± 0.47
35.56 ± 0.47
13.33 ± 0.82
4.44 ± 0.47
2.22 ± 0.47
2.22 ± 0.47
2.22 a ± 0.47 N13.1.1 60.00 ±
1.41
48.89 ± 1.25
30.00 ± 0.82
23.33 ± 1.41
18.89 ± 0.94
17.78 ± 0.47
17.78 ± 0.47
16.67 ab ± 0.00 HH3-34 62.22 ± 0.94 48.89 ± 1.25 28.89 ± 0.47 23.33 ± 0.82 21.11 ± 1.63 20.00 ± 1.41 20.00 ± 1.25 20.001.41 b ±
Values with different letters(a,b,c) indicate significant differences at P <0.05
Anatomy and observation the internal organs of the fish showed severe necrosis in the liver and kidney Bacterial isolation from dead fishes on TCBS medium determmined 30/30
