Nghiên cứu tạo chủng vi khuẩn vibrio parahaemolyticus đột biến giảm độc lực nhằm phát triển vắc xin phòng bệnh hoại tử gan thận trên một số loài cá biển tt tiếng anh

HA NOI NATIONAL UNIVERSITY VU THI BICH HUYEN A STUDY ON CREATING OF ATTENUATED MUTANT Vibrio parahaemolyticus STRAINS AND THEIR POTENTIAL AS LIVE VACCINE CANDIDATES AGAINST NEPHROTIC A

HA NOI NATIONAL UNIVERSITY

VU THI BICH HUYEN

A STUDY ON CREATING OF ATTENUATED MUTANT Vibrio parahaemolyticus

STRAINS AND THEIR POTENTIAL AS LIVE VACCINE CANDIDATES AGAINST NEPHROTIC AND HEPATIC NECROSIS DISEASE

IN SOME MARINE FISH

Specialized: GENETICS Code: 9.42.01.21

SUMMARY OF BIOLOGICAL THESIS

HANOI - 2020

The project was completed at: Department of Genetics – Biochemistry, Faculty of Biology,

Ha Noi National University of Education and Biotechnology laboratory, Faculty of

Biotechnology, Ha Noi Open University

Science instructor: Assoc Prof Dr Nguyen Xuan Viet

Assoc Prof Dr Pham Thi Tam

Critical Reviewer 1: Assoc Prof Dr Khuat Huu Thanh

Hanoi University of Science and Technology

Critical Reviewer 2: Assoc Prof Dr Nguyen Thi Hong Van

VNU University of Science - Vietnam National University, Hanoi

Critical Reviewer 3: Assoc Prof Dr Duong Minh Lam

Hanoi National University of Education

The thesis will be presented before Assessment Council in Hanoi National University

of Education at ………

The thesis can be found at the National Library, Hanoi or Library of Hanoi National

University of Education

PUBLISHED BY AUTHOR The articles were published

1 Cao Thi Thanh Huong, Pham Thi Tam, Nguyen Manh Hung, Nguyen Xuan Viet,

Vu Thi Bich Huyen (2015) The characteristics of Vibrio parahaemolyticus isolated from

fish have hepatic and kidney necrosis Science and Technology Journal of Agriculture &

Rural Development 8/2015: 72-78, in Vietnamese

2 Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thị Tam, Man Hong Phuoc,

Nguyen Dang Quang, Do Thanh Van, Dang Thi Hong Tham (2018) A study on creating an

attenuated Vibrio parahaemolyticus mutant strain by treatment with rifampicin The 3nd

National Scientific Conference on Biological Research and Teaching in Vietnam at Quy Nhon, Viet Nam 20th May: 1156 -1163, in Vietnamese

3 Vu Thi Bich Huyen, Nguyen Xuan Viet, Dang Thi Hong Tham, Man Hong Phuoc,

Pham Thi Tam (2018) Assessment of stability and immunization response of Vibrio parahaemolyticus L4650 attenuated strain to support vaccine production against hepatic and

kidney necrosis disease for marine fish, Science and Technology Journal of Agriculture &

Rural Development 21/2018: 79-85, in Vietnamese

4 Vu Thi Bich Huyen, Nguyen Xuan Viet, Huynh Viet Tung, Pham Thi Tam, man

Hong Phuoc (2019) Biochemical characteristics and genetics of Vibrio parahaemolyticus strains caused hepatic necrosis disease for groupers in Cat Ba, Hai Phong Veterinary

Science and Techniques Journal Vol 26 No.7/2019: 62-73, in Vietnamese

5 Vu Thi Bich Huyen, Nguyen Xuan Viet, Pham Thi Tam, Man Hong Phuoc,

Huynh Viet Tung, Nguyen Dang Quang, Do Thanh Van (2020) Development of attenuated

Vibrio parahaemolyticus mutant strains as potential live vaccines Asia Pacific Journal of Molecular Biology and Biotechnology 28(1): 52-67

Sequences were published in NCBI:

- Gen toxR of A3.3 strain with accession number MH047286

- Gen tlh of A3.3 strain with accession number MH047289

International Conference

Vu Thi Bich Huyen, Chu Dinh Toi, Nguyen Xuan Viet, Man Hong Phuoc, Pham Thi Tam (2019) Isolation and evaluation the potential as live attenuated vaccine candidate of rifampicin-resistant Vibrio parahaemolyticus strains 2019 International Academic Conference for Graduate Student of Nanjing Agricultural University in October 2019, Nanjing, China

INTRODUCTION

1 Reason to choose the topic

With the advantage of a long coastline (3,260 km) stretching from North to South, the potential for aquaculture development is huge According to the General Statistics Office, in

2018 the GDP of the whole fishery reached 190.123 billion VND, accounting for 3.43% of the whole economy and 23.57% of the whole agriculture sector, an increase of 6.46% compared to 2017, reaching the highest growth rate in agriculture, contributing 0.22 points

to the overall growth of agriculture and the whole country [187] However, the aquaculture industry in Vietnam as well as in the world always faces difficulties and challenges, especially the losses caused by diseases According to the Food and Agriculture Organization of the United Nations (FAO), the diseases costs the global aquaculture industry more than USD 6 billion a year, occurring in most developing countries In Vietnam, it is estimated that each year the seafood industry has lost nearly USD 1 billion due to the disease [22]

Hepatic and kidney necrosis disease in fish detected in 14 countries, in 48 species of

fish, is known to be caused by the bacterium Vibrio parahaemolyticus [112] Diseased fish

have symptoms such as red spots, skin sores, flakes, truncated fins, hemorrhagic organs, especially in liver and kidney, diseased fish can die in series, the death rate is up to 90%

[112, 138] V parahaemolyticus causes massive liver necrosis and mortality in large

numbers for fish annually reported in Quang Ninh, Hai Phong, Quang Ngai, Phu Yen, Khanh Hoa, Ba Ria-Vung Tau provinces [184, 185, 186]

Until now, to control and to treat nephrotic and kidney necrosis disease for fish,

farmers has mainly used antibiotics to kill V parahaemolyticus [34, 61] However, use

regularly and no strict control of antibiotics have led to the resistance development in many bacterial strains [26] and accumulation of residual antibiotics in fish tissue, which is food for human [107] Therefore, vaccination is an effective disease control method to reduce using antibiotic in aquaculture

Bacterial vaccines for fish include inactivated vaccines, live attenuated vaccines, recombinant vaccines, sub-unit vaccines, DNA vaccines [125] Most of the commercially available bacterial vaccines for fish in the world are inactivated vaccine because of their high safety However, the inactivated vaccine is considered to have a short protection period [152] Although there have been a few studies on making inactivated, recombinant or DNA

vaccines to prevent the disease caused by V parahaemolyticus in fish has been published,

but so far such vaccines are licensed for commercial use in fishes A attenuated vaccine using a attenuated bacterium is a promising research path for commercial production of fish vaccines due to its high relative survival percent and long protection periods

Creating a strain of V parahaemolyticus that has the ability to cause an immune

response in fish is important and decisive for the success or failure of developing a attenuated vaccine Therefore, the study of creating a attenuated strain for the production of attenuated vaccine to prevent necrosis of the liver and kidney is very necessary Therefore, the study of creating a attenuated strain for the production of attenuated vaccine to prevent necrosis of the liver and kidney is very necessary, consistent with the trend and offers a high potential for prevention nephrotic and kidney necrosis disease

Based on the theoretical and practical basis, the project: “A study on creating of

attenuated mutant Vibrio parahaemolyticus strains and their potential as live vaccine

candidate against nephrotic and hepatic necrosis disease in some marine fish” has been

carried out

2 Objectives

2.1 General objectives

Creating of attenuated mutant Vibrio parahaemolyticus strains causing immune

response for fish to develop production of vaccines against nephrotic and hepatic necrosis disease for some marine fish

2.2 Specific objectives

- Isolate attenuated strains of V parahaemolyticus from the bacterial virulence strains

isolated causing nephrotic and hepatic necrosis disease by treating with rifampicin

- Determine nucleotide sequence changes in genes that encode virulence proteins (tdh,

trh, tlh, toxR) and rpoB genes in Vibrio attenuated strains

- Determine the protection ability of the attenuated bacteria strain selected

3 Research content

- Isolation and identification of strains of V parahaemolyticus from a marine fish

suffering from nephrotic liver and kidney disease cultured in the Northern Viet Nam

- Isolation attenuated strains of V parahaemolyticus from pathogenic wild-type strains by treatment rifampicin and analyzing nucleotide sequence changes in genes (toxR,

tdh, trh, tlh và rpoB) of attenuated strains compareing wild-type strains

- Evaluation of the ability to create an immune response of the potential attenuated

mutant strain in orange-spotted grouper (Epinephelus coioides) and selection V

parahaemolyticus attenuated strains to be vaccine candidate

4 Objects

Strains of V parahaemolyticus cause hepatic and kidney necrosis disease for marine fish

5 The research scopes

Strains of V parahaemolyticus bacteria isolated from marine fish farmed around Cat

Ba island, Lan Ha bay, Cat Hai (Hai Phong); Dong Chau sea area (Thai Binh); Hai Thinh sea (Nam Dinh) and the attenuated mutant lines were isolated

6 The scientific and practical significance of the topic

6 1 Scientific significance

Provide a database of pathogenic V.parahaemotycus isolates for fish cultured in the

Northern Viet nam for morphological, biochemical and antibiotic resistance characteristics Detecting mutations in the virulence gene and ropB gene of rifampicn-resistant V parahaemolyticus strains are of scientific significance for the direction of further studies for the development of live attenuated vaccines used in preventing diseases for cultured marine fish

The results of evaluating the protection ability of attenuated V parahaemolyticus

strain in orange-spotted grouper is the scientific basis for immunological research for marine fish

6.2 Practical significance

The mutant strain of V parahaemolyticus, which has the potential to cause a protective

immune response, offers the prospect of producing vaccines against hepatic and kidney

necrosis disease for orange-spotted grouper as well as some other marine fish

7 New contributions of the thesis

- The thesis is one of the first studies on creating attenuated V parahaemolyticus

strains by treatment with rifampicin, to support the production of vaccines against hepatic and kidney necrosis disease in marine fish

- Analysis the difference in nucleotide sequence in virulence tlh genes and rpoB genes

of attenuated strains comparing wild-type strains provided the genetic basis for the

relationship between mutation changes in these genes and attenuation of strains V

paraheamolitycus

- Selection V paraheamolitycus L4650 strain being potential vaccine candidate for

development live attenuated vaccine for hepatic and kidney necrosis disease in marine fish The L4650 strain was stable virulence level, the survival rate of orange-spotted

grouper (Epinephelus coioides) injected with a dose of 100 µl/fish, 105 CFU/ml reached 100% The relative percent survival (RPS) of groupers vaccinated L4650 reaches 96.91

- 100% after 15 days post-vaccination; 93.33 - 100% after 6 months post-vaccination,

8 Location and study time

Location: The project was completed at: Department of Genetics – Biochemistry, Faculty of Biology, Ha Noi National University of Education and Biotechnology laboratory, Facultof Biotechnology, Ha Noi Open University

Study time: from 11/2014 to 4/2019

CHAPTER I: OVERVIEW OF RESEARCH

1.1 Overview of Vibrio parahaemolyticus cause hepatic and kidney necrosis disease in

marine fish

1.1.1 Morphological, biochemical and growth characteristics of Vibrio

1.1.2 Genome of V parahaemolyticus

1.1.3 Virulence and genes regulating haemolysin tvirulence

There are three haemolysin protein: TDH (thermostable direct haemolysin), TRH

(TDH-related haemolysin) and TLH (thermolabile haemolysin) are encoded by tdh, trh and tlh genes, respectively The toxR gen is in the toxRS operon (Vp-toxRS), encodes

for regulatory proteins that play an essential role in regulating the survival and virulence of bacteria

1.1.4 The rpoB gene and resistance to rifampicin

The rpoB gene coding for b-subunit of RNA polymerase that related to Rifampicin resistance Rifampicin is a broad-spectrum antibiotic that can hinder DNA-directed RNA polymerase, and thereby, blocking the initiation of transcription and killing bacterium

1.1.5 Antigen of Vibrio parahaemolyticus

1.2 Hepatic and kidney necrosis disease in marine fish

1.2.1 Symptom

1.2.2 Diagnosis and treatment

1.3 Vaccines and active immune mechanism

1.3.1 Vaccines and vaccine types for fish

1.3.2 Specific immunity in bone fish

1.3.3 Fish vaccine delivery

1.4 Study on creating attenuated strains for production of attenuated vaccines against hepatic and kidney necrosis disease

1.4.1 Creating attenuated strains with physical agents

1.4.2 Creating attenuated strains with chemical agents

1.4.3 Creating attenuated strains by genetic engineering

1.5 Research situation on vaccine production to prevent hepatic and kidney necrosis disease in fish

1.5.1 Research situation in the world

1.5.2 Research situation in Vietnam

Currently, studies to create vaccines against V parahaemolyticus are focusing on

inactivated and recombinant vaccines with the outer membrane proteins and DNA vaccines

However, commercially licensed vaccines against V parahaemolyticus are not available for

fish, including the attenuated vaccines for hepatic and kidney necrosis disease in fish In this study, we created attenuated strain and assessed the potential of the strain to select several

strains to use as a material for the production of attenuated vaccines against V

parahaemolyticus

CHAPTER II: OBJECTS, MATERIALS AND RESEARCH METHODS

2.1 Objects and materials

2.1.2.2 Experimental fish

Zebrafish (Danio rerio) length 3 - 3,5 cm and tilapia (Oreochromis niloticus) length 6

- 6,5 cm from Research Institute for Aquaculture No1 (Tu Son, Bac Ninh) Orange spotted

grouper (Epinephelus coioides) length 5,5 - 6 cm from Aquatic Breeding Center Hai Phong

2.1.2.3 Bacteria: The type strain V parahaemolyticus VTCC 12233 purchased from the

Institute of Microbiology and Biotechnology, Vietnam National University, Hanoi, Vietnam

was included as a control

2.1.2.4 Chemicals

2.1.2.5 Equipment

2.2 Research methods

2.2.1 Diagram of the main steps

Figure 2.1 Diagram of the main steps

Isolation

Treatment of rifampicin from 10 to 250 μg/ml

Assessment, selection

Disease marine fishes

V parahaemolyticus strains isolated

Rifampicin-resistant V parahaemolyticus strains

Attenuated strains of V parahaemolyticus

Evaluation of stability, ability to create immune response of

potential attenuated strains

Inject into orange-spotted grouper

Selecte potential attenuated strain

2.2.2 Method of isolating Vibrio strain from suspected infected fish

The liver, kidneys, skin, fins of suspected disease fish are crushed in 1.5% saline solution, dilute this solution, and spread evenly over the surface of the TCBS medium Select colonies with morphology: round, glossy, convex, dark green on TCBS medium

2.2.3 The method to hold bacterial strains

2.2.4 Gram stain method

2.2.5 Method for determining the growth of bacteria

2.2.6 Methods of assessing biochemical characteristics and antibiotic resistance characteristics of strains

(a) Assessing biochemical characteristics: fermentation, indole production, catalase

generation, mobility, gas production and H2S generation and haematopoietic capacity

(b) Antibiotic resistance characteristics: with ampicillin (25 µg), gentamycin (30 µg),

norfloxacin (10 µg), enrofloxacin (5 µg) và erythromycin (15 µg)

2.2.7 Methods of assessing virulence of isolated strains

Groupers are injected with the V parahaemolyticus isolates Determine survival rates

of fish

2.2.8 Method of treating bacteria with rifampicin

Bacterial culture on rifampicin-containing media with increasing rifampicin concentration from 10 to 250 µg/ml Selection rifampicin-resistant strains

2.2.9 Methods of assessing virulence of rifampicin-resistant strains

(a) Survival rate of fish after infection: Rifampicin-resistant bacteria strains were

evaluated for virulence by bacterial infection on zebrafish and tilapia Determine survival rate of fish after infection

(b) LD50 value

2.2.10 Molecular biology methods

2.2.10.1 Primer design method

Using CLC Genomics Workbench 8.5 (QIAGEN Bioinformatics) to design primar for

toxR, tdh, trh, tlh genes of V parahaemolyticus

2.2.10.2 Methods of total DNA extraction: Total DNA was extracted by i-genomic BYF

DNA Extraction Mini kit (iNtRON, Korea)

2.2.10.3 PCR, sequencing and analyzing sequences of virulence and rpoB genes

(a) PCR to amplify virulence genes and rpoB gene

Bảng 2.1: Sequence and characteristics of primers used in PCR Genes

target Primer Primer sequence (5’ – 3’) Tm (℃)

Size of products (bp) Source

toxR toxR-4 GTCTTCTGACGCAATCGTTG 54,1 368 Kim Y.B et al (1999)

tdh tdh1 ACTGGACTGTGGTTGGT tdh2 CCTCGAATTACGCAACAA 56,7 50,3 865 In this study

trh trhF TTGGCTTCGATATTTTCAGTATCT trhR TTGGCTTCGATATTTTCAGTATCT 52,2 52,8 500 Bej A.K et al (1999)

trh trh1 TCGCATTTTTTCACCATTCCC trh2 TAAGTTCACGCATTGAG 54,2 49,6 772 In this study

(1997) (b) Sequencing method: PCR products sent for sequencing at First BASE Laboratories, Malaysia

2.2.11 Bioinformatics method: Results of gene sequencing were analyzed with software

BLAST (https://blast.ncbi.nlm.nih.gov/Blast)

CLC Genomics Workbench 8.5

Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index)

Swiss model (https://swissmodel.expasy.org/interactive)

2.2.12 Methods for evaluating virulence stability and the safety of attenuated strain in orange-spotted grouper

(a) Evaluating virulence stability of attenuated strain

(b) Evaluating the safety of attenuated strain

2.2.13 Method of evaluating the immune response of the attenuated strain on groupers

(a) Assessing the immune response to fish

Relative survival percent (RPS) is calculated by the formula of Amend (1981)

RPS (%) = [1-(% dead vaccinated fish /% dead control fish)] x 100

(b) Evaluate immune length: assess relative survival percent of fish after 1, 2, 4, and 6 months of vaccination

2.2.14 Data processing methods

Data were processed statistically in Excel and Stata 2.0 software

CHAPTER III: RESULTS AND DISCUSSION 3.1 Isolation of bacteria from marine fish samples suspected to have hepatic and kidney necrosis disease

3.1.1 Isolation of Vibrio bacteria

Isolation of 26 bacterial isolates of the Vibrio ssp from fishes suspected to have hepatic

and kidney necrosis disease After that, 11 bacteria isolates were selected: B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3; HH3-34; LBT6 which have the

characteristic of V parahaemolyticus colonies

3.1.2 Biochemical analysis of bacterial isolates

All 11 bacterial isolates had biochemical characteristics similar to the positive control

strains VTCC 12233 and suitable for V parahaemolyticus: the ability to ferment glucose,

not to ferment lactose, not to produce H2S, not to produce gas, to produce indole, to be able

to move, to produce catalase, hemolytic type β Resistance to some types of antibiotics of isolates are shown in Table 3.3

The antibiotic resistance of V parahaemolyticus strain has also been reported by many authors [167, 182] It can be noticed that the antibiotics use lack of control in the treatment

of aquatic diseases is a huge concern for the aquaculture industry Vaccines for aquatic animals is a sustainable solution and is essential to minimize antibiotic resistance in pathogenic bacteria in aquaculture

Table 3.3 Antimicrobial properties with 5 antibiotics of 11 isolates

No

Isolates

Antibiotic resistance

Erythromycin (15 µg)

Gentamycin (30 µg)

Norfloxacin (10 µg)

Ampicillin (25 µg)

Enrofloxacin (5 µg)

Note:S - sensitivity; I - moderate sensitivity; R - resistance

3.1.3 Amplifying and sequencing some virulence genes and rpoB gene bacterial isolates

The bacterial isolates (11 isolates) and positive control bacteria V parahaemolyticus

VTCC12233 were extracted total DNA and checked quality on agarose electrophoresis gel Results showed that a total DNA band on the agarose gel was compact and sharp (Figure 3.6) The results of OD260/OD280 ratios of 12 total DNA samples were in the range of 1.8 to 2.0 Thus, these total DNA samples were purified, qualified for use in PCR

Figure 3.6 Total DNA of bacterial isolates of electrophoresis on agarose gel 1%

Line 1-12: VTCC12233; B3.13; B5M2; B5M3; B5M4; B13M1; B20M2; N9.2; N13.1.1; A3.3;

HH3-34; LBT6; M: Marker 1kb

Table 3.4 Presence of virulence genes of bacterial isolates

No Isolates Presence of virulence genes

Figure 3.7 The PCR product (368 bp) of toxR gene of 11 isolates

3.1.4 Evaluation of pathogenicity of V parahaemolyticus strains to grouper

Observing the symptoms of infected fish and recording the survival rate of the

groupers after 14 days of injection with V parahaemolyticus strains isolated showed that:

100% of the infected fish manifested hemorrhagic symptoms, hemorrhagic fin, flake of fish scales, skin ulcer, the muscular area around the injection site and skin are darker, severe necrosis of the liver and kidney

The survival rate of grouper after 14 days of infection (Table 3.5) ranged from 2,22%

to 22,22%, of which, fish injected with B5M3 and N9.2 strains had the lowest (2,22%) survival rate Thehighest survival rate recorded in fish infected with the B13M1 strain (22,22%) These rates in fishes infected with LBT6, B3.13, A3.3, B5M2, B5M4 strains were 13,33%; 6,67%; 10%; 18,9%; 18,9%, respectively The survival rate 16,67% was observed in fish infected with one of three strains of bacteria B20M2, N13.1.1, HH3-34 High mortality rates was in the first week, especially on day 1 to day 3 after infection In the following week, the mortality rate was lower and the change range of this rate was less among days

Anatomy and observation the internal organs of the fish showed severe necrosis in the liver and kidney Isolation bacteria from dead fishes on TCBS medium determmined 30/30 (100%) diseased fish samples detected with bacteria having characteristics of V parahaemolyticus: colonies were dark green , glossy surface, round shape, Gram-negative bacteria Especially, groupers infected with LBT6, A3.3 and B3.13 had the seriously damaged phenomenon in liver and kidney, decomposed Based on the results of the

virulence assessment of the isolated V parahaemolyticus strains, disease symptoms of fish,

we selected 3/7 strains of highly virulent bacteria, including LBT6, A3.3 and B3.13, and

be used these strains to select and create mutation strains