Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome.
Trang 1R E S E A R C H A R T I C L E Open Access
Relationship of metabolic syndrome and its
components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children
Ulises De la Cruz-Mosso1, José F Muñoz-Valle2, Lorenzo Salgado-Goytia1, Adrián García-Carreón1,
Berenice Illades-Aguiar1, Eduardo Castañeda-Saucedo1and Isela Parra-Rojas1*
Abstract
Background: Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its
components in a sample of Mexican mestizo children
Methods: This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th
percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP)≥ 95th
percentile and insulin resistance HOMA-IR≥ 2.4 The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP
Results: For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01) The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs 165 mg/dL; p = 0.02) in comparison with C/C genotype
Conclusions: The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total cholesterol levels in Mexican children
Keywords: Metabolic syndrome, PAI-1, Polymorphism, Dyslipidemia, Children
Background
Metabolic syndrome (MetS) is a common disorder
caused by a combination of poor diet, sedentary lifestyle
and genetic predisposition [1], the presence of MetS in
children is the main risk factor that predisposes to the
development of cardiovascular and metabolic diseases
such as atherosclerosis and type 2 diabetes mellitus in adulthood [2] The components of MetS include obesity, insulin resistance, hyperglycemia, atherogenic dyslipide-mia, and hypertension [1,3,4] Besides these components,
a decrease in fibrinolytic capacity has been shown to contribute to the development of this syndrome, which has been generally attributed to increased levels of plas-minogen activator inhibitor-1 (PAI-1) [5,6]
PAI-1 is the main inhibitor in the plasminogen activa-tion system (PAS), which comprises an inactive proen-zyme, plasminogen, which can be converted into its
* Correspondence: iprojas@yahoo.com
1 Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma
de Guerrero, Avenida Lázaro Cárdenas S/N, Ciudad Universitaria,
Chilpancingo, Guerrero CP 39090, Mexico
Full list of author information is available at the end of the article
© 2012 De la Cruz-Mosso et al; licensee BioMed Central Ltd This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
Trang 2active form plasmin by the action of physiological
plas-minogen activators (PAs) PAs degrades fibrin into
solu-ble products, being PAI-1 one of the main regulators of
fibrinolysis [7] Increased PAI-1 levels in plasma are
asso-ciated with the development of myocardial infarction and
the formation/progression of chronic inflammatory
dis-eases such as atherosclerosis and cardiovascular disease
[8,9] Increased of PAI-1 levels also have been linked
with risk factors such as obesity, insulin resistance,
glu-cose intolerance, hypertension and dyslipidemia (low
HDL plasma levels and hypertriglyceridemia), which
together are components of metabolic syndrome [10-13]
The human PAI-1 gene is ~ 12.2 kb long, contains nine
exons and 8 introns, and is located on chromosome
7q22 To date about 180 single nucleotide
polymorph-isms (SNP) in the PAI-1 gene have been described
[14,15] Association studies have shown that
polymorph-isms located in the promoter region of PAI-1 gene shows
a relationship with the concentrations of lipids (low
HDL) in Mexico-American population [16,17] One of
the polymorphisms in the promoter PAI-1 gene is the
-844 G/A polymorphism, which has been associated with
risk factors such as increased plasma levels of PAI-1,
glu-cose, insulin resistance, triglycerides and low HDL, as
well as with several diseases including deep vein
throm-bosis, coronary artery disease, rheumatoid arthritis and
systemic lupus erithematosus [18-21] Other SNP that is
interesting is the HindIII C/G polymorphism located in
the 3’ untranslated region (UTR) of PAI-1 gene, which
has been related to high levels of cholesterol and insulin
in myocardial infarction patients [22]
Based on this knowledge, both PAI-1 polymorphisms are
good candidates that might contribute to the pathological
features associated to the MetS Therefore, we designed
this study to analyze allele and genotype frequencies of
-844 G/A and HindIII C/G PAI-1 polymorphisms and its
association with MetS and its components in a sample of
Mexican Mestizo children
Methods
Patients and healthy subjects
All children enrolled in the study were of Mexican
Mes-tizo population born in the State of Guerrero, Mexico,
with a family history of ancestors, at least back to the
third generation born in our State This cross-sectional
study was carried out between June and December
2008 Participants were recruited of three schools in the
urban area from Chilpancingo, Guerrero, Mexico The
total group included 100 children with age range 6-11
years, divided in two groups: a) 48 children diagnosed
with MetS and b) 52 children metabolically healthy
without any clinical or biochemical alteration The
chil-dren with one or two clinic or metabolic alterations
were excluded
Informed written consent was obtained from all parents
or guardians before enrollment of children in the study Approval for the study was obtained from the Research Ethics Committee of the University of Guerrero according
to the ethical guidelines of 2008 Declaration of Helsinki
Clinical and anthropometric measurements
Body weight was determined using a Tanita body compo-sition monitor (Tanita BC-553, Arlington, USA) and height was measured to the nearest 0.1 cm using a stadi-ometer (Seca, Hamburg, Germany) From these measure-ments, body mass index was calculated (BMI = weight/ height2, kg/m2) The circumferences were measured by duplicate using a diameter tape accurate to within ± 0.1
cm (Seca 201, Hamburg, Germany) Waist circumference was measured at the level of the umbilicus and the super-ior iliac crest The measurement was made at the end of a normal expiration while the subjects stood upright, with feet together and arms hanging freely at the sides Hip cir-cumference was measured at the maximum point below the waist, without compressing the skin The waist-to-hip ratio was calculated as waist/hip The thickness of four skinfolds was measured to the nearest 0.1 mm, in dupli-cate, using skinfold caliper (Dynatronics Co, Salt Lake City, USA): triceps, biceps, subscapular and suprailiac The duplicate measures were averaged
Blood pressure (BP) was measured on the right arm of children seated and a rest for at least 5 min Two consecu-tive measures were obtained at 1-min interval with an aneroid sphygmomanometer (Riester CE 0124, Jungingen, Germany) Hypertension was defined as the average of the two measurements where the systolic BP (SBP) or diastolic
BP (DBP) is≥ 95th percentile for age and gender was determined [23] The classification of obesity was made using the 2000 Center for Disease Control and Prevention growth charts defined as normal weight 5th-85th percen-tiles and obesity≥ 95th percentile [24]
Biochemical measurements and definitions
A blood sample was obtained from each child from ante-cubital venipuncture after overnight fast Total serum cho-lesterol, triglycerides, HDL-chocho-lesterol, LDL-cholesterol and glucose levels were obtained using a semi-automated equipment (COBAS MIRA), insulin levels were deter-mined by immunoenzymatic assay (GenWay INS-EASIA kit)
The homeostasis model assessment of insulin resistance (HOMA-IR score) was used to determine insulin resistance
in children; this score was calculated with the following formula: fasting serum insulin (μU/mL) × fasting plasma glucose (mmol/L)/22.5 taking scores≥ 75th
percentile (HOMA-IR≥ 2.4) as the presence of insulin resistance
We employed International Diabetes Federation pro-posal for metabolic syndrome definition in children
Trang 3aged 10-16 years old for blood glucose and lipid levels
[25] In this study, MetS was defined as the presence of
three or more of the following criteria: fasting glucose
levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL,
HDL-cholesterol < 40 mg/dL, obesity BMI≥ 95th
percentile, SBP and DBP≥ 95th
percentile and insulin resistance HOMA-IR≥ 2.4
Genotyping of -844 G/A and HindIII C/G PAI-1
polymorphism
The genomic DNA (gDNA) was isolated from peripheral
blood leukocyte according to the salting out method
[26] The -844 G/A and HindIII C/G PAI-1 single
nucleotide polymorphisms were analyzed by polymerase
chain reaction-restriction fragment length polymorphism
(PCR-RFLP) Amplification of -844 PAI-1 promoter
region was done in a thermal cycler (Techne, TC-312,
Cambridge, UK) using the following oligonucleotides:
5’CAGGCTCCCACTGATTCTAC3’ (Forward) and
5’GAGGGCTCTCTTGTGTCAAC3’ (Reverse) [27] PCR
was carried out in a final volume of 20 μL containing
1 μg of gDNA, 20 μM of each oligonucleotide, 1.25 U/
μL Taq DNA polymerase, supplied buffer enzyme 1×,
MgCl2 2.5 mM, and 2.5 mM of each deoxynucleotide
triphosphate (dNTP) (Invitrogen Life Technologies,
Carlsbad, Ca) PCR reaction was performed by initial
denaturation at 94°C for 3 min, 30 cycles of
amplifica-tion at 94°C for 30 seconds for denaturaamplifica-tion, 60°C for
30 seconds for annealing, and 72°C for 30 seconds for
extension Finally, 72°C for 1 min was used for ending
extension, resulting in a 510 base pair amplified
frag-ment analyzed on a 6% polyacrylamide gel stained with
silver nitrate Amplified fragments of -844 PAI-1
poly-morphism were digested for 1 hour at 37°C with 3 U of
XhoI (New England Biolabs, Beverly, Mass.) restriction
enzyme Afterward, restriction fragments were analyzed
by electrophoresis on a 6% polyacrylamide gel stained
with silver nitrate The G/G wild-type genotype was
digested and appeared as 364 and 146 bp fragments,
whereas the A/A polymorphic genotype (absence of the
XhoI site) migrated as a 510 bp fragment
The HindIII polymorphism was detected using the
fol-lowing oligonucleotides:
5’GCCTCCAGCTACCGT-TATTGTACA3’ (Forward) and 5’CAGCCTAAACAACA
GAGACCCC3’ (Reverse) [28] PCR was carried out in a
final volume of 20μL containing 1 μg of gDNA, 3 μM of
each oligonucleotide, 1.25 U/μL Taq DNA polymerase,
supplied buffer enzyme 1×, MgCl2 1.5 mM, and 2.5 mM
of each dNTP (Invitrogen Life Technologies) PCR
reac-tion was performed by initial denaturareac-tion at 94°C for
3 min, 30 cycles of amplification at 94°C for 30 seconds
for denaturation, 60°C for 30 seconds for annealing, and
72°C for 30 seconds for extension Finally, 72°C for 1 min
was used for ending extension, resulting in a 755 bp
amplified fragment analyzed on a 6% polyacrylamide gel stained with silver nitrate Amplified fragments of Hind III PAI-1 polymorphism were digested for 1 hour at 37°C with 5 U of HindIII (New England Biolabs) restriction enzyme Afterward, restriction fragments were analyzed by electrophoresis on 6% polyacrylamide gel stained with sil-ver nitrate The C/C wild-type genotype was digested and appeared as 567 and 188 bp fragments, whereas the G/G polymorphic genotype (absence of HindIII site) migrated
as a 755 bp fragment To confirm the results, genotyping
of both polymorphisms were done in duplicate in all cases and were randomly selected only a few -844 and HindIII PAI-1 genotypes for sequencing
Statistical analysis
Statistical analysis was performed using the statistical soft-ware STATA v 9.2 For the descriptive analysis, nominal variables were expressed as frequencies, continuous vari-ables normally distributed as mean and standard deviation, and those not normally distributed were expressed as medians and percentile 5 and 95 We determined geno-type and allele frequencies for the polymorphisms -844 and HindIII PAI-1 gene by direct counting, we performed chi-square test to compare proportions between groups (MetS vs metabolically healthy) and to evaluate the Hardy-Weinberg equilibrium The linkage disequilibrium between both SNPs was determined as D’
The significance of the differences between the bio-chemical and anthropometric parameters by genotypes (G/G vs GA + AA -844 and C/C vs C/G + G/G HindIII PAI-1) was determined using student t test and by Mann Whitney To evaluate the effect of polymorphism we used models of linear and logistic regression adjusted by gender and age Differences were considered statistically signifi-cant at p < 0.05
Results
The present study included 100 Mexican Mestizo chil-dren of both genders, aged 6 to 11 years Chilchil-dren were classified into two groups made up of 52 children meta-bolically healthy and 48 children with MetS, according the criteria mentioned above The prevalence of compo-nents de MetS in the cases group was: 33.04% for obe-sity + hyperglycemia + high triglycerides, 29.79% for obesity + hyperglycemia + high triglycerides + low HDL-cholesterol, 14.89% for obesity + hyperglycemia + low HDL-cholesterol and others combinations with minor prevalence (data no shown)
In this study, both polymorphisms evaluated were in Hardy-Weinberg equilibrium (c2
= 0.005; p = 1.0 for -844 G/A polymorphism, andc2
= 0.62; p = 0.66 for HindIII C/
G polymorphism) The linkage disequilibrium (D’) between both SNPs was 0.81 The distribution of allele and genotype frequencies between the two groups did not
Trang 4show significant differences for HindIII C/G
polymorph-ism, but for the -844 G/A polymorphism we observed a
significant differences in genotype (p = 0.034) and allele
frequencies (p = 0.015) between the two groups, with an
OR of 2.79 (95% CI, 1.11 to 7.08) for the G/A genotype
and an OR of 2.2 (95% CI, 1.10 to 4.43) for A allele, which
indicates that children who were carriers of the risk A
allele, have 2.2 fold more susceptibility to present MetS,
and in children carrying the G/A genotype the risk
increases to 2.79 fold (Table 1)
Demographic, clinical and biochemical variables were
compared by gender in all children Only was observed a
difference, the boys had higher fasting glucose levels than
girls (median, 97 vs 93 mg/dL; p = 0.04) (Table 2)
Demographic, clinical and biochemical variables were
compared by genotypes of both PAI-1 polymorphisms
according to a dominant genetic model For the -844 G/
A polymorphism the G/A and A/A genotypes were
grouped for this genetic model, the -844 G/A + A/A
group showed a high prevalence of obesity (60%; p =
0.01), an increase in thickness of the biceps (16 mm; p =
0.05), triceps (16 mm; p = 0.01) and subscapular skinfolds
(15 mm; p = 0.03) and arm circumference (22 cm; p =
0.04), as well as decrease in HDL levels (39 mg/dL; p = 0.04) in comparison with G/G group (Table 3) To esti-mate in all children, the association of -844 G/A + A/A genotypes with demographic, clinical and biochemical variables that showed significant differences or tenden-cies, we used logistic regression models adjusted by age and gender The -844 G/A + A/A genotypes were asso-ciated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42;
p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01) (Table 4) However, we did not find a relationship with biceps, triceps and subscapular skinfolds as well as arm circumference (data no shown)
For the HindIII C/G polymorphism, when the C/G and G/G genotypes were grouped, the C/G + G/G group showed only an increase in plasma total cholesterol levels (179 mg/dL; p = 0.02) in comparison with C/C group (165 mg/dL)
Discussion
This study shows the association of two polymorphisms
in the PAI-1 gene with the development of MetS and its
Table 1 Genotype and allele frequencies of -844 and HindIII PAI-1 polymorphisms in cases and controls
syndrome
% (n = 48)
Metabolically healthy
% (n = 52)
-844 G/A PAI-1
Genotype
Allele
Genetic model
Do
HindIII C/G PAI-1
Genotype
Allele
Genetic model
Do
*Chi square test c 2
; OR = odds ratio; CI = confidence interval; Do = dominant model
§
Trang 5components such as obesity and atherogenic
dyslipide-mia in a Mexican children population
Regarding the distribution of genotype and allele
fre-quencies of both polymorphisms, for the HindIII C/G
polymorphism we found a high frequency of C allele,
simi-lar to previous reports in Mexican mestizo population and
Caucasian population, however the G allele frequency was
lower in Mexican population [18,21,29] On the other
hand, the -844 G/A polymorphism we observed that is
dis-tributed inversely to those reported in Caucasian
popula-tions, in which the A allele is more frequent than the G
allele [12,18,19] In our study this polymorphism had a
high frequency of G allele and a lower frequency of A
allele, consistent with already reported frequencies in
pre-vious studies in Mexican mestizo population [20,30],
sug-gesting that in the Mexican population there is a high
frequency of allele G
According to our results, the differences observed in
the distribution of -844 G/A polymorphism may be
attributed to the racial influence, which is central to the
heterogeneous distribution of genetic polymorphisms It
is known that the Mexican population originated from a
mixture of European (4.2 to 70.8%) and African (0.9 to 40.5%) populations with Amerindian groups (27.6 to 94.5%), giving origin to the Mexican mestizo population, which has a higher genetic diversity in the distribution
of this and other polymorphisms [31] This can explain the differences in the distribution of genotypic and alle-lic frequencies of our population with other populations
in the world
As an important finding, in our study we found signifi-cant differences in the distribution of genotype and allele frequencies of -844 G/A polymorphism in both groups, determining an OR of 2.2 for A allele, and an OR of 2.79 for G/A genotype, which indicates that children who carry the A allele are 2.2 fold more susceptible to develop MetS and children who are carriers of the G/A genotype have a 2.79 fold increased risk of developing the syn-drome, compared to those who are carriers of G allele and G/G genotype These results obtained in our study are similar to those reported in a previous study done in Caucasian population in which A/A genotype was asso-ciated with the susceptibility of developing MetS (OR, 4.87; p < 0.001) [12] These consistent results reported in different populations may be due to the effect of the polymorphism on the levels of the protein, since it has been reported that the base change of G to A at position -844 of the promoter PAI-1 gene generates a binding site consensus sequence for Ets nuclear protein, which could
be involved in regulating gene expression and influencing the increase in PAI-1 plasma protein levels [32,33] While for the HindIII C/G polymorphism not significant differences were found in genotype and allele distribu-tion, but it has been reported that the base change of C
to G at the 3’ UTR of PAI-1 gene might plays an impor-tant role in the disruption of the translational regulation process and cause changes in the translational levels of messenger ribonucleic acid (mRNA) in both physiological and pathological conditions, resulting in an increase in PAI-1 plasma protein levels [34]
We described for first time in Mexican children that -844 G/A polymorphism contribute to a significant increase in subcutaneous fat, increasing the risk of devel-oping obesity (OR, 2.6; p = 0.01) in children who are car-riers of the G/A and A/A genotypes A possible explanation for this finding could be that the -844 G/A polymorphism contribute to the large amount of PAI-1 produced by adipose tissue expansion, as well as the increase of obesity Studies of PAI-1 knockout mice have shown an effect of PAI-1 on weight gain and increased adipose cellularity associated with high-fat dieting [35] Besides, studies in which the PAI-1 gene was disrupted in ob/ob mice show a reduction of adiposity in these mice This suggests that PAI-1 gene can control fat mass, although the mechanism of action is not yet known, may
be PAI-1 gene can control fat mass at least in part, by
Table 2 General characteristics by gender in all children
Gender
n = 48
Girls
n = 52
p value
Circumferences
Skinfolds
Biochemical measurements
Triglycerides (mg/dL)c 101(36-204) 102 (38-200) 0.8
a) Data provided in n and percentages Chi square test; b) Data provided in
means ± SD Student’s t test; c) Data provided in median and percentile 5-95.
Mann-Whitney test
Trang 6Table 3 General characteristics according PAI-1 polymorphism following a dominant genetic model
n = 53
G/A + A/A
n = 47
n = 57
C/G + G/G
n = 43
p value
Circumferences
Skinfolds
Biochemical measurements
Insulin ( μU/mL) c
a) Data provided in n and percentages Chi square test; b) Data provided in means ± SD Student’s t test; c) Data provided in median and percentile 5-95 Mann-Whitney test
Table 4 Association of G/A + A/A genotypes of -844 PAI-1 polymorphism with obesity and lipid levels
-844 PAI-1
Genotypes
value
< 95thpercentile % (n = 58) ≥ 95 th
percentile % (n = 42)
Plasma triglycerides levels
< 150 mg/dL % (n = 61) > 150 mg/dL % (n = 39)
Plasma HDL-cholesterol levels
> 40 mg/dL % (n = 58) < 40 mg/dL % (n = 42)
*Chi square test, §
Reference category, OR = odds ratio, CI = confidence interval
Trang 7inducing the proliferation of adipocytes through the effect
on the expression of genes such as tumour necrosis factor
alpha (TNF-a) and transforming growth factor beta
(TGF-b), leptin and insulin [36]
In addition the effect on the increase in adipose tissue,
there was an association of G/A and A/A genotypes of
-844 G/A polymorphism with increased triglyceride
levels and decreased HDL-C levels, which indicates that
those children who are carriers of these genotypes, have
an increase in the risk to develop atherogenic
dyslipide-mia compared with genotype G/G In the case of HindIII
C/G polymorphism, C/G and G/G genotypes were
asso-ciated with a raise of total cholesterol explaining 8% of
the variability of their plasma concentration, influencing
along with -844 G/A polymorphism to the development
of atherogenic profile that characterizes the MetS It has
been reported that a very-low-density lipoprotein
(VLDL)-responsive element in the PAI-1 promoter could
be responsible for the effect of plasma lipids on PAI-1
expression [14] Therefore, the increase in PAI-1 levels
may contribute to the development of obesity and
atherogenic dyslipidemia, and PAI-1 may be a causal link
between obesity and cardiovascular disease
The -844 G/A and HindIII C/G PAI-1 single nucleotide
polymorphisms have not been associated with PAI-1
levels Several adult studies showed that an increase in the
level of PAI-1 was related to the genotype PAI-1 4 G/5 G
polymorphism [37,38] However, in children some
infor-mation is available on the influence of the 4 G/5 G
poly-morphism on PAI-1 levels or with others obesity-related
phenotypes In Children with obesity, Estelles et al [39]
observed no influence of the 4 G/5 G polymorphism on
PAI-1 levels Moreover, no influence of the PAI-1 4 G/5 G
polymorphism on lipid and glucose metabolism
para-meters was observed in Turkish obese children [40,41]
A limitation of this study is the small number of sample,
even though is a sample with children that were recruited
with precise selection criteria and the control group did
not have any of the components included in the definition
of MetS In addition, few studies of genetic association of
PAI-1 gene with MetS have been conducted in children
Other limitation of this study is that lack of replication,
the replication of genetic associations in independent
populations is essential to reduce the number of
false-positive results and to further define the role of these
var-iants in the susceptibility to complex disease as MetS
Although our study found an association of -844 G/A
polymorphism with the MetS and its components such
as obesity and a atherogenic dyslipidemia characterized
by hypertriglyceridemia and low HDL-cholesterol, and
the HindIII C/G polymorphism with increased plasma
levels of total cholesterol, other of the limitations is that
PAI-1 plasma levels were not measured; therefore the
association of -844 G/A and HindIII C/G polymorphisms
with PAI-1 levels remains uncertain in our population Therefore it is necessary to determine PAI-1 plasma levels in future studies in Mexican children
Conclusions
In summary, this study provide evidence that the -844 G/
A PAI-1 polymorphism is related with the risk of develop-ing MetS, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism is associated with increased total cholesterol levels, which contributes to the pathogenesis of MetS
Abbreviations MetS: metabolic syndrome; PAI-1: plasminogen activator inhibitor-1; PAS: plasminogen activation system; Pas: physiological plasminogen activators; HDL: high density lipoprotein; 3 ’UTR: 3’untranslated region; BP: blood pressure; SBP: systolic blood pressure; DBP: diastolic blood pressure; LDL: low density lipoprotein; HOMA-IR: homeostasis model assessment of insulin resistance; gDNA: genomic DNA; PCR-RFLP: polymerase chain reaction-restriction fragment length polymorphism
Acknowledgements This work was supported by grants from PROMEP-SEP (UAGRO-EXB-057) and FOMIX-CONACYT-Gobierno del Estado de Guerrero 2010-01 (No 147778) Author details
1
Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma
de Guerrero, Avenida Lázaro Cárdenas S/N, Ciudad Universitaria, Chilpancingo, Guerrero CP 39090, Mexico.2Grupo de Inmunogenética Funcional, Departamento de Biología Molecular y Genómica, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara, Jalisco, Mexico.
Authors ’ contributions IPR conceived and organized the study and prepared the manuscript UDCM performed the genotyping and participated in the statistical analysis, interpreted the data and wrote the manuscript LSG and AGC were responsible for patient enrollment and participated in the genetic analysis JFMV, BIA and ECS participated in the design of the study, contributed interpreting the data and revising successive drafts of the manuscript All authors read and approved the final manuscript.
Competing interests The authors declare that they have no competing interests.
Received: 22 July 2011 Accepted: 29 March 2012 Published: 29 March 2012
References
1 Huang PL: A comprehensive definition for metabolic syndrome Dis Model Mech 2009, 2:231-237.
2 Taslim S, Tai ES: The relevance of the metabolic syndrome Ann Acad Med Singap 2009, 38:29-25.
3 Alberti KGMM, Zimmet P, Shaw J: Metabolic syndrome –a new world-wide definition A Consensus Statement from the International Diabetes Federation Diabet Med 2006, 23:469-480.
4 Bruce KD, Byrne CD: The metabolic syndrome: common origins of a multifactorial disorder Postgrad Med J 2009, 85:614-621.
5 Hamsten A, de Faire U, Walldius G, Dahlén G, Szamosi A, Landou C, Blombäck M, Wiman B: Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction Lancet 1987, 2:3-9.
6 Juhan-Vague I, Thompson SG, Jespersen J: Involvement of the hemostatic system in the insulin resistance syndrome A study of 1500 patients with angina pectoris The ECAT Angina Pectoris Study Group Arterioscler Thromb 1993, 13:1865-1873.
Trang 87 Aso Y: Plasminogen activator inhibitor (PAI)-1 in vascular inflammation
and thrombosis Front Biosci 2007, 12:2957-2966.
8 Schneiderman J, Sawdey MS, Keeton MR, Bordin GM, Bernstein EF, Dilley RB,
Loskutoff DJ: Increased type 1 plasminogen activator inhibitor gene
expression in atherosclerotic human arteries Proc Natl Acad Sci USA 1992,
89:6998-7002.
9 Sobel BE: Increased plasminogen activator inhibitor-1 and vasculopathy.
A reconcilable paradox Circulation 1999, 99:2496-2498.
10 Morange PE, Lijnen HR, Alessi MC, Kopp F, Collen D, Juhan-Vague I:
Influence of PAI-1 on adipose tissue growth and metabolic parameters
in a murine model of diet-induced obesity Arterioscler Thromb Vasc Biol
2000, 20:1150-1154.
11 Naran NH, Chetty N, Crowther NJ: The influence of metabolic syndrome
components on plasma PAI-1 concentrations is modified by the PAI-1 4
G/5G genotype and ethnicity Atherosclerosis 2008, 196:155-163.
12 Bouchard L, Vohl MC, Lebel S, Hould FS, Marceau P, Bergeron J, Pérusse L,
Mauriège P: Contribution of genetic and metabolic syndrome to omental
adipose tissue PAI-1 gene mRNA and plasma levels in obesity Obes Surg
2010, 20:492-499.
13 Ha H, Oh EY, Lee HB: The role of plasminogen activator inhibitor 1 in
renal and cardiovascular diseases Nat Rev Nephrol 2009, 5:203-211.
14 Binder BR, Christ G, Gruber F, Grubic N, Hufnagl P, Krebs M, Mihaly J,
Prager GW: Plasminogen activator inhibitor 1: physiological and
pathophysiological roles News Physiol Sci 2002, 17:56-61.
15 Ma Z, Paek D, Oh CK: Plasminogen activator inhibitor-1 and asthma: role
in the pathogenesis and molecular regulation Clin Exp Allergy 2009,
39:1136-1144.
16 Arya R, Blangero J, Williams K, Almasy L, Dyer TD, Leach RJ, O ’Connell P,
Stern MP, Duggirala R: Factors of insulin resistance syndrome-related
phenotypes are linked to genetic locations on chromosomes 6 and 7 in
nondiabetic mexican-americans Diabetes 2002, 51:841-847.
17 Duggirala R, Blangero J, Almasy L, Dyer TD, Williams KL, Leach RJ,
O ’Connell P, Stern MP: A major susceptibility locus influencing plasma
triglyceride concentrations is located on chromosome 15q in Mexican
Americans Am J Hum Genet 2000, 66:1237-1245.
18 Adamski MG, Turaj W, Slowik A, Wloch-Kopec D, Wolkow P, Szczudlik A:
A-G-4 G haplotype of PAI-1 gene polymorphisms -844 G/A, HindIII G/C,
and -675 4 G/5G is associated with increased risk of ischemic stroke
caused by small vessel disease Acta Neurol Scand 2009, 120:94-100.
19 Lopes C, Dina C, Durand E, Froguel P: PAI-1 polymorphisms modulate
phenotypes associated with the metabolic syndrome in obese and
diabetic Caucasian population Diabetologia 2003, 46:1284-1290.
20 Torres-Carrillo NM, Torres-Carrillo N, Vázquez-Del Mercado M,
Delgado-Rizo V, Oregón-Romero E, Parra-Rojas I, Muñoz-Valle JF: The -844 G/A PAI-1
polymorphism is associated with mRNA expression in rheumatoid
arthritis Rheumatol Int 2008, 28:355-360.
21 Padilla-Gutiérrez JR, Palafox-Sánchez CA, Valle Y, Orozco-Barocio G,
Oregón-Romero E, Vázquez-Del Mercado M, Rangel-Villalobos H,
Llamas-Covarrubias MA, Muñoz-Valle JF: Plasminogen activator inhibitor-1
polymorphisms (-844 G > A and HindIII C > G) in systemic lupus
erythematosus: association with clinical variables Clin Exp Med 2011,
11:11-17.
22 Dawson S, Hamsten A, Wiman B, Henney A, Humphries S: Genetic
variation at the plasminogen activator inhibitor-1 locus is associated
with altered levels of plasma plasminogen activator inhibitor-1 activity.
Arterioscler Thromb 1991, 11:183-190.
23 National High Blood Pressure Education Program Working Group on High
Blood Pressure in Children and Adolescents: The fourth report on the
diagnosis, evaluation, and treatment of high blood pressure in children
and adolescents Pediatrics 2004, 114:555-576.
24 Centers for Disease Control and Prevention, National Center for Health
Statistics: Clinical Growth Charts [http://www.cdc.gov/growthcharts/
clinical_charts.htm].
25 Zimmet P, Alberti G, Kaufman F, Tajima N, Arslanian S, Wong G, Bennett P,
Shaw J, Caprio S: International diabetes federation task force on
epidemiology and prevention of diabetes: the metabolic syndrome in
children and adolescents Lancet 2007, 369:2059-2061.
26 Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for
extracting DNA from human nucleated cells Nucleic Acids Res 1988,
16:1215.
27 Henry M, Chomiki N, Scarabin PY, Alessi MC, Peiretti F, Arveiler D, Ferrières J, Evans A, Amouyel P, Poirier O, Cambien F, Juhan-Vague I: Five frequent polymorphisms of the PAI-1 gene: lack of association between genotypes, PAI activity, and triglyceride levels in a healthy population Arterioscler Thromb Vasc Biol 1997, 17:851-858.
28 Grenett HE, Khan N, Jiang W, Booyse FM: Identification of the Hind III polymorphic site in the PAI-1 gene: analysis of the PAI-1 Hind III polymorphism by PCR Genet Test 2000, 4:65-68.
29 Benza RL, Grenett H, Li XN, Reeder VC, Brown SL, Go RC, Hanson KA, Perry GJ, Holman WL, McGiffin DC, Kirk KA, Booyse FM: Gene Polymorphisms for PAI-1 Are Associated with the Angiographic Extent
of Coronary Artery Disease J Thromb Thrombolysis 1998, 5:143-150.
30 Torres-Carrillo N, Magdalena Torres-Carrillo N, Vázquez-Del Mercado M, Rangel-Villalobos H, Parra-Rojas I, Sánchez-Enríquez S, Francisco Muñoz-Valle J: Distribution of -844 G/A and Hind III C/G PAI-1 polymorphisms and plasma PAI-1 levels in Mexican subjects: comparison of frequencies between populations Clin Appl Thromb Hemost 2008, 14:220-226.
31 Rubi-Castellanos R, Martínez-Cortés G, Muñoz-Valle JF, González-Martín A, Cerda-Flores RM, Anaya-Palafox M, Rangel-Villalobos H: Pre-Hispanic Mesoamerican demography approximates the present-day ancestry of Mestizos throughout the territory of Mexico Am J Phys Anthropol 2009, 139:284-294.
32 Grubic N, Stegnar M, Peternel P, Kaider A, Binder BR: A novel G/A and the
4 G/5G polymorphism within the promoter of the plasminogen activator inhibitor-1 gene in patients with deep vein thrombosis Thromb Res 1996, 84:431-443.
33 Henry M, Chomiki N, Scarabin PY, Alessi MC, Peiretti F, Arveiler D, Ferrières J, Evans A, Amouyel P, Poirier O, Cambien F, Juhan-Vague I: Five frequent polymorphisms of the PAI-1 gene: lack of association between genotypes, PAI activity, and triglyceride levels in a healthy population Arterioscler Thromb Vasc Biol 1997, 17:851-858.
34 Torres-Carrillo N, Torres-Carrillo NM, Martínez-Bonilla GE, Vázquez-Del Mercado M, Palafox-Sánchez CA, Oregón-Romero E, Bernard-Medina AG, Rangel-Villalobos H, Muñoz-Valle JF: Plasminogen activator inhibitor-1 C/G polymorphism in relation to plasma levels in rheumatoid arthritis Clin Exp Med 2009, 9:223-228.
35 Morange PE, Lijnen HR, Alessi MC, Kopp F, Collen D, Juhan-Vague I: Influence of PAI-1 on adipose tissue growth and metabolic parameters
in a murine model of diet-induced obesity Arterioscler Thromb Vasc Biol
2000, 20:1150-1154.
36 Schäfer K, Fujisawa K, Konstantinides S, Loskutoff DJ: Disruption of the plasminogen activator inhibitor 1 gene reduces the adiposity and improves the metabolic profile of genetically obese and diabetic ob/ob mice FASEB J 2001, 15:1840-1842.
37 Hoffstedt J, Andersson LL, Persson L, Isaksson B, Arner P: The common -675 4 G/5G polymorphism in the plasminogen activator inhibitor-1 gene is strongly associated with obesity Diabetologia 2002, 45:584-587.
38 Sartori MT, Vettor R, De Pergola G, De Mitrio V, Saggiorato G, Della Mea PD, Patrassi GM, Lombardi AM, Fabris R, Girolami A: Role of the 4 G/5G polymorphism of PAI-1 gene promoter on PAI-1 levels in obese patients: influence of fat distribution and insulin-resistance Thromb Haemost 2001, 86:1161-1169.
39 Estelles A, Dalmau J, Falco C, Berbel O, Castello R, Espana F, Aznar J: Plasma 1 levels in obese children-effect of weight loss and influence of
PAI-1 promoter 4 G/5G genotype Thromb Haemost 200PAI-1, 86:647-652.
40 Kinik ST, Ataç FB, Verdi H, Cetinta ş S, Sahin FI, Ozbek N: The effect of plasminogen activator inhibitor-1 gene 4 G/5G polymorphism on glucose and lipid metabolisms in Turkish obese children Clin Endocrinol
2005, 62:607-610.
41 Kinik ST, Ozbek N, Yuce M, Yazici AC, Verdi H, Ataç FB: PAI-1 gene 4 G/5G polymorphism, cytokine levels and their relations with metabolic parameters in obese children Thromb Haemost 2008, 99:352-356 Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1471-2431/12/41/prepub
doi:10.1186/1471-2431-12-41 Cite this article as: De la Cruz-Mosso et al.: Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children BMC Pediatrics 2012 12:41.