Báo cáo y học: "Emulsified Isoflurane Preconditioning Reduces Lung Injury Induced By Hepatic Ischemia/Reperfusion in Rats"

Báo cáo y học: "Emulsified Isoflurane Preconditioning Reduces Lung Injury Induced By Hepatic Ischemia/Reperfusion in Rats"

International Journal of Medical Sciences

2011; 8(5):353-361 Research Paper

Emulsified Isoflurane Preconditioning Reduces Lung Injury Induced By Hepatic Ischemia/Reperfusion in Rats

Xin Lv1,2 *, Zhen-meng Wang1 *, Sheng-dong Huang3, Shao-hua Song4, Fei-xiang Wu1, Wei-feng Yu 1 

1 Department of Anaesthesia and Intensive Care, Eastern Hepatobiliary Surgery Hospital, Second Military Medical Uni-versity, Shanghai, China

2 Department of Anesthesiology, Shanghai Pneumology Hospital, Tongji University School of Medicine, Shanghai, China

3 Department of Cardiothoracic surgery, Changhai Hospital, Second Military Medical University, Shanghai, China

4 Organ Transplantation Center, Changzheng Hospital, Second Military Medical University, Shanghai, China

* The first two authors contributed equally to this work

 Corresponding author: Wei-Feng Yu, Prof., Department of Anesthesia and Intensive Care, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, 225# Changhai Road, Shanghai 200438, China Telephone and Fax: +86-21-81875231 E-mail: ywf808@sohu.com

© Ivyspring International Publisher This is an open-access article distributed under the terms of the Creative Commons License (http://creativecommons.org/ licenses/by-nc-nd/3.0/) Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited.

Received: 2010.12.27; Accepted: 2011.04.11; Published: 2011.06.08

Abstract

Objective: To investigate whether emulsified isoflurane preconditioning could reduce

lung injury induced by hepatic I/R in rats and its mechanism

Materials and methods: 32 pentobarbital-anesthetized Sprague-Dawley rats were equally

randomized into four groups: laparotomy group (Sham group), hepatic I/R and normal

saline infusion group (I/R+S group), I/R and lipid vehicle infusion (I/R+V group), or

I/R and 8% emulsified isoflurane infusion (I/R+E group) at the rate of 8 ml·kg-1·h-1 for 30

min Blood supply of the hepatic artery and portal vein to the left and the median liver

lobes was occluded for 90 min after 30-min washout time Reperfusion was allowed to

proceed for 4 h before sacrifice of the animals Lung injury was observed histologically

Neutrophil infiltration and TNF-α concentration in serum and lung were measured

Changes of wet-to-dry weight ratios in lung tissue, ICAM-1 expression and NF-κB

activ-ity in lung after hepatic I/R were determined

Results: Compared with I/R+S or I/R+V group, emulsified isoflurane preconditioning

reduced hepatic I/R-induced lung histologic injury and inhibited the increase of

myeloperoxidase (MPO) activity in the lung tissue markedly (5.5±1.37 and 5.22±1.33 vs

3.81±1.62 U/g, P<0.05) In addition, both serum and lung tissue TNF-α levels were

re-duced in I/R+E group (104.58±31.40 and 94.60±22.23 vs 72.44±17.28 pg/ml, P<0.05;

393.51±88.22 and 405.46±102.87 vs 292.62±74.56 pg/ml, P<0.01) Emulsified isoflurane

preconditioning also inhibited the increase of ICAM-1 expression (0.79±0.17 and

0.84±0.24 vs 0.62±0.21, P<0.05) and NF-κB translocation (4.93±0.48 and 4.76±0.57 vs

4.01±0.86, P<0.05) in the lung tissue markedly

Conclusions: Emulsified isoflurane preconditioning markedly attenuated hepatic

I/R-induced lung injury in rats, which may be hopefully applied to the clinical treatment

of organ injury caused by hepatic surgery, transplantation or hemorrhagic shock

Key words: emulsified isoflurane; inflammation; intercellular adhesion molecule-1; neutrophils;

nuclear factor-κB; rats; tumor necrosis factor-α

International Publisher

Int J Med Sci 2011, 8 354

Introduction

Ischemia/reperfusion (IR) injury represents a

complex series of events, including release of reactive

oxygen species, nitric oxide imbalance, cytokine

cas-cades, neutrophil accumulation and cell death,

re-sulting in cellular and tissue damage1 Hepatic I/R

injury, which can been seen in various clinical settings

such as liver transplantation, hepatectomy, and

hem-orrhagic shock, may lead to local and remote organ

damage2, yet the precise pathogenesis is not fully

de-fined Massive accumulation of neutrophils in the

lung, the development of interstitial pulmonary

ede-ma and increased expression of proinflamede-matory

mediators are major features of lung injury induced

by hepatic I/R

Various methods, including pharmacological

treatment, gene therapy and ischemia

precondition-ing, have been applied to ameliorate hepatic I/R

in-jury, with inspiring results In 1986, Murry et al3

demonstrated for the first time that intermittent

epi-sodes of ischemia had a protective effect on the

myo-cardium that was later subjected to a sustained bout

of ischemia A characteristic of ischemic

precondi-tioning is a cross-tolerance phenomenon The efficacy

of anesthetic preconditioning was first described in

1997 with isoflurane in animals4,5, and later confirmed

by several studies in the brain6, kidney7 and liver8

Inhaled isoflurane preconditioning was also shown to

reduce acute lung injury and inflammation induced

by endotoxin9,10 or I/R11

Emulsified isoflurane has been widely studied in

recent years, because it was found to eliminate the

need for specific ventilatory circuits, provide rapid

anesthetic induction and recovery, have remarkable

hemodynamic stability12 and reduce environmental

pollution and tissue toxicity Rao et al13 demonstrated

that emulsified isoflurane had a myocardial protective

effect on I/R injury similar to that of inhaled

isoflu-rane We therefore hypothesized that emulsified

isoflurane preconditioning might also be able to

in-hibit inflammation reaction and reduce lung injury

induced by hepatic I/R in rats

Materials and methods

Inbred male Sprague-Dawley rats weighing

200-250 g (Experimental Animal Center of the Second

Military Medical University, Shanghai, China) were

maintained in laminar flow cages in a specific

patho-gen free animal facility, and allowed free access to

standard laboratory chow and water before

experi-ments This study was approved by the animal care

committee at the Second Military Medical University

and all procedures in this experiment were performed

according to the Guide for the Care and Use of La-boratory Animals

Surgical procedures of hepatic I/R

A model of segmental (70%) hepatic ischemia was used as previously described14,15 Rats were anesthetized intraperitoneally with pentobarbital (40 mg/kg) Body temperature was monitored by a rectal probe and maintained at around 37℃ by a heating lamp The right carotid artery was cannulated for ar-terial blood monitoring and blood-gas analysis, and the right jugular vein was cannulated for drug infu-sion and blood sampling A midline laparotomy was performed, and an atraumatic clip was applied to interrupt the arterial and portal venous blood supply

to the left and median lobes of the liver The clip was removed 90 min after partial hepatic ischemia to ini-tiate hepatic reperfusion Sham control rats under-went the same protocol without vascular occlusion Oxygen was not given during the surgery and throughout the experimental period Rats were killed after 4-h reperfusion, and lung tissues and blood samples were collected for analysis

Preparation of emulsified isoflurane

The 8% emulsified isoflurane (v/v) manuftured by Huarui Pharmacy, Ltd (Wuxi, China) ac-cording to the procedures described previously16,17, was kindly bestowed by Prof Jin Liu from the Labor-atory of Anesthesiology and Critical Care Medicine, West China Hospital, Sichuan University (Chengdu, China) Briefly, 1.6 mL liquid isoflurane and 18.4 mL 30% Intralipid® (fat emulsion injection, Sino-Swed Pharmaceutical Corp LTD, China) was mixed in a 20-mL glass ampoule and sealed using an alcohol blowtorch The ampoule was then vigorously shaken

on a vibrator for 15 min to solubilize isoflurane into a lipid emulsion The emulsified isoflurane ampoule was opened just before use and the residual drug was discarded Before this experiment, the stability of 8% emulsified isoflurane was investigated by gas chro-matography There was no change in isoflurane con-centration nor were lipid droplets found during 6 months of storage at room temperature

Experimental Design

Group 1 Sham (n=8): animals were subjected to anesthesia and laparotomy

Group 2 I/R+S (n=8): animals were infused with normal saline through the right external jugular vein

at the rate of 8 ml·kg-1·h-1 for 30 min, and then sub-jected to 70% hepatic ischemia for 90 min, followed by 4-h reperfusion

Group 3 I/R + V (n=8): animals were infused

with lipid vehicle (Intralipid®, 30%) through the right

external jugular vein at the rate of 8 ml·kg-1·h-1 for 30

min, followed by a 30-min wash-out period before

I/R

Group 4 I/R + E (n=8): animals were infused

with emulsified isoflurane through the right external

jugular vein at the rate of 8 ml·kg-1·h-1 for 30 min as

Rao described13, followed by a 30-min wash-out

pe-riod before I/R

Lung Function

Before sacrifice of the animals, arterial blood was

sampled from the right carotid artery for blood gas

analysis with a blood-gas analyzer (GEM Premier

3000, Instrumentation Laboratory, USA)

Histology

The middle lobe of the right lung was excised for

histopathology Samples were fixed in 10% neutral

buffered formalin, paraffin embedded, sliced into

5-µm sections, stained with hematoxylin-eosin (H&E)

according to standard procedures, and evaluated by

light-microscopic examination

Pulmonary edema

The extent of lung edema was measured by

tis-sue wet to dry weight ratios The lower lobe of the

right lung from each animal was harvested, blotted

dry, weighed, incubated at 60℃ overnight and

re-weighed18 The wet to dry weight ratio was calculated

by dividing the wet by the dry weight

Myeloperoxidase assay

Myeloperoxidase (MPO), a marker of pulmonary

neutrophil accumulation and activation, was

deter-mined by a modified method of Welborn et al19

Briefly, frozen lung sample (200mg) was

homoge-nized in 0.01 M KH2PO4 at a ratio of 1:10 weight for

volume The pellets were resuspended in 0.5 mL of

C-TAB (cetyltrimethylammoniumbromide) buffer

The samples were homogenized, sonicated for 45 s,

and subjected to one freeze-thaw cycle MPO was

assayed in the supernatant with the H2O2-dependent

oxidation of 3,3’,5,5’-tetramethylbenzidine

Absorb-ance was read at 650 nm and compared with a linear

standard curve with sensitivity to 0.008 U Values

were then divided by the wet weight of the lung

tis-sue

Lung tissue and serum tumor necrosis factor-α

(TNF-α) Assay

Frozen lung tissue was homogenized in 10

volumes of 50 mmol/L phosphate buffer (pH 6.0)

After centrifugation at 4,000g, the supernatant was

frozen at -20℃ and saved for measurement of TNF-α level 2 ml blood obtained from the right jugular vein was centrifuged at 3,000g to get serum, which was saved at -20℃ for measurement of TNF-α levels Lung tissue and serum TNF-α levels were measured using a commercial rat TNF-α ELISA kit (R&D Systems, USA)

RT-PCR analysis of intercellular adhesion mole-cule-1 (ICAM-1) mRNA expression in the lung

ICAM-1 mRNA from frozen lung tissues was measured using semi-quantitative RT-PCR Total RNA was extracted from the tissue sample using the Trizol reagent (Invitrogen, Life Technologies) ac-cording to the manufacturer’s protocol The RNA concentration was determined by ultraviolet light absorbance at a wavelength of 260nm The first-strand complementary DNA (cDNA) was synthesized using oligo-dT primer and the AMV reverse transcriptase The cDNA products were amplified in 50μl reaction volume containing 50 pmol of each primer, 1μl of the cDNA reaction mix, 5μl Buffer (10 mmol/L), 1μl of

each dNTP (10mmol/L), and 3 units of Taq DNA

polymerase (GIBCO Life Technologies) After 5-min initial melting at 95℃, the mixture was amplified for a total of 30 cycles with a three-step cycle process that began with melting at 95℃ for 45 s, annealing at 60℃ for 30 s, and extension at 72℃ for 45 s The final cycle was followed by 5-min soaking at 72℃ The nucleo-tide sequences of the PCR primers were 5'- CTTCAAGCTGAGCGACATTGG -3' (forward) and 5'- AGCATGAGAAATTGGCTCCGT -3' (reverse) for ICAM-1 and 5'- ACCACAGTCCATGCCATCAC -3' (forward) and 5'- TCCACCACCCTGTTGCTGTA -3' (reverse) for GAPDH The expected size of the ampli-fied cDNA fragments of ICAM-1 and GAPDH was

326 and 452 bp, respectively Ten microliters of each RT-PCR were electrophoresed in a 1.5% agarose gel and stained with ethidium bromide The intensity of each ICAM-1 mRNA band was quantified by densi-tometry using a gel documentation and analysis sys-tem and normalized to values for GAPDH

Western blot analysis for nuclear factor-B (NF-B) activity

Nuclear proteins were prepared from lung tis-sues according to the modified protocols of previ-ously studies20,21 Briefly, frozen liver tissues were homogenized in cold buffer A containing 10mM HEPES-KOH, 1.5mM MgCl2, 10mM KCl, 1mM phe-nylmenthysulfonylfluoride (PMSF), 1mM dithio-threitol(DTT) and 0.1mM EDTA The homogenate was centrifuged at 450g for 1 min at 4℃ The super-natant was collected and incubated on ice for 30 min,

Int J Med Sci 2011, 8 356

vortexed for 30 s after addition of 10% NP-40, then

centrifuged at 5,000g for 3 min at 4℃ The pellet

(nu-clei) was resuspended in cold buffer B containing

20mM HEPES-KOH, 25% glycerol, 420mM NaCl,

1.5mM MgCl2, 1mM PMSF, 1mM DTT, and 0.1mM

EDTA, and incubated for 30 min with intermittent

stirring The suspension was centrifuged at 15,000g

for 10min at 4℃, and the protein concentration was

determined by Coomassie blue dye-binding assay An

equal amount of protein was mixed with the sample

buffer, separated by 10% SDS-PAGE, and transferred

to nitrocellulose membranes The membrane was

blocked for 1 h at room temperature with blocking

solution (3% nonfat milk in Tris buffered saline with

Tween 20) Blots were then incubated overnight at 4℃

with mouse monoclonal anti-NF-B p65 antibody

(Santa Cruz Biotechnology, 1:500), washed three

times, and incubated with a horseradish

peroxi-dase-labeled secondary antibody for 1 h at room

temperature Immunoreactive proteins were

visual-ized with the use of enhanced chemiluminescence

detection (Pierce, USA) The protein band density was

quantified by densitometric techniques and expressed

as mean relative densitometric units

Statistical analysis

Data were expressed as mean ± SD The

statisti-cal analysis was carried out using SPSS 13.0 for

Win-dows All data were analyzed by ANOVA, followed

by the Student-Newman-Keuls test P<0.05 was con-sidered statistically significant

Results

Arterial blood gas analysis

Compared with sham group, the IR+S and IR+V group had significantly lower PaO2 and higher PaCO2

(P < 0.05) Preconditioning with emulsified isoflurane improved pulmonary function, as indicated with higher PaO2 and lower PaCO2, while pH, HCO2- and SpO2 in IR+S and IR+V groups were lower than those

in sham and IR+E groups, but the difference was not statistically significant (P>0.05, Table 1)

Table 1 Arterial blood gas analysis

sham 7.38±0.05 91.38±3.67 a 37.25±2.05 a 25.56±1.67 97.00±1.07 IR+S 7.33±0.03 80.50±6.78 44.38±3.81 22.70±2.99 95.50±1.69 IR+V 7.33±0.06 80.25±9.38 42.38±3.54 23.33±1.50 95.13±1.96 IR+E 7.39±0.03 89.13±6.51 a 37.25±3.96 a 25.20±2.07 96.63±1.19 Data are expressed as mean ± SD a p <0.05 vs I/R+S group or

I/R+V group

Lung histopathology after hepatic I/R

The effects of emulsified isoflurane precondi-tioning on the histopathological changes of the lungs

in rats with hepatic I/R are shown in Figure 1

Figure 1: Morphologic changes of the lung A, sham group: No histologic alteration was observed B, IR+S group: the

inflammatory process was observed as represented by infiltration of leukocytes into interstitial and alveolar spaces, edema and partial destruction of the pulmonary architecture C, IR+V group: Similar to IR+S group D, IR+E group: Lung pathology was attenuated to a great extent Original magnification: ×400

Blind analysis was performed on all samples to

evaluate pulmonary architecture, tissue edema

for-mation and infiltration of the inflammatory cells The

results were classified into four grades where Grade 1

represented normal histopathology; Grade 2 mild

infiltration of neutrophilic leukocytes; Grade 3

mod-erate infiltration of neutrophilic leukocytes with

perivascular edema formation and partial destruction

of the pulmonary architecture and Grade 4 dense

in-filtration of neutrophilic leukocyte associated with

abcess formation and complete destruction of the

pulmonary architecture Pulmonary histology was

normal in sham group (Grade 1, Fig 1A) In contrast,

morphological study showed that the lung tissues in

the saline treated and fat vehicle treated groups were

severely damaged 90 min after hepatic ischemia and 4

h after reperfusion, as represented by marked

infil-tration of leukocytes into interstitial and alveolar

spaces, edema and partial destruction of the

pulmo-nary architecture (Grade 3, Fig 1B & 1C), while only

moderate lung edema, inflammatory cell infiltration

and thickening of the alveolar wall were seen in

emulsified isoflurane preconditioning group (Grade

2, Fig 1D), suggesting that lung injury induced by

hepatic I/R was attenuated by emulsified isoflurane

preconditioning

Figure 2: Lung tissue W/D weight ratio (n = 8)

Emul-sified isoflurane suppressed the increases of the lung

W/D ratio significantly, while no similar protective

ef-fect was observed in NS or lipid vehicle preconditioning

a p<0.01 vs sham group; b p <0.05 vs I/R+S group or I/R+V

group

Pulmonary edema after hepatic I/R

The lung W/D ratio (a parameter of pulmonary edema) increased significantly in the I/R+S, I/R+V and I/R+E groups compared with that in sham group (Fig 2) Emulsified isoflurane suppressed the in-creases of the lung W/D ratio significantly, while no similar protective effect was observed in NS or lipid vehicle preconditioning

Myeloperoxidase (MPO) activity after hepatic I/R

Neutrophil recruitment in the lung was assessed

by measuring tissue MPO content Lung tissue MPO was low in sham rats(1.41±0.51 U/g), but increased to 5.5±1.37, 5.22±1.33 and 3.81±1.62 U/g in I/R+S, I/R+V and I/R+E groups 4 h after hepatic reperfusion (P<0.01) MPO activity in I/R+E was significantly lower than that in I/R+S or I/R+V group (P<0.05, Fig 3)

Figure 3: Lung tissue MPO activity (n = 8) Lung tissue

MPO was low in sham rats and increased in I/R+S, I/R+V and I/R+E groups, while MPO activity in I/R+E was sig-nificantly lower than that in I/R+S or I/R+V group a

p<0.01 vs sham group; b p <0.05 vs I/R+S group or I/R+V

group

Lung Tissue and Serum TNF-α level after hepatic I/R

Compared with sham group, both serum and lung TNF-α levels increased significantly in I/R+S, I/R+V and I/R+E groups 4 h after reperfusion (P<0.05) Statistic analysis showed that both serum and lung TNF-α levels in I/R+E group were signifi-cantly lower than those of I/R+S or I/R+V group(P<0.05), and there was no significant difference between I/R+S and I/R+V groups (P>0.05, Fig 4)

Int J Med Sci 2011, 8 358

ICAM-1 mRNA expression in lung

RT-PCR analysis revealed that ICAM-1 mRNA

expression was hardly detectable in sham group

However, it was up-regulated markedly in the other

three groups (Fig 5) Compared with I/R+S or I/R+V

group, emulsified isoflurane preconditioning reduced

ICAM-1 mRNA expression significantly

NF-B activity in lung

A low level of p65 subunit of NF-B was ob-served in nuclear extracts of the lungs from sham group As expected, the nuclear localization of p65 increased markedly in I/R+S, I/R+V and I/R+E groups compared with sham group (Fig 6) As indi-cated by previous results, p65 expression was signif-icantly reduced by emulsified isoflurane precondi-tioning, but not by normal saline or lipid vehicle pre-conditioning (P<0.05)

Figure 4: Effects of emulsified isoflurane pretreatment on TNF-α levels in lung tissue and serum after hepatic I/R

in rats (n = 8) Compared with sham group, both serum and lung TNF-α levels increased significantly in I/R+S, I/R+V

and I/R+E groups Serum and lung TNF-α levels in I/R+E group were significantly lower than those of I/R+S or I/R+V group a p<0.01 vs sham group; b p <0.05 vs I/R+S group or I/R+V group

Figure 5: RT-PCR analysis of ICAM-1 mRNA

expression in the lung after hepatic I/R (n = 6)

ICAM-1 mRNA expression was increased markedly

in I/R+S, I/R+V and I/R+E groups Compared with

I/R+S or I/R+V group, emulsified isoflurane

preconditioning reduced ICAM-1 mRNA

expres-sion significantly a p<0.01 vs sham group; b p

<0.05 vs I/R+S group or I/R+V group

Figure 6: Effects of emulsified isoflurane pretreatment on NF-κB p65 translocation in the lung after hepatic I/R (n = 3) The top panel shows Western blot analysis for NF-kB p65 in nuclear protein extracts from the rat lung The

bottom panel shows relative densitometric units The average expression level of the sham group data was set to 1.0, and other data were adjusted to this baseline The nuclear localization of p65 increased markedly in I/R+S, I/R+V and I/R+E groups compared with sham group, but it was significantly reduced by emulsified isoflurane preconditioning a

p<0.01 vs sham group; b p <0.05 vs I/R+S group or I/R+V group

Discussion

Ischemia followed by reperfusion injury is

asso-ciated with a number of clinical disorders, including

systemic inflammatory response syndrome (SIRS),

multiple organ dysfunction syndrome (MODS) and

multiple system organ failure (MOSF) The lung is one

of the most important target organs in MODS or

MOSF caused by severe injury It was found that the

lung could also be damaged by remote organ injury

such as gut and liver I/R injury22 This process is

as-sociated with activation of inflammatory reaction,

including the increased activity of NF-κB and the

in-creased inflammatory mediators such as TNF-α and

ICAM-123

The results of our study showed that 90-min

hepatic ischemia followed by 4-h reperfusion induced

significant lung injury, as manifested by evidence of

lung edema, PMN infiltration and histological

inju-ries Moreover, lung injury was associated with

flammation, as indicated by NF-κB translocation,

in-crease of TNF-α levels and MPO activity, and

up-regulation of ICAM-1 expression in the lung

tis-sue

To our knowledge, this is the first study

providing the evidence that preconditioning with

emulsified isoflurane could attenuate inflammation reaction and ALI induced by hepatic I/R In the study

we used emulsified isoflurane infused at a rate of 8 ml·kg-1·h-1 for 30 min, knowing that this dosage had

no significant inhibitory effect on circulation in pen-tobarbital anesthetized rats as shown by previous experiments24 Our results showed that emulsified isoflurane preconditioning could reduce lung injury induced by hepatic I/R, as represented by decreased NF-κB activity, TNF-α level and MPO activity, and decreased ICAM-1 expression in the lung as well Neutrophils are an important component of the inflammatory response that characterizes ALI25 Ac-tivated neutrophils, which infiltrate the lungs during endotoxemia, produce cytokines, such as interleu-kin-1β and TNF-α, and play a key role in the devel-opment of ALI by releasing neutrophil proteases and reactive oxygen species26 Previous studies27-29 showed that isoflurane preconditioning could reduce neutro-phil accumulation in the myocardium, and that abol-ishing neutrophils would induce impairment to con-tractile function in rat hearts in vitro and in vivo This inhibitory effect of isoflurane on neutrophils was as-sociated with an inhibition on neutrophil superoxide production and adherence to coronary vascular en-dothelia In our study, emulsified isoflurane

precon-Int J Med Sci 2011, 8 360

ditioning significantly reduced neutrophil

accumula-tion in the lung, which may be associated with the

protective effect on the lung

Lung injury induced by hepatic I/R is thought of

as a result of liver-derived TNF-α In fact, blockade of

TNF-α by antibody neutralization greatly reduced

hepatic I/R induced lung inflammatory injury in

rats30 TNF-α can up-regulate neutrophil adhesion

molecules in the liver and remote organs, especially

intercellular adhesion molecule-1 (ICAM-1),

follow-ing hepatic I/R, which then plays an important role in

tissue neutrophil influx31

Some experiments suggested that ischemic

pre-conditioning was able to exhibit anti-inflammatory

and protective effect in some organs in vitro and in

vivo Isoflurane could down-regulate LPS-induced

production of pro-inflammatory cytokines, including

TNF-α and IL-1β in rats32 In this study animals were

pretreated with 1.4% isoflurane for 30 min before LPS

injection Notably, isoflurane inhalation was

associ-ated with a significant reduction of

endotoxe-mia-induced pulmonary TNF-α and IL-1β The

simi-lar protective effect was also observed in a rat model

of renal I/R injury33.Our results showed that

emulsi-fied isoflurane preconditioning reduced the serum

and lung TNF-α levels and ICAM-1 mRNA

expres-sion in lung tissue after hepatic I/R, which may be at

least partly contribute to reduced lung injury

After hepatic ischemia and reperfusion,

in-creased TNF-α level in the circulation initiates a

me-diator cascade in the lung, including neutrophil

infil-tration and increased pulmonary vascular expression

of intercellular adhesion molecule-1 The gene

ex-pression of these proinflammatory mediators is

con-trolled at least partly by the transcription factor

NF-B34

NF-B is a key transcription factors that plays a

key role in inflammatory response and is activated in

the lung after hepatic IR Activation of NF-B induced

expression of a variety of inflammation-related

products, including cytokines, chemokines, and

ad-hesion molecules35,36 Increased concentrations of

these inflammatory mediators may contribute to lung

injury Previous studies showed that sevoflurane

preconditioning and ischemia preconditioning

atten-uated NF-B activation and reduced the expression of

inflammatory mediators induced by I/R in the heart,

thus decreasing myocardial IR injury37 It was found

in the present study that emulsified isoflurane

pre-conditioning had a similar effect on NF-B

transloca-tion in the lung Emulsified isoflurane preconditransloca-tion-

precondition-ing suppressed the activity of NF-B significantly and

reduced the expression of inflammatory mediators

including TNF-α and ICAM-1, both of which contrib-ute to the lung injury after hepatic I/R

This study, together with previous reports, sug-gest that emulsified isoflurane preconditioning could ameliorate lung edema and neutrophil recruitment, decrease TNF-α level in serum and lung tissue, and down-regulate ICAM-1 by inhibiting activation of NF-B, which played a key role in inflammatory

re-sponse and is activated in the lung after hepatic IR

In conclusion, the present study demonstrated that emulsified isoflurane may also be protective in surgery- or trauma- related organ injuries occurring secondary to hepatic I/R Emulsified isoflurane re-duced lung injury inre-duced by hepatic I/R, as evi-denced by amelioration of lung edema and neutrophil recruitment, decreased TNF-α level in the lung tissue and down-regulation of ICAM-1 Zhang et al38 found that emulsified isoflurane preconditioning protected the liver and lung in a rat model of hemorrhagic shock, which might be due to inhibition of cell death and improvement of anti-oxidation in mitochondria Rao et al13 found that emulsified isoflurane precondi-tioning reduced myocardial infarct size, plasma lac-tate dehydrogenase and creatine kinase levels after myocardial ischemia reperfusion in rats as inhaled isoflurane So we speculate that the protective mech-anism of emulsified isoflurane is generalized and not specific to the lung These results suggest that emul-sified isoflurane may prove applicable to the clinical treatment of organ injury caused by hepatic surgery, transplantation or hemorrhagic shock

Acknowledgements

The study was supported by the National Natu-ral Science Foundation of China (Grant No 30700788) and Youth Scholars Foundation of Shanghai Health Bureau (Grant No 2009Y064)

Conflict of Interest

The authors have declared that no conflict of in-terest exists

References

1 Casillas-Ramírez A, Mosbah IB, Ramalho F et al Past and fu-ture approaches to ischemia-reperfusion lesion associated with liver transplantation Life Sci 2006; 79: 1881-1894

2 Liu DL, Jeppsson B, Hakansson CH et al Multiple-system or-gan damage resulting from prolonged hepatic inflow interrup-tion Arch Surg 1996; 131: 442-447

3 Murry CE, Jennings RB, Reimer KA Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium Circulation 1986; 74: 1124-1136

4 Cason BA, Gamperl AK, Slocum RE et al Anesthetic-induced preconditioning: previous administration of isoflurane de-creases myocardial infarct size in rabbits Anesthesiology 1997; 87: 1182-1190

5 Kersten JR, Schmeling TJ, Pagel PS et al Isoflurane mimics

ischemic preconditioning via activation of K (ATP) channels:

reduction of myocardial infarct size with an acute memory

phase Anesthesiology 1997; 87: 361-370

6 Zheng S, Zuo Z Isoflurane preconditioning reduces purkinje

cell death in an in vitro model of rat cerebellar ischemia

Neu-roscience 2003; 118: 99-106

7 Lee HT, Ota-Setlik A, Fu Y et al Differential protective effects of

volatile anesthetics against renal ischemia–reperfusion injury in

vivo Anesthesiology 2004; 101: 1313-1324

8 Bedirli N, Ofluoglu E, Kerem M et al Hepatic energy

metabo-lism and the differential protective effects of sevoflurane and

isoflurane anesthesia in a rat hepatic ischemia-reperfusion

in-jury model Anesth Analg 2008; 106: 830-837

9 Reutershan J, Chang D, Hayes JK et al Protective Effects of

Isoflurane Pretreatment in Endotoxin-induced Lung Injury

Anesthesiology 2006; 104: 511-517

10 Plachinta RV, Hayes JK, Cerilli LA et al Isoflurane

pretreat-ment inhibits lipopolysaccharide-induced inflammation in rats

Anesthesiology 2003; 98: 89-95

11 Liu R, Ishibe Y, Ueda M Isoflurane-sevoflurane administration

before ischemia attenuates ischemia-reperfusion-induced

inju-ry in isolated rat lungs Anesthesiology 2000; 92: 833-840

12 Mathias LA, Piccinini Filho L, Rittes JC et al Intravenous

isoflurane in lipid emulsion promotes cardiovascular and

res-piratory stability Experimental model Revista Brasileira de

Anestesiologia 2004; 54: 656-662

13 Rao Y, Wang Y, Zhang W et al Emulsified isoflurane produces

cardiac protection after ischemia reperfusion injury in rabbits

Anesth Analg 2008; 106: 1353-1359

14 Centurion SAR, Centurion LM, Souza MEJ et al Effects of

is-chemic liver preconditioning on hepatic ischemia/reperfusion

injury in the rat Transplant Proc 2007; 39: 361-364

15 Peralta C, Prats N, Xaus C et al Protective effect of liver

is-chemic preconditioning on liver and lung injury induced by

hepatic ischemia-reperfusion in the rat Hepatology 1999; 30:

1481-1489

16 Zhou JX, Luo NF, Liang XM et al The efficacy and safety of

intravenous emulsified isoflurane in rats Anesth Analg 2006;

102: 129-134

17 Yang XL, Ma HX, Yang ZB, et al Comparison of minimum

alveolar concentration between intravenous isoflurane lipid

emulsion and inhaled isoflurane in dogs Anesthesiology 2006;

104: 482-487

18 Reutershan J, Chang D, Hayes JK et al Protective effects of

isoflurane pretreatment in endotoxin-induced lung injury

An-esthesiology 2006; 104: 511-517

19 Welborn MB 3rd, Moldawer LL, Seeger JM et al Role of

en-dogenous interleukin-10 in local and distant organ injury after

visceral ischemia-reperfusion Shock 2003; 20: 35-40

20 Smirnova IV, Bittel DC, Ravindra R et al Zinc and cadmium

can promote rapid nuclear translocation of metal response

el-ementbinding transcription factor-1 J Biol Chem 2000; 275:

9377-9384

21 Yang J, Li W, Duan M, Zhou Z et al Large dose ketamine

in-hibits lipopolysaccharide induced acute lung injury in rats

In-flamm Res 2005; 54: 133-137

22 Hato S, Urakami A, Yamano T et al Attenuation of liver and

lung injury after hepatic ischemia and reperfusion by a

cyto-kine-suppressive agent, FR167653 Eur Surg Res 2001; 33:

202-209

23 Okaya T, Holthaus R, Kato A et al Involvement of the

neuro-peptide substance P in lung inflammation induced by hepatic

ischemia/reperfusion Inflamm Res 2004; 53: 257-61

24 Hu ZY, Liu J Effects of emulsified isoflurane on

haemody-namics and cardiomyocyte apoptosis in rats with myocardial

ischaemia Clin Exp Pharmacol Physiol 2009, 36: 776-783

25 Abraham E Neutrophils and acute lung injury Crit Care Med 2003; 31(Suppl): 195-199

26 Parsey MV, Tuder R, Abraham E Neutrophils are major con-tributors to intraparenchymal lung IL-1 expression after hem-orrhage and endotoxemia J Immunol 1998; 160: 1007-1013

27 Hu G, Salem MR, Crystal GJ Isoflurane and sevoflurane pre-condition against neutrophil-induced contractile dysfunction in isolated rat hearts Anesthesiology 2004; 100: 489-497

28 Hu G, Salem MR, Crystal GJ Role of adenosine receptors in volatile anesthetic preconditioning against neutrophil-induced contractile dysfunction in isolated rat hearts Anesthesiology 2005; 103: 287-295

29 Hu G, Vasiliauskas T, Salem MR et al Neutrophils pretreated with volatile anesthetics lose ability to cause cardiac dysfunc-tion Anesthesiology 2003; 98: 712-718

30 Colletti LM, Remick DG, Burtch GD et al Role of tumor necro-sis factor-α in the pathophysiologic alternations after hepatic ischemia/reperfusion injury in the rat J Clin Invest 1990; 85: 1936-1943

31 Colletti LM, Cortis A, Lukacs N et al Tumor necrosis factor up-regulates intercellular adhesion molecule 1, which is im-portant in the neutrophil-dependent lung and liver injury as-sociated with hepatic ischemia and reperfusion in the rat Shock 1998; 10: 182-191

32 Li QF, Zhu YS, Jiang H et al Isoflurane preconditioning ame-liorates endotoxin-induced acute lung injury and mortality in rats Anesth Analg 2009; 109: 1591-1597

33 Hashiguchi H, Morooka H, Miyoshi H et al Isoflurane protects renal function against ischemia and reperfusion through inhi-bition of protein kinases, JNK and ERK Anesth Analg 2005; 101: 1584-1589

34 Wang Y, Schmeichel AM, Iida H et al Enhanced inflammatory response via activation of NF-kappaB in acute experimental diabetic neuropathy subjected to ischemia-reperfusion injury J Neurol Sci 2006; 247: 47-52

35 Yoshidome H, Kato A, Edwards MJ et al Interleukin-10 inhibits pulmonary NF-kappaB activation and lung injury induced by hepatic ischemia-reperfusion Am J Physiol 1999; 277: 919-23

36 Colletti LM, Cortis A, Lukacs N et al Tumor necrosis factor up-regulates intercellular adhesion molecule 1, which is im-portant in the neutrophil-dependent lung and liver injury as-sociated with hepatic ischemia and reperfusion in the rat Shock 1998; 10: 182-91

37 Zhong C, Zhou Y, Liu H Nuclear factor kappaB and anesthetic preconditioning during myocardial ischemia-reperfusion An-esthesiology 2004; 100: 540-545

38 Zhang L, Luo N, Liu J et al Emulsified isoflurane precondi-tioning protects against liver and lung Injury in rat model of

doi:10.1016/j/jss.2010.06.037