Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children

Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome.

R E S E A R C H A R T I C L E Open Access

Relationship of metabolic syndrome and its

components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children

Ulises De la Cruz-Mosso1, José F Muñoz-Valle2, Lorenzo Salgado-Goytia1, Adrián García-Carreón1,

Berenice Illades-Aguiar1, Eduardo Castañeda-Saucedo1and Isela Parra-Rojas1*

Abstract

Background: Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its

components in a sample of Mexican mestizo children

Methods: This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th

percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP)≥ 95th

percentile and insulin resistance HOMA-IR≥ 2.4 The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP

Results: For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01) The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs 165 mg/dL; p = 0.02) in comparison with C/C genotype

Conclusions: The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total cholesterol levels in Mexican children

Keywords: Metabolic syndrome, PAI-1, Polymorphism, Dyslipidemia, Children

Background

Metabolic syndrome (MetS) is a common disorder

caused by a combination of poor diet, sedentary lifestyle

and genetic predisposition [1], the presence of MetS in

children is the main risk factor that predisposes to the

development of cardiovascular and metabolic diseases

such as atherosclerosis and type 2 diabetes mellitus in adulthood [2] The components of MetS include obesity, insulin resistance, hyperglycemia, atherogenic dyslipide-mia, and hypertension [1,3,4] Besides these components,

a decrease in fibrinolytic capacity has been shown to contribute to the development of this syndrome, which has been generally attributed to increased levels of plas-minogen activator inhibitor-1 (PAI-1) [5,6]

PAI-1 is the main inhibitor in the plasminogen activa-tion system (PAS), which comprises an inactive proen-zyme, plasminogen, which can be converted into its

* Correspondence: iprojas@yahoo.com

1 Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma

de Guerrero, Avenida Lázaro Cárdenas S/N, Ciudad Universitaria,

Chilpancingo, Guerrero CP 39090, Mexico

Full list of author information is available at the end of the article

© 2012 De la Cruz-Mosso et al; licensee BioMed Central Ltd This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and

active form plasmin by the action of physiological

plas-minogen activators (PAs) PAs degrades fibrin into

solu-ble products, being PAI-1 one of the main regulators of

fibrinolysis [7] Increased PAI-1 levels in plasma are

asso-ciated with the development of myocardial infarction and

the formation/progression of chronic inflammatory

dis-eases such as atherosclerosis and cardiovascular disease

[8,9] Increased of PAI-1 levels also have been linked

with risk factors such as obesity, insulin resistance,

glu-cose intolerance, hypertension and dyslipidemia (low

HDL plasma levels and hypertriglyceridemia), which

together are components of metabolic syndrome [10-13]

The human PAI-1 gene is ~ 12.2 kb long, contains nine

exons and 8 introns, and is located on chromosome

7q22 To date about 180 single nucleotide

polymorph-isms (SNP) in the PAI-1 gene have been described

[14,15] Association studies have shown that

polymorph-isms located in the promoter region of PAI-1 gene shows

a relationship with the concentrations of lipids (low

HDL) in Mexico-American population [16,17] One of

the polymorphisms in the promoter PAI-1 gene is the

-844 G/A polymorphism, which has been associated with

risk factors such as increased plasma levels of PAI-1,

glu-cose, insulin resistance, triglycerides and low HDL, as

well as with several diseases including deep vein

throm-bosis, coronary artery disease, rheumatoid arthritis and

systemic lupus erithematosus [18-21] Other SNP that is

interesting is the HindIII C/G polymorphism located in

the 3’ untranslated region (UTR) of PAI-1 gene, which

has been related to high levels of cholesterol and insulin

in myocardial infarction patients [22]

Based on this knowledge, both PAI-1 polymorphisms are

good candidates that might contribute to the pathological

features associated to the MetS Therefore, we designed

this study to analyze allele and genotype frequencies of

-844 G/A and HindIII C/G PAI-1 polymorphisms and its

association with MetS and its components in a sample of

Mexican Mestizo children

Methods

Patients and healthy subjects

All children enrolled in the study were of Mexican

Mes-tizo population born in the State of Guerrero, Mexico,

with a family history of ancestors, at least back to the

third generation born in our State This cross-sectional

study was carried out between June and December

2008 Participants were recruited of three schools in the

urban area from Chilpancingo, Guerrero, Mexico The

total group included 100 children with age range 6-11

years, divided in two groups: a) 48 children diagnosed

with MetS and b) 52 children metabolically healthy

without any clinical or biochemical alteration The

chil-dren with one or two clinic or metabolic alterations

were excluded

Informed written consent was obtained from all parents

or guardians before enrollment of children in the study Approval for the study was obtained from the Research Ethics Committee of the University of Guerrero according

to the ethical guidelines of 2008 Declaration of Helsinki

Clinical and anthropometric measurements

Body weight was determined using a Tanita body compo-sition monitor (Tanita BC-553, Arlington, USA) and height was measured to the nearest 0.1 cm using a stadi-ometer (Seca, Hamburg, Germany) From these measure-ments, body mass index was calculated (BMI = weight/ height2, kg/m2) The circumferences were measured by duplicate using a diameter tape accurate to within ± 0.1

cm (Seca 201, Hamburg, Germany) Waist circumference was measured at the level of the umbilicus and the super-ior iliac crest The measurement was made at the end of a normal expiration while the subjects stood upright, with feet together and arms hanging freely at the sides Hip cir-cumference was measured at the maximum point below the waist, without compressing the skin The waist-to-hip ratio was calculated as waist/hip The thickness of four skinfolds was measured to the nearest 0.1 mm, in dupli-cate, using skinfold caliper (Dynatronics Co, Salt Lake City, USA): triceps, biceps, subscapular and suprailiac The duplicate measures were averaged

Blood pressure (BP) was measured on the right arm of children seated and a rest for at least 5 min Two consecu-tive measures were obtained at 1-min interval with an aneroid sphygmomanometer (Riester CE 0124, Jungingen, Germany) Hypertension was defined as the average of the two measurements where the systolic BP (SBP) or diastolic

BP (DBP) is≥ 95th percentile for age and gender was determined [23] The classification of obesity was made using the 2000 Center for Disease Control and Prevention growth charts defined as normal weight 5th-85th percen-tiles and obesity≥ 95th percentile [24]

Biochemical measurements and definitions

A blood sample was obtained from each child from ante-cubital venipuncture after overnight fast Total serum cho-lesterol, triglycerides, HDL-chocho-lesterol, LDL-cholesterol and glucose levels were obtained using a semi-automated equipment (COBAS MIRA), insulin levels were deter-mined by immunoenzymatic assay (GenWay INS-EASIA kit)

The homeostasis model assessment of insulin resistance (HOMA-IR score) was used to determine insulin resistance

in children; this score was calculated with the following formula: fasting serum insulin (μU/mL) × fasting plasma glucose (mmol/L)/22.5 taking scores≥ 75th

percentile (HOMA-IR≥ 2.4) as the presence of insulin resistance

We employed International Diabetes Federation pro-posal for metabolic syndrome definition in children

aged 10-16 years old for blood glucose and lipid levels

[25] In this study, MetS was defined as the presence of

three or more of the following criteria: fasting glucose

levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL,

HDL-cholesterol < 40 mg/dL, obesity BMI≥ 95th

percentile, SBP and DBP≥ 95th

percentile and insulin resistance HOMA-IR≥ 2.4

Genotyping of -844 G/A and HindIII C/G PAI-1

polymorphism

The genomic DNA (gDNA) was isolated from peripheral

blood leukocyte according to the salting out method

[26] The -844 G/A and HindIII C/G PAI-1 single

nucleotide polymorphisms were analyzed by polymerase

chain reaction-restriction fragment length polymorphism

(PCR-RFLP) Amplification of -844 PAI-1 promoter

region was done in a thermal cycler (Techne, TC-312,

Cambridge, UK) using the following oligonucleotides:

5’CAGGCTCCCACTGATTCTAC3’ (Forward) and

5’GAGGGCTCTCTTGTGTCAAC3’ (Reverse) [27] PCR

was carried out in a final volume of 20 μL containing

1 μg of gDNA, 20 μM of each oligonucleotide, 1.25 U/

μL Taq DNA polymerase, supplied buffer enzyme 1×,

MgCl2 2.5 mM, and 2.5 mM of each deoxynucleotide

triphosphate (dNTP) (Invitrogen Life Technologies,

Carlsbad, Ca) PCR reaction was performed by initial

denaturation at 94°C for 3 min, 30 cycles of

amplifica-tion at 94°C for 30 seconds for denaturaamplifica-tion, 60°C for

30 seconds for annealing, and 72°C for 30 seconds for

extension Finally, 72°C for 1 min was used for ending

extension, resulting in a 510 base pair amplified

frag-ment analyzed on a 6% polyacrylamide gel stained with

silver nitrate Amplified fragments of -844 PAI-1

poly-morphism were digested for 1 hour at 37°C with 3 U of

XhoI (New England Biolabs, Beverly, Mass.) restriction

enzyme Afterward, restriction fragments were analyzed

by electrophoresis on a 6% polyacrylamide gel stained

with silver nitrate The G/G wild-type genotype was

digested and appeared as 364 and 146 bp fragments,

whereas the A/A polymorphic genotype (absence of the

XhoI site) migrated as a 510 bp fragment

The HindIII polymorphism was detected using the

fol-lowing oligonucleotides:

5’GCCTCCAGCTACCGT-TATTGTACA3’ (Forward) and 5’CAGCCTAAACAACA

GAGACCCC3’ (Reverse) [28] PCR was carried out in a

final volume of 20μL containing 1 μg of gDNA, 3 μM of

each oligonucleotide, 1.25 U/μL Taq DNA polymerase,

supplied buffer enzyme 1×, MgCl2 1.5 mM, and 2.5 mM

of each dNTP (Invitrogen Life Technologies) PCR

reac-tion was performed by initial denaturareac-tion at 94°C for

3 min, 30 cycles of amplification at 94°C for 30 seconds

for denaturation, 60°C for 30 seconds for annealing, and

72°C for 30 seconds for extension Finally, 72°C for 1 min

was used for ending extension, resulting in a 755 bp

amplified fragment analyzed on a 6% polyacrylamide gel stained with silver nitrate Amplified fragments of Hind III PAI-1 polymorphism were digested for 1 hour at 37°C with 5 U of HindIII (New England Biolabs) restriction enzyme Afterward, restriction fragments were analyzed by electrophoresis on 6% polyacrylamide gel stained with sil-ver nitrate The C/C wild-type genotype was digested and appeared as 567 and 188 bp fragments, whereas the G/G polymorphic genotype (absence of HindIII site) migrated

as a 755 bp fragment To confirm the results, genotyping

of both polymorphisms were done in duplicate in all cases and were randomly selected only a few -844 and HindIII PAI-1 genotypes for sequencing

Statistical analysis

Statistical analysis was performed using the statistical soft-ware STATA v 9.2 For the descriptive analysis, nominal variables were expressed as frequencies, continuous vari-ables normally distributed as mean and standard deviation, and those not normally distributed were expressed as medians and percentile 5 and 95 We determined geno-type and allele frequencies for the polymorphisms -844 and HindIII PAI-1 gene by direct counting, we performed chi-square test to compare proportions between groups (MetS vs metabolically healthy) and to evaluate the Hardy-Weinberg equilibrium The linkage disequilibrium between both SNPs was determined as D’

The significance of the differences between the bio-chemical and anthropometric parameters by genotypes (G/G vs GA + AA -844 and C/C vs C/G + G/G HindIII PAI-1) was determined using student t test and by Mann Whitney To evaluate the effect of polymorphism we used models of linear and logistic regression adjusted by gender and age Differences were considered statistically signifi-cant at p < 0.05

Results

The present study included 100 Mexican Mestizo chil-dren of both genders, aged 6 to 11 years Chilchil-dren were classified into two groups made up of 52 children meta-bolically healthy and 48 children with MetS, according the criteria mentioned above The prevalence of compo-nents de MetS in the cases group was: 33.04% for obe-sity + hyperglycemia + high triglycerides, 29.79% for obesity + hyperglycemia + high triglycerides + low HDL-cholesterol, 14.89% for obesity + hyperglycemia + low HDL-cholesterol and others combinations with minor prevalence (data no shown)

In this study, both polymorphisms evaluated were in Hardy-Weinberg equilibrium (c2

= 0.005; p = 1.0 for -844 G/A polymorphism, andc2

= 0.62; p = 0.66 for HindIII C/

G polymorphism) The linkage disequilibrium (D’) between both SNPs was 0.81 The distribution of allele and genotype frequencies between the two groups did not

show significant differences for HindIII C/G

polymorph-ism, but for the -844 G/A polymorphism we observed a

significant differences in genotype (p = 0.034) and allele

frequencies (p = 0.015) between the two groups, with an

OR of 2.79 (95% CI, 1.11 to 7.08) for the G/A genotype

and an OR of 2.2 (95% CI, 1.10 to 4.43) for A allele, which

indicates that children who were carriers of the risk A

allele, have 2.2 fold more susceptibility to present MetS,

and in children carrying the G/A genotype the risk

increases to 2.79 fold (Table 1)

Demographic, clinical and biochemical variables were

compared by gender in all children Only was observed a

difference, the boys had higher fasting glucose levels than

girls (median, 97 vs 93 mg/dL; p = 0.04) (Table 2)

Demographic, clinical and biochemical variables were

compared by genotypes of both PAI-1 polymorphisms

according to a dominant genetic model For the -844 G/

A polymorphism the G/A and A/A genotypes were

grouped for this genetic model, the -844 G/A + A/A

group showed a high prevalence of obesity (60%; p =

0.01), an increase in thickness of the biceps (16 mm; p =

0.05), triceps (16 mm; p = 0.01) and subscapular skinfolds

(15 mm; p = 0.03) and arm circumference (22 cm; p =

0.04), as well as decrease in HDL levels (39 mg/dL; p = 0.04) in comparison with G/G group (Table 3) To esti-mate in all children, the association of -844 G/A + A/A genotypes with demographic, clinical and biochemical variables that showed significant differences or tenden-cies, we used logistic regression models adjusted by age and gender The -844 G/A + A/A genotypes were asso-ciated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42;

p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01) (Table 4) However, we did not find a relationship with biceps, triceps and subscapular skinfolds as well as arm circumference (data no shown)

For the HindIII C/G polymorphism, when the C/G and G/G genotypes were grouped, the C/G + G/G group showed only an increase in plasma total cholesterol levels (179 mg/dL; p = 0.02) in comparison with C/C group (165 mg/dL)

Discussion

This study shows the association of two polymorphisms

in the PAI-1 gene with the development of MetS and its

Table 1 Genotype and allele frequencies of -844 and HindIII PAI-1 polymorphisms in cases and controls

syndrome

% (n = 48)

Metabolically healthy

% (n = 52)

-844 G/A PAI-1

Genotype

Allele

Genetic model

Do

HindIII C/G PAI-1

Genotype

Allele

Genetic model

Do

*Chi square test c 2

; OR = odds ratio; CI = confidence interval; Do = dominant model

§

components such as obesity and atherogenic

dyslipide-mia in a Mexican children population

Regarding the distribution of genotype and allele

fre-quencies of both polymorphisms, for the HindIII C/G

polymorphism we found a high frequency of C allele,

simi-lar to previous reports in Mexican mestizo population and

Caucasian population, however the G allele frequency was

lower in Mexican population [18,21,29] On the other

hand, the -844 G/A polymorphism we observed that is

dis-tributed inversely to those reported in Caucasian

popula-tions, in which the A allele is more frequent than the G

allele [12,18,19] In our study this polymorphism had a

high frequency of G allele and a lower frequency of A

allele, consistent with already reported frequencies in

pre-vious studies in Mexican mestizo population [20,30],

sug-gesting that in the Mexican population there is a high

frequency of allele G

According to our results, the differences observed in

the distribution of -844 G/A polymorphism may be

attributed to the racial influence, which is central to the

heterogeneous distribution of genetic polymorphisms It

is known that the Mexican population originated from a

mixture of European (4.2 to 70.8%) and African (0.9 to 40.5%) populations with Amerindian groups (27.6 to 94.5%), giving origin to the Mexican mestizo population, which has a higher genetic diversity in the distribution

of this and other polymorphisms [31] This can explain the differences in the distribution of genotypic and alle-lic frequencies of our population with other populations

in the world

As an important finding, in our study we found signifi-cant differences in the distribution of genotype and allele frequencies of -844 G/A polymorphism in both groups, determining an OR of 2.2 for A allele, and an OR of 2.79 for G/A genotype, which indicates that children who carry the A allele are 2.2 fold more susceptible to develop MetS and children who are carriers of the G/A genotype have a 2.79 fold increased risk of developing the syn-drome, compared to those who are carriers of G allele and G/G genotype These results obtained in our study are similar to those reported in a previous study done in Caucasian population in which A/A genotype was asso-ciated with the susceptibility of developing MetS (OR, 4.87; p < 0.001) [12] These consistent results reported in different populations may be due to the effect of the polymorphism on the levels of the protein, since it has been reported that the base change of G to A at position -844 of the promoter PAI-1 gene generates a binding site consensus sequence for Ets nuclear protein, which could

be involved in regulating gene expression and influencing the increase in PAI-1 plasma protein levels [32,33] While for the HindIII C/G polymorphism not significant differences were found in genotype and allele distribu-tion, but it has been reported that the base change of C

to G at the 3’ UTR of PAI-1 gene might plays an impor-tant role in the disruption of the translational regulation process and cause changes in the translational levels of messenger ribonucleic acid (mRNA) in both physiological and pathological conditions, resulting in an increase in PAI-1 plasma protein levels [34]

We described for first time in Mexican children that -844 G/A polymorphism contribute to a significant increase in subcutaneous fat, increasing the risk of devel-oping obesity (OR, 2.6; p = 0.01) in children who are car-riers of the G/A and A/A genotypes A possible explanation for this finding could be that the -844 G/A polymorphism contribute to the large amount of PAI-1 produced by adipose tissue expansion, as well as the increase of obesity Studies of PAI-1 knockout mice have shown an effect of PAI-1 on weight gain and increased adipose cellularity associated with high-fat dieting [35] Besides, studies in which the PAI-1 gene was disrupted in ob/ob mice show a reduction of adiposity in these mice This suggests that PAI-1 gene can control fat mass, although the mechanism of action is not yet known, may

be PAI-1 gene can control fat mass at least in part, by

Table 2 General characteristics by gender in all children

Gender

n = 48

Girls

n = 52

p value

Circumferences

Skinfolds

Biochemical measurements

Triglycerides (mg/dL)c 101(36-204) 102 (38-200) 0.8

a) Data provided in n and percentages Chi square test; b) Data provided in

means ± SD Student’s t test; c) Data provided in median and percentile 5-95.

Mann-Whitney test

Table 3 General characteristics according PAI-1 polymorphism following a dominant genetic model

n = 53

G/A + A/A

n = 47

n = 57

C/G + G/G

n = 43

p value

Circumferences

Skinfolds

Biochemical measurements

Insulin ( μU/mL) c

a) Data provided in n and percentages Chi square test; b) Data provided in means ± SD Student’s t test; c) Data provided in median and percentile 5-95 Mann-Whitney test

Table 4 Association of G/A + A/A genotypes of -844 PAI-1 polymorphism with obesity and lipid levels

-844 PAI-1

Genotypes

value

< 95thpercentile % (n = 58) ≥ 95 th

percentile % (n = 42)

Plasma triglycerides levels

< 150 mg/dL % (n = 61) > 150 mg/dL % (n = 39)

Plasma HDL-cholesterol levels

> 40 mg/dL % (n = 58) < 40 mg/dL % (n = 42)

*Chi square test, §

Reference category, OR = odds ratio, CI = confidence interval

inducing the proliferation of adipocytes through the effect

on the expression of genes such as tumour necrosis factor

alpha (TNF-a) and transforming growth factor beta

(TGF-b), leptin and insulin [36]

In addition the effect on the increase in adipose tissue,

there was an association of G/A and A/A genotypes of

-844 G/A polymorphism with increased triglyceride

levels and decreased HDL-C levels, which indicates that

those children who are carriers of these genotypes, have

an increase in the risk to develop atherogenic

dyslipide-mia compared with genotype G/G In the case of HindIII

C/G polymorphism, C/G and G/G genotypes were

asso-ciated with a raise of total cholesterol explaining 8% of

the variability of their plasma concentration, influencing

along with -844 G/A polymorphism to the development

of atherogenic profile that characterizes the MetS It has

been reported that a very-low-density lipoprotein

(VLDL)-responsive element in the PAI-1 promoter could

be responsible for the effect of plasma lipids on PAI-1

expression [14] Therefore, the increase in PAI-1 levels

may contribute to the development of obesity and

atherogenic dyslipidemia, and PAI-1 may be a causal link

between obesity and cardiovascular disease

The -844 G/A and HindIII C/G PAI-1 single nucleotide

polymorphisms have not been associated with PAI-1

levels Several adult studies showed that an increase in the

level of PAI-1 was related to the genotype PAI-1 4 G/5 G

polymorphism [37,38] However, in children some

infor-mation is available on the influence of the 4 G/5 G

poly-morphism on PAI-1 levels or with others obesity-related

phenotypes In Children with obesity, Estelles et al [39]

observed no influence of the 4 G/5 G polymorphism on

PAI-1 levels Moreover, no influence of the PAI-1 4 G/5 G

polymorphism on lipid and glucose metabolism

para-meters was observed in Turkish obese children [40,41]

A limitation of this study is the small number of sample,

even though is a sample with children that were recruited

with precise selection criteria and the control group did

not have any of the components included in the definition

of MetS In addition, few studies of genetic association of

PAI-1 gene with MetS have been conducted in children

Other limitation of this study is that lack of replication,

the replication of genetic associations in independent

populations is essential to reduce the number of

false-positive results and to further define the role of these

var-iants in the susceptibility to complex disease as MetS

Although our study found an association of -844 G/A

polymorphism with the MetS and its components such

as obesity and a atherogenic dyslipidemia characterized

by hypertriglyceridemia and low HDL-cholesterol, and

the HindIII C/G polymorphism with increased plasma

levels of total cholesterol, other of the limitations is that

PAI-1 plasma levels were not measured; therefore the

association of -844 G/A and HindIII C/G polymorphisms

with PAI-1 levels remains uncertain in our population Therefore it is necessary to determine PAI-1 plasma levels in future studies in Mexican children

Conclusions

In summary, this study provide evidence that the -844 G/

A PAI-1 polymorphism is related with the risk of develop-ing MetS, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism is associated with increased total cholesterol levels, which contributes to the pathogenesis of MetS

Abbreviations MetS: metabolic syndrome; PAI-1: plasminogen activator inhibitor-1; PAS: plasminogen activation system; Pas: physiological plasminogen activators; HDL: high density lipoprotein; 3 ’UTR: 3’untranslated region; BP: blood pressure; SBP: systolic blood pressure; DBP: diastolic blood pressure; LDL: low density lipoprotein; HOMA-IR: homeostasis model assessment of insulin resistance; gDNA: genomic DNA; PCR-RFLP: polymerase chain reaction-restriction fragment length polymorphism

Acknowledgements This work was supported by grants from PROMEP-SEP (UAGRO-EXB-057) and FOMIX-CONACYT-Gobierno del Estado de Guerrero 2010-01 (No 147778) Author details

1

Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma

de Guerrero, Avenida Lázaro Cárdenas S/N, Ciudad Universitaria, Chilpancingo, Guerrero CP 39090, Mexico.2Grupo de Inmunogenética Funcional, Departamento de Biología Molecular y Genómica, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara, Jalisco, Mexico.

Authors ’ contributions IPR conceived and organized the study and prepared the manuscript UDCM performed the genotyping and participated in the statistical analysis, interpreted the data and wrote the manuscript LSG and AGC were responsible for patient enrollment and participated in the genetic analysis JFMV, BIA and ECS participated in the design of the study, contributed interpreting the data and revising successive drafts of the manuscript All authors read and approved the final manuscript.

Competing interests The authors declare that they have no competing interests.

Received: 22 July 2011 Accepted: 29 March 2012 Published: 29 March 2012

References

1 Huang PL: A comprehensive definition for metabolic syndrome Dis Model Mech 2009, 2:231-237.

2 Taslim S, Tai ES: The relevance of the metabolic syndrome Ann Acad Med Singap 2009, 38:29-25.

3 Alberti KGMM, Zimmet P, Shaw J: Metabolic syndrome –a new world-wide definition A Consensus Statement from the International Diabetes Federation Diabet Med 2006, 23:469-480.

4 Bruce KD, Byrne CD: The metabolic syndrome: common origins of a multifactorial disorder Postgrad Med J 2009, 85:614-621.

5 Hamsten A, de Faire U, Walldius G, Dahlén G, Szamosi A, Landou C, Blombäck M, Wiman B: Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction Lancet 1987, 2:3-9.

6 Juhan-Vague I, Thompson SG, Jespersen J: Involvement of the hemostatic system in the insulin resistance syndrome A study of 1500 patients with angina pectoris The ECAT Angina Pectoris Study Group Arterioscler Thromb 1993, 13:1865-1873.

7 Aso Y: Plasminogen activator inhibitor (PAI)-1 in vascular inflammation

and thrombosis Front Biosci 2007, 12:2957-2966.

8 Schneiderman J, Sawdey MS, Keeton MR, Bordin GM, Bernstein EF, Dilley RB,

Loskutoff DJ: Increased type 1 plasminogen activator inhibitor gene

expression in atherosclerotic human arteries Proc Natl Acad Sci USA 1992,

89:6998-7002.

9 Sobel BE: Increased plasminogen activator inhibitor-1 and vasculopathy.

A reconcilable paradox Circulation 1999, 99:2496-2498.

10 Morange PE, Lijnen HR, Alessi MC, Kopp F, Collen D, Juhan-Vague I:

Influence of PAI-1 on adipose tissue growth and metabolic parameters

in a murine model of diet-induced obesity Arterioscler Thromb Vasc Biol

2000, 20:1150-1154.

11 Naran NH, Chetty N, Crowther NJ: The influence of metabolic syndrome

components on plasma PAI-1 concentrations is modified by the PAI-1 4

G/5G genotype and ethnicity Atherosclerosis 2008, 196:155-163.

12 Bouchard L, Vohl MC, Lebel S, Hould FS, Marceau P, Bergeron J, Pérusse L,

Mauriège P: Contribution of genetic and metabolic syndrome to omental

adipose tissue PAI-1 gene mRNA and plasma levels in obesity Obes Surg

2010, 20:492-499.

13 Ha H, Oh EY, Lee HB: The role of plasminogen activator inhibitor 1 in

renal and cardiovascular diseases Nat Rev Nephrol 2009, 5:203-211.

14 Binder BR, Christ G, Gruber F, Grubic N, Hufnagl P, Krebs M, Mihaly J,

Prager GW: Plasminogen activator inhibitor 1: physiological and

pathophysiological roles News Physiol Sci 2002, 17:56-61.

15 Ma Z, Paek D, Oh CK: Plasminogen activator inhibitor-1 and asthma: role

in the pathogenesis and molecular regulation Clin Exp Allergy 2009,

39:1136-1144.

16 Arya R, Blangero J, Williams K, Almasy L, Dyer TD, Leach RJ, O ’Connell P,

Stern MP, Duggirala R: Factors of insulin resistance syndrome-related

phenotypes are linked to genetic locations on chromosomes 6 and 7 in

nondiabetic mexican-americans Diabetes 2002, 51:841-847.

17 Duggirala R, Blangero J, Almasy L, Dyer TD, Williams KL, Leach RJ,

O ’Connell P, Stern MP: A major susceptibility locus influencing plasma

triglyceride concentrations is located on chromosome 15q in Mexican

Americans Am J Hum Genet 2000, 66:1237-1245.

18 Adamski MG, Turaj W, Slowik A, Wloch-Kopec D, Wolkow P, Szczudlik A:

A-G-4 G haplotype of PAI-1 gene polymorphisms -844 G/A, HindIII G/C,

and -675 4 G/5G is associated with increased risk of ischemic stroke

caused by small vessel disease Acta Neurol Scand 2009, 120:94-100.

19 Lopes C, Dina C, Durand E, Froguel P: PAI-1 polymorphisms modulate

phenotypes associated with the metabolic syndrome in obese and

diabetic Caucasian population Diabetologia 2003, 46:1284-1290.

20 Torres-Carrillo NM, Torres-Carrillo N, Vázquez-Del Mercado M,

Delgado-Rizo V, Oregón-Romero E, Parra-Rojas I, Muñoz-Valle JF: The -844 G/A PAI-1

polymorphism is associated with mRNA expression in rheumatoid

arthritis Rheumatol Int 2008, 28:355-360.

21 Padilla-Gutiérrez JR, Palafox-Sánchez CA, Valle Y, Orozco-Barocio G,

Oregón-Romero E, Vázquez-Del Mercado M, Rangel-Villalobos H,

Llamas-Covarrubias MA, Muñoz-Valle JF: Plasminogen activator inhibitor-1

polymorphisms (-844 G > A and HindIII C > G) in systemic lupus

erythematosus: association with clinical variables Clin Exp Med 2011,

11:11-17.

22 Dawson S, Hamsten A, Wiman B, Henney A, Humphries S: Genetic

variation at the plasminogen activator inhibitor-1 locus is associated

with altered levels of plasma plasminogen activator inhibitor-1 activity.

Arterioscler Thromb 1991, 11:183-190.

23 National High Blood Pressure Education Program Working Group on High

Blood Pressure in Children and Adolescents: The fourth report on the

diagnosis, evaluation, and treatment of high blood pressure in children

and adolescents Pediatrics 2004, 114:555-576.

24 Centers for Disease Control and Prevention, National Center for Health

Statistics: Clinical Growth Charts [http://www.cdc.gov/growthcharts/

clinical_charts.htm].

25 Zimmet P, Alberti G, Kaufman F, Tajima N, Arslanian S, Wong G, Bennett P,

Shaw J, Caprio S: International diabetes federation task force on

epidemiology and prevention of diabetes: the metabolic syndrome in

children and adolescents Lancet 2007, 369:2059-2061.

26 Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for

extracting DNA from human nucleated cells Nucleic Acids Res 1988,

16:1215.

27 Henry M, Chomiki N, Scarabin PY, Alessi MC, Peiretti F, Arveiler D, Ferrières J, Evans A, Amouyel P, Poirier O, Cambien F, Juhan-Vague I: Five frequent polymorphisms of the PAI-1 gene: lack of association between genotypes, PAI activity, and triglyceride levels in a healthy population Arterioscler Thromb Vasc Biol 1997, 17:851-858.

28 Grenett HE, Khan N, Jiang W, Booyse FM: Identification of the Hind III polymorphic site in the PAI-1 gene: analysis of the PAI-1 Hind III polymorphism by PCR Genet Test 2000, 4:65-68.

29 Benza RL, Grenett H, Li XN, Reeder VC, Brown SL, Go RC, Hanson KA, Perry GJ, Holman WL, McGiffin DC, Kirk KA, Booyse FM: Gene Polymorphisms for PAI-1 Are Associated with the Angiographic Extent

of Coronary Artery Disease J Thromb Thrombolysis 1998, 5:143-150.

30 Torres-Carrillo N, Magdalena Torres-Carrillo N, Vázquez-Del Mercado M, Rangel-Villalobos H, Parra-Rojas I, Sánchez-Enríquez S, Francisco Muñoz-Valle J: Distribution of -844 G/A and Hind III C/G PAI-1 polymorphisms and plasma PAI-1 levels in Mexican subjects: comparison of frequencies between populations Clin Appl Thromb Hemost 2008, 14:220-226.

31 Rubi-Castellanos R, Martínez-Cortés G, Muñoz-Valle JF, González-Martín A, Cerda-Flores RM, Anaya-Palafox M, Rangel-Villalobos H: Pre-Hispanic Mesoamerican demography approximates the present-day ancestry of Mestizos throughout the territory of Mexico Am J Phys Anthropol 2009, 139:284-294.

32 Grubic N, Stegnar M, Peternel P, Kaider A, Binder BR: A novel G/A and the

4 G/5G polymorphism within the promoter of the plasminogen activator inhibitor-1 gene in patients with deep vein thrombosis Thromb Res 1996, 84:431-443.

33 Henry M, Chomiki N, Scarabin PY, Alessi MC, Peiretti F, Arveiler D, Ferrières J, Evans A, Amouyel P, Poirier O, Cambien F, Juhan-Vague I: Five frequent polymorphisms of the PAI-1 gene: lack of association between genotypes, PAI activity, and triglyceride levels in a healthy population Arterioscler Thromb Vasc Biol 1997, 17:851-858.

34 Torres-Carrillo N, Torres-Carrillo NM, Martínez-Bonilla GE, Vázquez-Del Mercado M, Palafox-Sánchez CA, Oregón-Romero E, Bernard-Medina AG, Rangel-Villalobos H, Muñoz-Valle JF: Plasminogen activator inhibitor-1 C/G polymorphism in relation to plasma levels in rheumatoid arthritis Clin Exp Med 2009, 9:223-228.

35 Morange PE, Lijnen HR, Alessi MC, Kopp F, Collen D, Juhan-Vague I: Influence of PAI-1 on adipose tissue growth and metabolic parameters

in a murine model of diet-induced obesity Arterioscler Thromb Vasc Biol

2000, 20:1150-1154.

36 Schäfer K, Fujisawa K, Konstantinides S, Loskutoff DJ: Disruption of the plasminogen activator inhibitor 1 gene reduces the adiposity and improves the metabolic profile of genetically obese and diabetic ob/ob mice FASEB J 2001, 15:1840-1842.

37 Hoffstedt J, Andersson LL, Persson L, Isaksson B, Arner P: The common -675 4 G/5G polymorphism in the plasminogen activator inhibitor-1 gene is strongly associated with obesity Diabetologia 2002, 45:584-587.

38 Sartori MT, Vettor R, De Pergola G, De Mitrio V, Saggiorato G, Della Mea PD, Patrassi GM, Lombardi AM, Fabris R, Girolami A: Role of the 4 G/5G polymorphism of PAI-1 gene promoter on PAI-1 levels in obese patients: influence of fat distribution and insulin-resistance Thromb Haemost 2001, 86:1161-1169.

39 Estelles A, Dalmau J, Falco C, Berbel O, Castello R, Espana F, Aznar J: Plasma 1 levels in obese children-effect of weight loss and influence of

PAI-1 promoter 4 G/5G genotype Thromb Haemost 200PAI-1, 86:647-652.

40 Kinik ST, Ataç FB, Verdi H, Cetinta ş S, Sahin FI, Ozbek N: The effect of plasminogen activator inhibitor-1 gene 4 G/5G polymorphism on glucose and lipid metabolisms in Turkish obese children Clin Endocrinol

2005, 62:607-610.

41 Kinik ST, Ozbek N, Yuce M, Yazici AC, Verdi H, Ataç FB: PAI-1 gene 4 G/5G polymorphism, cytokine levels and their relations with metabolic parameters in obese children Thromb Haemost 2008, 99:352-356 Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2431/12/41/prepub

doi:10.1186/1471-2431-12-41 Cite this article as: De la Cruz-Mosso et al.: Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children BMC Pediatrics 2012 12:41.