NGHIÊN cứu BỆNH GUMBORO TRÊN GÀ TẠI một số TỈNH ĐỒNG BẰNG SÔNG cửu LONG tt tiếng anh

MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY SUMMARY OF DOCTOR THESIS Major: PATHOLOGY AND TREATMENT OF ANIMALS Major code: 62640102 PhD student: NGO PHU CUONG STUDY ON CHI

MINISTRY OF EDUCATION AND TRAINING

CAN THO UNIVERSITY

SUMMARY OF DOCTOR THESIS

Major: PATHOLOGY AND TREATMENT OF ANIMALS

Major code: 62640102

PhD student: NGO PHU CUONG

STUDY ON CHICKEN GUMBORO DISEASE IN SOME PROVINCES OF THE MEKONG DELTA

Can Tho, 2019

THESIS WAS COMPLETELY CONDUCTED AT CAN

THO UNIVERSITY

Scientific Supervisor: Assoc Prof TRAN NGOC BICH

Thesis was defened with the doctoral thesis examinination committee of Can Tho University

Meeting at: ………, Can Tho University

At … … … date … month … year …

Opponent 1:

Opponent 2:

Thesis can be found at the library:

1 Learning Resource Center, Can Tho University

2 National Library of Vietnam

LIST OF PUBLISHED SCIENTIFIC RESEARCH

1 Ngô Phú Cường và Trần Ngọc Bích, 2018 Epidemiological

characteristics of chicken Gumboro disease in the Mekong Delta ISSN 1859-2333 Can Tho University Journal of Science, 54(4B): 40 – 44

2 Ngo Phu Cuong, Tran Ngoc Bich, and Tran Trung Tin,

2018 Some epidemiological characteristics of Gumboro disease in household chickens in 5 provinces of the Mekong Delta ISSN 1859 – 4581 Science and Technology Journal of Agriculture and Rural Development, 21(1): 64 – 69

3 Ngo Phu Cuong, Le Thi Kim Xuyen, Le Thanh Hoa and

Tran Ngoc Bich, 2018 Analysis of characteristic molecular and pedigree of virulent Gumboro virus strains isolated in 2017-

2018 in Ben Tre and Vinh Long National Conference on Biotechnology 2018, 485-490

4 National Conference on Biotechnology 2018, Ha Noi

5 Workshop on Science and Technology of Veterinary Medicine 2018, Hai Duong

Chapter 1: INTRODUCTION 1.1 The importance of thesis

Gumboro disease has been one of the avian diseases causing the huge economic loss for the poultry industry in many provinces of Vietnam for a long time Recently, Gumboro disease shows different mutant strains belonged to serotype I and II; among them, serotype I has a high virulence and pathogenicity (OIE, 2008) In Vietnam, Gumboro disease was officially found from the 1980s based on clinical symptoms, lesions, and epidemiology Isolated IBDV with different genotypes and phenotypes coexist causing the disease progress complicated and difficult for achieving

the effective treatment with vaccination (Nguyen Ba Thanh et al., 2007; Le

Thi Kim Xuyen and Le Thanh Hoa, 2008; Ho Thi Viet Thu, 2012a) The research of Ho Thi Viet Thu (2012a) indicated that Gumboro disease usually outbreaks in the flocks without vaccination (70,0%), following by one-time vaccinated chicken (62,5%) and two-time vaccinated chicken (28,6%)

In Vietnam, as well as in the Mekong Delta, Gumboro virus is diverse and complicated because of importing chicken breeds from many countries on the world Moreover, IBDV with various genotypes and phenotypes makes the disease more severe and less effective in treatment

by the vaccine Therefore, the thesis named “Study on chicken Gumboro disease in some provinces of the Mekong Delta” was conducted

1.2 The aim of research

- Determining the prevalence of Gumboro virus in chickens raised

in farms, households in the Mekong Delta The related factors such as breeds, ages, vaccinated times, raising methods, death chickens… and some clinical symptoms in the suspicious infected flocks were included

- Determining the genetic characteristic of the Gumboro virus isolated in the Mekong Delta Comparing the gene encoding VP2 region with the gene bank, commercial vaccine strains, and creating the genetic dendrogram of virus in the field

- Surveying the ratio of immune response and the difference in the immune response of three Gumboro vaccines in 2 chicken breeds (Ben Tre

“Noi” and Luong Phuong)

1.3 The meaning and practice of thesis

Gumboro disease is an acute infectious disease caused by the virus

in the poultry (mainly in chicken and turkey), considering as the classical disease of the poultry industry There are many studies on this disease, virus, and preventive vaccines; however, this disease still outbreaks Immunodeficiency significantly affects the preventive efficiency of many vaccination campaigns in chickens as well as increases the sensitivity of chickens to other opportunistic pathogens Some evidence indicated that IBDV infected chicken flocks could become the host to transmitted other

pathogenic viruses (Pham Hong Son et al., 2012; Ho Thi Viet Thu, 2012a)

Recent reports reveal that IBDV has been one of the important pathogens causing the enormous economic loss for the poultry industry IBDV isolated strains harbor different genotypes and phenotypes to lead the disease complex and difficult in the effective treatment with the vaccine

(Nguyen Ba Thanh et al., 2007; Le Thi Kim Xuyen and Le Thanh Hoa,

2008; Ho Thi Viet Thu, 2012a)

IBDV’effective prevention contributes to the general health of chicken flocks and decreases economic loss Research for vaccine production based on the sequence of genetic nucleotides from IBDV isolated in the field has been conducted domestically and internationally However, up to now, in the Mekong Delta, the information of decoding the VP2 region in Gumboro virus was still limited Therefore, the nucleotide decryption of Gumboro virus isolated in the field was necessary for determining the pathogenic level, suitable vaccine selection to prevent Gumboro disease in chicken flocks, and increasing the economic efficiency

of the poultry industry

1.4 The new of thesis

By collecting virus strains causing Gumboro disease in the field of some provinces in the Mekong Delta, comparing the modification of gene sequence, the antigen and pathogenicity, the resource and genetic relationship of virus strains, it helps us to select the suitable vaccine strains

to prevent this disease effectively On the other hand, it contributes to set

up a reliable scientific basis for developing the preventive strategy against the IBD disease in the Mekong Delta and saving the health of chicken flocks in Vietnam

Chapter 2: RESEARCH CONTENTS AND METHODS 2.1 Research contents, research time, and research places 2.1.1 Nội dung nghiên cứu

Content 1: Study on the prevalence of chicken Gumboro disease in the Mekong Delta

Content 2: Study on the genetic characteristics of Gumboro virus isolated in the Mekong Delta

Content 3: Study on the immune response of three Gumboro vaccines selected from the result of Content 2 towards two chicken breeds (Ben Tre “Noi” and Luong Phuong)

2.1.2 Research time: from 10/2015 to 10/2018 2.1.3 Research places

Research was carried out in 6 provinces of the Mekong Delta, including Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh About the poultry farming, these provinces have developed both 2 raising methods: industrial chickens in big farms and household chickens They are relatively representative of the poultry production in the Mekong Delta

For storage and examination of specimens, chicken sera: Department of Veterinary Medicine, College of Agriculture, Can Tho University

For running RT – PCR: Institute of Biotechnology – Vietnam Academy of Science and Technology, Ha Noi

For analyzing the sequence of VP2 genes from Gumboro virus in the field: Macrogen Company, Korea

For setting the layout of investigated experiments about the immune response of 3 Gumboro vaccines towards two chicken breeds (Ben Tre “Noi” and Luong Phuong): Dong Thap province

Direct ELISA kit: IBDV Ag Test (originated from belgium) delivered from Thoi Dai Xanh company

Indirect ELISA kit: IBDV Ab Test, Thinh A company

2.2.3 Research object 2.2.3.1 Content 1

- All chickens were raised in Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh

- No of examined chicken flocks: 131 flocks

2.2.3.3 Content 3

Experimental chickens were raised at the households in Dong Thap Ben Tre “Noi” chicks at a one-day age were bought from the local hatchery company Luong Phuong chicks at a one-day age were bought from Nong Nghiep Tri Viet L.L.C Chicks were vaccinated to prevent Marek disease before supplying for the farmers Experimental chickens were fully captive to ensure the hygiene livestock environment, nutrition source, caring, and vaccination in regular

2.3 Research method 2.3.1 Content 1 2.3.1.1 Method of the survey on the prevalence of chicken Gumboro disease in househols/farms

Chicken breeds were mainly surveyed including hybrid “Noi”, Tau vang, Binh Dinh, Luong Phuong in 3 raising methods: free grazing, half-grazing, and captivity (Table 2.1)

Table 2.1: The number of examined chicken flocks in the Mekong Delta

2.3.1.2 Method of the survey on the characteristic symptoms and lesions in the suspicious infected chicken flocks

Information collection: recording the related information about the chicken flocks using the questionnaire, when the disease was announced Chickens infected Gumboro disease show the symptoms and lesions such

as moodiness, withdrawing their beaks in the wings, falling to one side, lying down, half-closed eyes, stocking in the corner, picky or skip eating, drinking much, disorientation, white stools, loose or watery stools with

blood, swollen or hemorrhagic Fabricius bursa, hemorrhagic in chest

2.3.1.3 Method of the Gumboro virus detection

The suspicious infected chicken flocks with Gumboro disease were examined clinical symptoms and collected feces by using kit IBDV Ag Test (originated from Belgium) delivered by Thoi Dai Xanh company

2.3.2 Content 2 2.3.2.1 Method of detection of VP2 gene from Gumboro virus isolated in the field

- Step 1: Selection of samples

- Step 2: Extraction of ARN from samples

A pair of primer using for RT-PCR: forward GVF: 5’ CAAACGATCGCAGCGATGACAAACCTGCAAGAT 3’ and reverse GVR: 5’ GGCTTCAAAGACATAATTCGGGCC 3’ Amplification of gene at “hypervariable region” with molecular weight: 0.47 kb

- Step 3: Synthetic of c.DNA from ARN by using Themor kit

- Step 4: Running PCR with c DNA

- Step 5: Electrophoresis PCR products on agarose gel 2%, at 75V,

50 min to check the amplification of gene

2.3.2.2 Method of decryption of the nucleotide sequence of VP2 gene and determination of pathogenicity of Gumboro virus

After detection of the VP2 gene from Gumboro virus isolated in the field, ta total of 10 virus samples, which were good quality, bright DNA bands, single bands (marked for each province) were selected to analyze the homogeneous gene The sequence of VP2 gene was decoded in Macrogen Company, Korea The nucleotide sequence of VP2 gene was compared by using GENDOC2.7 software (http://www.nrbsc.org/gfx/gendoc/)

2.3.2.3 Method of comparison and creation of the genetic dendrogram from Gumboro virus isolated in the field with the gene bank and vaccine strains used in the Mekong Delta

Access on the Gene bank to get the information of Gumboro virus strains which were announced in Vietnam and on the world, as well as in

the Mekong Delta

Table 2.2: List of virus Gumboro strains and vaccine strains in the Gene bank used in this research

code

Isolated year

20 IBD BLEN AY332560 USA av

21 BUR-706 EU544156 Brazil at

22 Cevac EU544158 Hungary at

23 Georgia KF573194 India at

24 Nobilis AJ586966 Netherland av

vv: very virulent; av: antigenic variant; at: attenuated

During the survey, vaccine brandnames were frequently used including IBD Blen, Bur 706, Ceve Gumboro, Georgia, Nobilis; therefore, they are applied in this research:

- Vaccine 1: IBD BLEN (MERIAL – USA)

- Vaccine 2: BUR 706 (MERIAL – France)

- Vaccine 3: Cevac Gumboro L (Hungary)

- Vaccine 4: Georgia (India)

- Vaccine 5: Nobilis (MSD – Netherland)

2.3.3 Content 3 2.3.3.1 Method of survey on the immune response of 3 Gumboro vaccines on Ben Tre “Noi” and Luong Phuong chickens

a Experimental henhouses

The henhouses were the soil-floor with an area of 3.5 m2 prepared before stocking The floor was covered with a layer of sand about 20 cm thick, 15 - 20 cm thick of rice husk on the paddled layer; the roof is made

of nipa leaves It were fenced with B40 net around, and covered with canvas to avoid drafts with a feeding light and feeder system for chickens Cages, breeding equipment were disinfected before putting chickens into the experimental henhouses

b Experimental arrangment

The experiment were arranged in a completely random block with

4 experiments and 3 replicates (Table 2.3) Each experiment was 30 chickens/tratment At 3 day-old, chicks were collected the heart blood to check the maternal antibodies; thus, a total of 60 chicks were used Chickens were continuously raised in the experiments to collect the vein blood of wings The total of chickens were used: 4 experiment x 2 breeds x

Ben Tre “Noi” 3 times 30 30 30 30

Luong Phuong 3 times 30 30 30 30

EX1: the control treatment (without vaccination); EX2: IBD BLEN (MERIAL – USA); EX3: Cevac Gumboro L (Hungary); EX4: Nobilis (MSD – Netherland)

2.3.3.2 Method of collecting blood to examine the anitibodies Table 2.4: Summary of vaccination times and collecting blood

to examine the antibodies

Vaccination

First time 7 - 180 180 180 Second time 28 - 180 180 180

Blood collection

Before vaccination 3 60

First time 21 60 60 60 60 Second time 42 60 60 60 60

EX1: Control; EX2: Vaccine IBD BLEN; EX3: Vaccine Cevac Gumboro L; EX4: Vaccine Nobilis

The antibodies were examined by the direct ELISA assay of Gumboro virus Indexx ELISA kit (USA) was supplied by Thinh A Com pany (Ho Chi Minh City)

2.4 Examined indexes 2.4.1 Content 1

- Characteristics of chicken flocks infected Gumboro disease: breed, raising method, age, vaccinated times

- The ratio of symptoms and lesions in Gumboro infected chickens

- The ratio of infected samples

- The ratio of death chickens due to Gumboro disease

- The homogenous level of the sequence of nucleotide and amino acid of Gumboro virus strains isolated in the filed and other strains in Vietnam and on the world (published on the Gene bank)

- The genetic origin of Gumboro virus in the field

2.4.3 Content 3

- The rate of immune response between 2 chicken breeds, used vaccine, and vaccination times

- The difference of immune response between 2 chicken breeds, used vaccine, and vaccination times

2.5 Data analysis

The experimental data were analyzed by using the Excel software The statistics and variance were analyzed by using Minitab 16 The comparison of the experimental avergaes were examined by Chi-Square and Tukey method of Minitab 16

Chapter 3: RESULTS AND DISCUSSIONS 3.1 Content 1: Survey on the prevalence of chicken Gumboro disease in some provinces of the Mekong Delta

3.1.1 Characteristics of chicken flocks infected Gumboro disease

3.1.1.1 The ratio of Gumboro infected chicken flocks among chicken breeds

Table 3.1: The ratio of Gumboro infected chicken flocks among chicken breeds

Percentage (%)

of Tau Vang, and 17 flocks of Binh Dinh The total rate of infected chicken flocks was 45%

The ratio of infected chickens was significantly different among chicken breeds (P<0,05); the highest rate was Tau Vang chicken (68,4%), while the lowest ones was hybrid “Noi” chickens (28,8%) It indicates that the resistance against Gumboro disease depends on the genetic characteristic of chicken breeds that affect on the early immune response to IBDV

3.1.1.2 The ratio of chicken Gumboro disease by raising methods

Table 3.2: The ratio of chicken Gumboro disease by raising methods

Table 3.2 showed that there was different significantly in the rate

of Gumboro disease among raising methods; this disease occured primarily

in free grazing or half-grazing chickens (57,1%, 55,0% respectively), and the lowest rate was in the captive chickens (28,0%) (P<0,05) The reason might be that the grazing method reduced stress due to the keeping (concentration, uncertain hygiene, lack of ventilation ); therefore, chickens were resistant well against the disease in comparison with captive chickens

3.1.1.3 The ratio of chicken Gumboro disease by ages Table 3.3: The ratio of chicken Gumboro disease by ages

infected flocks

No of infected flocks

Percentage (%)

infected flocks

No of infected flocks

Percentage (%)