Đánh giá nguồn gen và phân tích chỉ thị phân tử liên quan tính trạng năng suất trứng ở giống gà liên minh

MINISTRY OF EDUCATION AND TRAINING MINISTRY OF AGRICULTURE AND RURAL DEVELOPMENT VIETNAM ACADEMY OF AGRICULTURAL SCIENCES ---***--- TRAN THI BINH NGUYEN EVALUATING GENETIC RESOURCES

MINISTRY OF EDUCATION AND

TRAINING

MINISTRY OF AGRICULTURE AND RURAL

DEVELOPMENT VIETNAM ACADEMY OF AGRICULTURAL SCIENCES

-*** -

TRAN THI BINH NGUYEN

EVALUATING GENETIC RESOURCES AND ANALYZING MOLECULAR MARKERS RELATED TO EGG YIELD TRAITS IN LIEN MINH

CHICKEN BREED

Specialization: Biotechnology Code number: 9420201

SUMMARY OF AGRICULTURAL DOCTORAL THESIS

Hanoi, 2019

The dissertation has been completed at: Vietnam Academy of Agricultural Sciences

Supervisors:

1 Dr Nguyen Thi Dieu Thuy

2 Dr Nguyen Huu Duc

Reviewer 1:

Reviewer 2:

Reviewer 3:

The dissertation will be defended at the Dissertation committee at the

National level Vietnam Academy of Agricultural Sciences, on Date

month year

The full text of the dissertation can be found in the following libraries:

- The National Library of Vietnam;

- The Library of Vietnam Academy of Agricultural Sciences.

DANH MỤC CÔNG TRÌNH CÔNG BỐ LIÊN QUAN ĐẾN LUẬN ÁN

1 Tran Thi Binh Nguyen, Nguyen Huu Duc, Do Vo Anh Khoa, Nguyen Thi

Dieu Thuy (2018), “Effect of nucleotide polymorphism of candidate genes on

egg production traits in native Lien Minh chicken”, Livestock Research for

Rural Development 30(6)

2 Tran Thi Binh Nguyen, Nguyen Huu Duc, Vu Duc Quy, Pham Thu Giang,

“Polymorphism in candidate genes of Lien Minh chicken”, Vietnam Journal of

Agricultural Sciences 1(2), tr 174-182

3 Tran Thi Binh Nguyen, Nguyen Hung Cuong, Vu Thi Tien, Ta Thi Loan,

neuropeptide gene polymorphism with egg production trait in Lien Minh

chicken”, National Biotechnology conference 2018, Hanoi 26/10/2018, pp 1828-1833

4 Tran Thi Binh Nguyen, Nguyen Huu Duc and Nguyen Thi Dieu Thuy

trait in Lien Minh chicken”, Vietnam Journal of Biotechnology, 16(2), pp 1-8

5 Tran Thi Binh Nguyen, Do Thi Lieu, Nguyen Huu Duc, Hoang Thi Yen, Vu

Cong Quy, Nguyen Hung Cuong and Nguyen Thi Dieu Thuy (2016),

candidate genes concerning with egg production traits of Lien Minh chicken

breed”, Journal of Animal Husbandry Sciences and Technics, 212, pp 2-8

INTRODUCTION

1 The necessity of research

Lien Minh chicken is an indigenous breed with several favorable properties, such

as good meat quality and associated with the economic development of the people in the Lien Minh village, Cat Hai, Hai Phong Such breed comes in beautiful physical appearance with its nice feather color, yellow skin and produces high-quality meat with thinfat under the skin The source of the Lien Minh chicken gene was assessed at the level of dangerous threat (FAO, 2007), and has been listed on the conservation list since 2008 The conservation and efficient use of Lien Minh chicken were developed

in 2013 Research results from more than 30 households studied in Tran Chau commune, Cat Hai district, Hai Phong city the grazing revealed that, aAge of first egg laying in Lien Minh chickens was quite late (197.5 days of age) and low egg yield 75.6

eggs/chicken/year (Doan BH et al, 2016) It is therefore essential to increase Lien

Minh chicken egg production in order to conserve, exploit, and develop such poultry breeds

Chicken egg production can be affected by a number of factors such as genetics, nutrition, light, and veterinary care regimes Among these factors, Genetic polymorphism is currently studied in order to improve economic characteristics of

indigenous chickens The polymorphisms of PRL (Prolactin), VIP (Vasoactive Intestinal Peptide), VIPR1 (Vasoactive Intestinal Peptide Receptor 1), NPY (Neuropeptide Y), GH (Growth hormone) and GHR (Growth hormone receptor) have

been defined to have significant association with fertility in some in some indigenous chicken breeds around the world Therefore, genetic polymorphism can be used as DNA markers to improve egg production in indigenous chickens

Additionally, little research has been carried out on the evaluation of the genetic diversity based on the nucleotide sequence of D-loop mitochondrial genes in Lien Minh chickens The results of these studíe can be used to provide information on genetic diversity, to support for registering the copyright of the Lien Minh chicken breed Furthermore, this work is a solid foundation for building the panorama of Lien Minh chicken’s genetic diversity levels

Therefore, "Evaluating genetic resources and analyzing molecular markers

related to egg yield traits in Lien chicken breed” was implemented to provide genetic

information of the D-loop region of mitochondrial genes and candidate genes improving egg production as well as support conservation, exploitation and development of Lien Minh chicken

2 Research objectives

- Evaluate genetic diversity of Lien Minh chickens based on sequences of mitochondrial DNA D-loop region

- Determine the genetic relationship and the origin of Lien Minh chickens

- Identif genetic relationships between candidate genes and egg yield traits in Lien Minh chickens

3 Scientific and practical significance

* Practical significance:

Provide scientific information to promote and develop the market for indigenous chickens Lien Minh products Provide scientific information to promote and develop the market for indigenous chickens Lien Minh products Provide information for the Hai Phong Center for Science and Technology Application, companies and livestock farms to select the line Lien Minh chickens with high egg production

4 Object and scope of the study

- The thesis applied bioinformatics tools to assessing the genetic resource of Lien Minh chickens: Analyzing the nucleotide sequence of mtDNA D-loop region of Lien Minh chicken to assess the diversity of genetic resources

- Determine genotypic and allelic frequency of at PRL, VIP, VIPR1, NPY, GH, and GHR genes in Lien Minh chickens

- Assess the relationship between polymorphisms of PRL, VIP, VIPR1, NPY, GH, and GHR genes and egg production traits

5 Subject of research and scope of research

Subjects of research: Lien Minh indigenous chickens in Tran Chau commune, Cat Hai district, Hai Phong city

Scope of research: The Thesis applied biotechnology and bioinformatics tools

to analyze the genetic diversity of Lien Minh chicken, and to support conservation,

exploitation and development of Lien Minh chickens

The Thesis focused on candidate genes related to egg production ability, so that the target genes could be identified, Contributing to the selection of Lien Minhchicken with high egg yield

6 Structure of the thesis

The thesis comprises of 107 pages (apart from references and appendices), including: Introduction (5 pages); chapter 1: Literature review (37 pages); chapter 2: Materials contents and methods (8 pages); chapter 3: Results and discussion (50 pages); Conclusion and recommendations (2 pages) The paper uses 180 references, 33

of which are in Vietnamese and 147 others are in English The thesis includes 32 tables, 44 figures, 4 appendices and 5 publications

CHAPTER 1 LITERATURE OVERVIEW

The thesis has used to and analyzed 33 reference materials in Vietnamese and

147 materials in English, which relate to the following contents: The mitochondrion is

a double-membrane-bound organelle found in most eukaryotic organisms Mitochondrial genomes are about 16 kb in almost all animals Mitochondrial DNA is the DNA located in mitochondria with characteristics: i) multiple number of copies; ii) exist in a haploid form and have almost no recombination; iii) relatively fast mutation rates and iv) mother line genetics in most species, so it is used as a tool in analysis between evolutionary relationships and evaluation of genetic variation within and

between species (Harpending et al, 1998) The nucleotide sequence in D-loop region is

the fastest evolving region compared to that of mtDNa, Making it an appropriate region in in analyzing population genetic diversity, especially internal changes of the same species

To study the low reproductive rate in Lien Minh chickens, the loci associated with reproductive traits (candidate genes) were selected derived from the knowledge

of reproductive physiology and reports as to whether these genes showed an association with reproductive performance in commercial poultry lines Prolactin is a polypeptide hormone secreted by the anterior pituitary gland, which is involved in many physiological pathways: osmotic regulation, luteolysis (regressive ovary) and the

maintenance of incubation behavior in hens Studies have shown that the PRL is

present in the hypothalamus, the pituitary gland, the oviduct, and the egg, with the

highest levels found in the pituitary gland (Li et al, 2009a) In chickens, the hormone

prolactin is one of the hormones that plays an important role in egg production Prolactin concentrations increase sharply in plasma, may induce broody behavior

(Sockman et al, 2000), and results in reduced egg production (Reddy et al, 2002) A

mutation that occurs in the promoter region can affect the expression of the PRL gene,

so it may affect egg production Prolactin secretion in birds is predominantly regulated

by releasing factors, one of which is a vasoactive intestinal peptide (Kagya-Agyemang

et al, 2012) Vasoactive intestinal peptide (VIP) is a prolactin-releasing factor in birds

(El Halawani et al, 1990; 1997) VIP increases PRL secretion from pituitary glands,

especially when the pituitary gland responsiveness is enhanced with estrogen

pre-treatment (Sharp et al, 2005) VIP binds with the vasoactive intestinal peptide receptor

to give rise to the secretion and release of PRL (El Halawani et al, 1990) Neuropeptide Y (NPY) is an important neuromodulator, which is associated with gonadal function in birds and mammals (Hilal et al, 1996) NPY may affect the egg production rate through its role in controlling ovulation (Dunn et al, 2004) Genetic

encoding for the neuropeptide Y gene is associated with the age of having the first egg

and the number of eggs laid (Xu et al, 2011a, Xu et al, 2011b, Dunn et al, 2004, Li et

al, 2009b) The NPY gene might produce markers for the age of the onset of lay, and

through its role in the control of ovulation, influence the egg production rate

Injections of NPY change the plasma concentration of the luteinizing hormone and growth hormone (Pierroz et al, 1996), suggesting that it may play a significant role in the secretion of these hormones (Wang et al, 2001) Growth hormone (GH), when combined with the growth hormone receptor in the liver and when forming the GH-

GHR-IGFs signal pathway, affects chicken development (Lau et al, 2007) The

identified alleles of the GH gene of White leghorn have been linked to the egg production phenotype (Kuhnlein et al, 1997) The growth hormone receptor (GHR)

controls the number of follicles in animals that are recruited to the rapid growth phase

(Roberts et al, 1994; Monget et al, 2002)

Lien Minh breed comes in beautiful physical appearance with its nice feather color, yellow skin and produces high-quality meat with thin subcutaneous fat layer, crispy and chewy skin It also possesses long legs and neck silky fur The rooster has a good appearance, colorful feathers and it can weigh up to 5kg, and a hen has 3kg The market demand for Lien Minh chicken is very large, but in the small-scale farming conditions and extensive farming methods, Lien Minh hamlet and surrounding areas only meet a very small part of market demand in Cat Hai district and Hai Phong city, typically in Cat Ba

Therefore, the study evaluated the genetic diversity of Lien Minh chickens by using the D-loop nucleotide sequence, at the same time using genes related to fertility

to find gene polymorphisms can improve egg yield in Lien Minh chickens

CHAPTER 2 MATERIALS, CONTENTS AND METHODS 2.1 MATERIALS

2.1.1 Animal materials

2.1.1.1 Chicken population

Blood samples of Lien Minh chicken raised in households in Lien Minh village were collected for genetic diversity analysis Lien Minh chickens were selected based on the following criteria: Limiting blood ties (from different farming households in Lien Minh village, Tran Chau commune, Cat Hai district, Hai Phong), roosters (n = 12 individuals) and hens (n = 12 individuals), mature individuals with typical characteristics of the breed, confirmed by breeders participating in the project "Exploitation and development of Lien chicken Minh in Hai Phong "at Decision No 2398 / QD-BKHCN dated August 31, 2012 of the Minister of Science and Technology In addition, two indigenous chicken breeds are Dong Tao chicken - GDT (n = 18) and Chicken Many Finger - G9C (n = 6) were sampled from the locality where they originated (Khoai Chau District, Hung Yen and Xuan Son National Park, Phu Tho)

2.1.1.2 Sample collection (or Egg collection)

We collected Lien Minh chicken eggs at households in Lien Minh hamlet Then eggs were hatched, tended, vaccinated and monitored at Hai Phong City of Science and Technology Application Center in an individual form from hatching (01 day old)

to 44 weeks of age Lien Minh chickens received the same veterinary cared, nutrition, environment and evaluated characteristics egg production traits

1.1.1.3 Primer sequences used for amplification in thesis

Table 2.2 Primer sequences used for amplification of the D-loop region

( o C)

PCR size ([bp]

References

R: CATCTTGGCATCTTCAGTGCC 56 1321 Oka et al, 2007

Table 2.3 Primer used in candidate gene analysis

( o C)

PCR size ([bp]

24bp(PRL24)

F:TTTAATATTGGTGGGTGAAGAGACA R: ATGCCACTGATCCTCGAAAACTC 54 154/130 Xu et al, 2011

R: GCTGGTGAACCA ATCTCGGTT 58 718 Li et al, 2008

R: TTTATCCCGTGTTCTCTTGACA 60 750 Li et al, 2008

F: Forward primer; R: Reverse primer; T (a): Annealing temperature

Components of the cut reaction (total volume of a 15 µl reaction): deionized water (2,5 µl), 10X cutting buffer (1,5 µl), PCR product (10 µl), restriction enzyme (1 µl), the incubation time is 16 hours, the incubation temperature is corresponding to each enzyme cut (Table 2.4)

Table 2.4 Information for polymorphisms and restriction enzyme (RE)

Locus Polymophism RE GenBank accession

number PCR-RFLP size [bp] Ta [ o C] Manufacturer

26V / P / N95-0458-02, USA), centrifuge (HETTICH-UNI version 320R, Germany), egg pressure gauge, Nano Drop Spectrophotometer

Determining genotypic and allelic frequency in candidate genes (PRL, VIP,

VIPR1, NPY, GH and GHR) related to egg yield traits;

Identifing the relationship between candidate genes and egg yield traits in Lien Minh chickens

2.3 METHODS

2.3.1 Blood sampling

The blood samples from Lien Minh chickens were taken with a 5 ml syringe from the vein of the wing vein, then quickly transferred to a blood tube containing EDTA-K anticoagulant Blood tube was stored at 4ºC, and -20ºC in the lab

2.3.2 DNA extraction

Genomic DNA was extracted by a standard procedure using Proteinase K digestion followed by phenol-chloroform extraction and precipitation with ethanol

(Ausubel et al, 1995) A nanodrop spectrometer and agarose gel electrophoresis were

until analysis

2.3.3 PCR amplification

The PCR primers were designed based on the chicken candidate gene sequences using Primer 3.0 software PCR was performed in a 25 µl reaction containing 1x PCR

(Fermentas), and 100 ng genomic DNA In PCR amplification, an initial denaturation

2.3.4 PCR purification and gene sequencing

Purification of DNA fragments for sequencing: The purification process was used with the QIAquick PCR Purification Kit (QIAGEN) The purified product was

sequenced on the ABI-3100 Avant Gentic Analyzer from Macrogen Company (Korea)

2.3.5 Restriction Fragment Length Polymorphism

Genetic length polymorphism analysis used PCR-RFLP (Restriction Fragment Length Polymorphism (RFLP) technique with appropriate restriction fragment enzymes PCR products were then digested with restriction enzymes overnight The restriction fragments were separated on 2% agarose gel stained with ethidium bromide

2.3.6 Evaluate indicators related to reproductive traits in chickens

Based on the description of Bui Huu Doan et al (2011), the indicators…to

produce eggs include age at first egg laying (days), weight of first egg (gram), energy egg yield (total number of eggs/hens/20 weeks) egg weight (grams) and egg shape index (large diameter size/small diameter D/R)

2.3.7 Body weight

The body weight of Lien Minh chickens was weighed every Friday at 19 o'clock (start from 01 day to 22 weeks), when chickens go to barns, using a scale of 5 g accuracy

2.3.8 Statistical analyses

Nucleotide sequences were identified with the Basic Local Alignment Search

Tool (BLAST) (Altschul et al, 1990) Multiple nucleotide alignments were carried out

with BioEdit (Hall, 1999) The diversity parameters, including the nucleotide diversity haplotypes D-loop of all sequences were estimated using DnaSP v.5 software (Librado and Rozas, 2009) Neighbor Joining (NJ) phylogenetic tree was conducted using MEGA version 6.1 (Tamura et al, 2007) Phylogenetic tree analysis was constructed

based on classification of Oka et al, (2007) with reference mtDNA sequences from the

GenBank database

, The gene frequencies were calculated by counting method as: p= 2(AA) + (AB)/2N and q= 2(BB) + (AB)/2N where p = the gene frequency of allele A, q = the gene frequency of allele B and N = the total number of chickens tested The Hardy-

Weinberg Equilibrium (HWE) was estimated using the method of Rodriguez et al,

2009 The association between genotype and egg production was analyzed based on General Linear Model of Minitab software version 16.0: Yij= µ + Gi + ξij (where Yij: traits observed; μ: general mean, Gi: influence of genotype; ξij: random error)

Chapter III RESULTS AND DISCUSSION 3.1 GENETIC DIVERSITY ANALYSIS IN INDIGENOUS LIEN MINH CHICKEN

3.1.1 DNA extraction

In order to carry out an evaluation of the Lien Minh chicken genetic diversity based on the nucleotide sequence of D-loop region of mitochondrial DNA, it is necessary to obtain pure and intact genomic DNA

Table 3.1 Results of genomic Spectrophotometer

to subsequent experiments

3.1.2 Amplification of the mitochondrial DNA D-loop region

As shown in Figure 3.2, DNA sample is a bright band and has a molecular expected

bands of 1000 bp and 1500 bp)

Figure 3.2 Eectrophoresis of PCR products on 1% agarose gel

Wells 1 → 9: PCR products of Lien Minh chickens, M: Ladder DNA1kb (Merck)

3.1.3 Nucleotide sequence in D-loop region

The result of the nucleotide sequence in D-loop region of Lien Minh chicken were registered on GenBank with the codes: from KY172116 to KY172121 and from

MH425591 to MH425608

3.1.4 Analysis of nucleotide polymorphism in D-loop region of Lien Minh chickens and other native chickens with code on Genbank

3.1.4.1 Diversity analysis in D-loop region

DnaSP was used to analyze the nucleotide polymorphism in mtDNA D-loop region of Lien Minh chicken The analytical parameters include: Number of polymorphic sites (S); number of haplotype (h); haplotype diversity (Hd); nucleotide diversity (Pi); Tajima test (D) The analysis results of the nucleotide polymorphic parameters (1050 bp) in Lien Minh chickens, other native chickens in Vietnam were shown in Table 3.2

Table 3.2: Polymorphic sites, haplotype and nucleotide diversity of chicken breeds

3.1.4.2 Polymorphic nucleotide sequence in D-loop region

a Analysis of D-loop nucleotide polymorphisms between Lien Minh chickens and native Vietnamese chicken breeds (455 bp)

The analysis results indicate, there were 21 nucleotide substitution sites and no nucleotide insert/deletion polymorphism when compared to a native Vietnamese chicken coded GU564373 (Dong Tao chicken) Figure 3.4 showed that among 21 nucleotide substitution sites there are 11 T→C substitutive positions, four A→G substitutive positions, five substitutive positions C→T, but only one G→A substitutive nucleotide sites Especially, T→C substitution at position 241 appeared in all Lien Minh chickens, in addition this substitution at position 206 appeared in 17 of 24 studied samples

b Analysis of D-loop nucleotide polymorphisms between Lien Minh chickens and native breeds in the world (in Genbank)

The results showed that from 24 nucleotide sequences were identified by 23 nucleotide polymorphic positions between Lien Minh chicken and the branch E breed with code AB268540 (Gallus gallus domesticus), including 22 nucleotide substitution sites and a nucleotide insert site Special nucleotide G insertion at position 860 appears

in all Lien Minh chickens Besides, nucleotide substitution T→C appears in 10 positions (167, 199, 217, 243, 246, 256, 270, 315, 367, 888) and substitutions C→T appears only in position 225, 261, 310 and 446