Rapid real time pcr for Cyp2c19 and itgb3 gene detection to optimize the use of clopidogrel and aspirin for pci stent graft patients

The response to clopidogrel and aspirin in patients is known to be highly variable as bioavailability is dependent upon the conversion of the prodrug into the pharmacologically active clopidogrel and aspirin. Blood samples were collected from consenting patients after they were on the maintenance dose of anti-platelet therapy. The real-time PCR method was developed for the identification of the specific mutations in the CYP2C19 gene (CYP2C19 *2 and CYP2C19*3) and ITGB3 gene (PlA1/ A2).

RAPID REAL-TIME PCR FOR CYP2C19 AND ITGB3 GENE DETECTION TO OPTIMIZE THE USE OF CLOPIDOGREL AND ASPIRIN FOR PCI STENT GRAFT PATIENTS

Nguyen Thi Trang, Luong Thi Lan Anh , Vu To Giang , Do Duc Huy,

Nguyen Thi Minh Ngoc,

Department of Biomedical and Genetics, Hanoi Medical University, Hanoi, Vietnam

The response to clopidogrel and aspirin in patients is known to be highly variable as bioavailability

is dependent upon the conversion of the prodrug into the pharmacologically active clopidogrel and aspirin Blood samples were collected from consenting patients after they were on the maintenance dose of anti-platelet therapy The real-time PCR method was developed for the identification of the specific mutations in the CYP2C19 gene (CYP2C19 *2 and CYP2C19*3) and ITGB3 gene (PlA1/ A2) The real-time PCR method using SYBR green was validated against the Sanger’s sequencing method described previously and used to determine the frequency and type of mutations of postPCI patients The results indicated that patients carrying any CYP2C19 loss-of-function alleles had a higher event rate (52.5%) of the study group: 10% homozygous and 35% heterozygous (CYP2C19

*2); 7.5% heterozygous carriers (CYP2C19*3) Carriers of the Leu33Pro polymorphism of ITGB3 gene accounted for approximately 10% of the study population In conclusion, a genotyping variant of CYP2C19 and ITGB3 provides an excellent opportunity for optimizing the anti-platelet regimen post-PCI

Keywords: coronary artery disease, CYP2C19, clopidogrel, ITGB3, aspirin resistance

I INTRODUCTION

Coronary artery disease (CAD) is the

most common type of heart disease It is the

leading cause of death in the world in both

men and women [1] In Vietnam, coronary

artery disease has been increasing rapidly

in recent years Percutaneous coronary

intervention (PCI) is one of the most

common medical procedures performed for

treatment of CAD

Dual antiplatelet therapy with aspirin and a P2Y12 receptor antagonist including clopidogrel is the standard of care in patients undergoing PCI and in patients with acute coronary syndromes (ACS) because this regimen has markedly decreased the rate of cardiovascular events However, the substantial variability

in pharmacodynamics response, as well

as the moderate antiplatelet efficacy of clopidogrel and aspirin, has raised major concerns Many researches have focused

on the impact of genetic polymorphisms encoding transport systems or enzymes

Corresponding author: Nguyen Thi Trang, Department

of Biomedical and Genetics, Hanoi Medical University

Email: trangnguyen@hmu.edu.vn

Received: 03 June 2017

of these drugs An ESC Guidelines class

II recommendation has been given for the

management of acute coronary syndromes

patients (2011) to perform genotyping in

high-risk PCI patients if a change in the

anti-platelet therapy will ensue based on the test

results [2]

Loss-of-function polymorphisms in

CYP2C19 are the strongest individual

variables affecting pharmacokinetics

and antiplatelet response to clopidogrel

CYP2C19 G681A (*2) and CYP2C19

G636A (*3) alleles are associated with CYP

function reduction, impaired clopidogrel

responsiveness and increased subsequent

post-PCI ischemic outcomes [3 - 5]

The GPllb/llla receptor is a key regulator

of platelet aggregation Consequently,

polymorphisms within the GPllb/llla

receptor have been of great interest with

regard to aspirin resistance, the most

commonly investigated being the PlA1/A2 SNP (Leu33Pro) [6] Some studies have suggested an association between the presence of the PlA2 allele and increased platelet activity, as determined by platelet aggregation and/or fibrinogen binding [7 - 10]

The Realtime - PCR method is an accurate way of defining polymorphism, with the advantage of relatively simple, fast-paced techniques that have opened up new possibilities for applying this technique

as a routine test before indications of clopidogrel and aspirin therapy for PCI patients The aim of this study was to investigate the frequencies of CYP2C19 G681A (*2; rs4244285), CYP2C19 G636A (*3; rs4986893) and PlA1/ PlA2 (T1565C, rs5918) polymorphisms of CYP2C19 and ITGB3 gene in study subjects by Realtime

2 Method:

About 3 ml of venous blood were collected in a tube containing EDTA Peripheral blood leucocytes were separated by centrifugation DNA was extracted from peripheral blood with DNA Expression Kit (Lytech, Russia) Realtime - PCR technique was used to identify polymorphism of CYP2C19 gene (CYP2C19*2 , CYP2C19*3) and ITGB3 gene (PlA1 / PlA2) The primers used for PCR of each polymorphism are given in Table 1:

Table 1 FP - Forward primer, ASP - Allele specific primer, RP- Reverse primer.

CYP2C19*2

(G681A)

FP 5’ – CCCACTATCATTGATTATTTCTCG – 3’ASP 5’– CCCACTATCATTGATTATTTCTCA-3’

Using the DNA-express kit for DNA extraction and Realtime Techniques - Genomic PCR and mutation analysis are time-saving methods: saving an average of 45 minutes for DNA extraction and 90 minutes for gene polymorphism This technique is therefore highly applicable in clinical practice to quickly and accurately identify patients' genotypes prior to the introduction of the regimen as well as the dose of clopidogrel and aspirin

Statistical analysis

The continuous data were presented as mean and standard deviation (SD) The statistical analyses were conducted using SPSS (SPSS Statistics for Windows, Version 17.0 Chicago: SPSS Inc.)

3 Ethics

All patients were duly informed of the benefit of such a test and were asked to sign an informed consent form before blood collection Ethical clearance was obtained from the Hanoi Medical University Institutional Ethics Committee

III RESULTS

1 Characteristics of the study population

There were 40 patients enrolled in the study ranging in age from 39 to 79 years, the majority were men (85%) Patients with high risk factors for cardiovascular disease were relatively many, including hypertension (72.5%) and hypercholesterolemia (32.5%) (Table 2)

Table 2 Characteristics of the study group

Table 3 CYP2C19 and ITGB3 polymorphism detection rates using Realtime - PCR

Gene

CYP2C19 *2, *3

ITGB3 PlA1/ PlA2

3 Genotype frequencies of study subjects.

Table 4 shows that the number of patients with CYP2C19*2 allele accounted for 45%, mainly heterozygous (35%), homozygotes (10%) 7.5% of patients with CYP2C19*3 allele, all

of them are heterozygous 10% of patients carry PlA2 alleles - all of them are heterozygous

Table 4 Genotype frequencies of study subjects.

zygous Wild type allele Mutant allele

The combination of aspirin and

clopidogrel is the mainstay anti - platelet

strategy for preventing ischemic events after

PCI However, many studies have shown

resistance to aspirin and clopidogrel, which

reduces the effectiveness of treatment

According to Boris T et al (2009), the rate

of no responsiveness to aspirin varied

from 5% to 60%, with clopidogrel 6% -25%

and both drugs 10.4% [11] In Vietnam,

according Do Quang Huan (2013), in 174

patients with coronary artery disease

enrolled in the study, the prevalence of

nonresponse to aspirin and clopidogrel

were 21.3% and 26.4% [12] According

to Ibrahim O (2013), aspirin resistance/

non-responders in their study at acute

coronary syndrome patients accounted for

4.69% while non-responders to clopidogrel

accounted for 21.9% [13] Thus, studies on

factors related to clopidogrel and aspirin

resistance, particularly genetic factors, are

coronary heart disease

Several polymorphisms of the CYP2C19 gene have been identified and they produce

an inactive enzyme Two inactive genetic variants (CYP2C19*2 and CYP2C19*3) account for more than 95% of cases of poor metabolism of the relevant medications [14].The genotypes were distributed as good

or normal metabolizers (CYP2C19*1/*1; also called extensive metabolizers in literature), intermediate (*1/*2; *1/*3,

*2/*17, and *3/*17), poor (*2/*2 and *3/*3), rapid (*1/*17), and ultra-rapid metabolizers (*17/*17)

In our study, more than half of the study population carriers of at least one CYP2C19 loss-of-function allele (CYP2C19 * 2 or CYP2C19 * 3) The results of our study were similar to those found in Liu Mao’s study (2013): about 55% of Asians have one or more loss-of-function allele of CYP2C19 [15] Among them, the frequencies of

IV DISCUSSION

study was 35% (14 patients), the frequencies

of heterozygous CYP2C19 G636A (*3)

was 7.5% (3 patients) Poor metabolizers,

with both alleles being mutated and hence

unable to metabolize clopidogrel, formed

10% of the population (4 patients), all of

them are homozygous CYP2C19 *2 Thus,

the intermediate metabolizers and the poor

metabolizers of clopidogrel are relatively

large As recommended by the American

Association for Clinical Pharmacology and

Clinical Pharmacy (ASCPT) in 2013 for the

use of platelet antiplatelet drugs [16]: it is

necessary to consider alternative treatment

sor treatment strategies in patients identified

as CYP2C19 intermediate metabolizers and

poor metabolizers Therefore, identifying

the genotype of an individual before taking

clopidogrel is necessary to achieve its

optimal anti-platelet activity

In addition, our study identified that

4 patients (10% of study population)

were PLA1/A2 heterozygotes No PLA2

homozygotes were found in the study

group No patients carry the PlA2 / PlA2

homozygous genotype According to a

study by Sperr W R et al (1998), in central

Europeans, the PlA1/A2 allele is present in

20-30 % of people and the PlA2/A2 allele

is present in 1-3 % of people [8] It has

been shown that platelets containing PlA1/

A2 or PlA2/A2 alleles are more reactive

than homozygous PlA1/A1 platelets with

enhanced thrombin formation and a lower

threshold for activation, granule release,

and fibrinogen binding, and therefore will

have a variable response to the antiplatelet

effects of aspirin [9; 10]

Results from our study indicate high

prevalence of mutations that would alter the normal function of the CYP2C19 gene

in metabolizer clopidogrel Our study also found that the small rate of individuals with the PlA2 allele of SNP rs5918 of the ITGB3 gene reduces the response to aspirin Variability or resistance to aspirin or clopidogrel has been demonstrated using various in vivo biomarkers and ex vivo platelet function tests Accumulating data suggested that patients with resistance are

at high risk for ischemic events, including stent thrombosis Thus, cardiologists have focused much attention on the adequacy of antiplatelet regimens

Study limitations: First and foremost, among the limitations of the present study

is its small sample size and absence it a control group, although we tried to overcome this shortcoming by matching the cases We calculated our sample size based on the frequency of the CYP2C19*2 alleles in the Vietnam population However, our achieved power was markedly reduced due to the low frequency of the non-functional allele

in our study population Moreover, while

we focused on CYP2C19*2, CYP2C19*3 and PlA2 as the most important alleles responsible for the resistance to clopidogrel and aspirin therapy, we did not study the prevalence of other non-functional CYP2C19 alleles Further cohort studies with larger samples and on different ethnicities in the Vietnam population are required to determine the effects of the CYP2C19 and ITGB3 polymorphism on the prognosis of CAD patients who have undergone PCI and are receiving dual anti-platelet therapy

V CONCLUSION

In our study, carriers of at least one

CYP2C19 loss-of-function allele (CYP2C19

* 2 or CYP2C19 * 3) approximately 52,5% of

the study population and 10% of the study

population were PLA1/A2 heterozygotes of

ITGB3 gene Therefore, the prevalence of

antiplatelet therapy nonresponse is higher

in patients undergoing PCI The Realtime -

PCR technique is a fast, accurate and

cost-effective way to identify polymorphisms of

CYP2C19 gene and ITGB3 gene, that are

suitable for Vietnamese conditions, and is

clinically relevant Using this method, the

common mutations that cause changes in

the bioavailability of clopidogrel and aspirin

may be reliably identified and the medication

and dosage adjusted accordingly Thus, this

technique could be used as a routine test

before treatment of dual – platelet for PCI

patients

Acknowledgments

The authors would like to take this

opportunity to extend our sincere thanks to

Center of Genetics Couseling for providing

financial support for the study We also are

grateful for National Cardiovascular Institute

for supporting us in identifying CYP2C19

and ITGB3 mutations

REFERENCES

1 Shanthi Mendis, Pekka Puska,

Bo Norrving, (2011) Global Atlas on

cardiovascular disease prevention and

control World Stroke Organization, 3 - 9.

2 C.W Hamm, J.P Bassand, S

Agewall et al (2011) ESC guidelines

for themanagement of acute coronary syndromes in patients presenting without persistent ST-segment elevation: The task force for the management of ACS (acute coronary syndromes) in patients presenting without persistent ST-segment elevation of the ESC (European Society of Cardiology),

Eur Heart J 32 (23): 2999 - 3054.

3 Brant J.T., Close S.L, Iturria S.J

et al (2007) Common polymorphysm

of CYP2C19 and CYP2C9 affect the phamacokinetic and pharmacodynamic

respone to clopidogrel but not prasugrel J Thromb Heamost 5: 2429 - 2436.

4 Mega J L., Close S L., Wiviott

alloantigens, Pl(A1) and Pl(A2), are associated with a leucine(33)/proline(33) amino acid polymorphism in membrane glycoprotein IIIa, and are distinguishable by

DNA typing J Clin Invest 83: 1778 - 1781.

7 Sirotkina OV, Khaspekova SG, Zabotina AM, Shimanova YV, Mazurov

AV (2007) Effects of platelet glycoprotein

IIb-IIIa number and glycoprotein IIIa Leu33Pro polymorphism on platelet aggregation and sensitivity to glycoprotein

IIb-IIIa antagonists Platelets 18: 506 – 14.

8 Sperr W R., Huber K., Roden M

et al (1998) Inherited platelet glycoprotein

polymorphisms and a risk for coronary

heart disease in young central Europeans

Thromb Res 90: 117 - 123.

9 Undas A., Brummel K., Musial J

et al (2001) Pl(A2) polymorphism of

beta-3 integrins is associated with enhanced

thrombin generation and impaired

antithrombotic action of aspirin at the site of

microvascular injury Circulation 104: 2666

- 2672

10 Michelson A D., Furman M.I.,

Goldschmidt-Clermont P et al (2000)

Platelet GP IIIa- PlA polymorphisms

display different sensitivities to agonists

Circulation 101: 1013 - 1018.

11 Boris T I., Mareike Sausemuth

H I., Evangelos G et al (2009) Dual

Antiplatelet Drug Resistance Is a Risk

Factor for Cardiovascular Events after

Percutaneous Coronary Intervention

Clinical Chemistry 55: 1171 - 1176

12 Đỗ Quang Huân, Hồ Tấn Thịnh

(2013) Tỷ lệ không đáp ứng với điều trị

thuốc chống kết tập tiểu cầu trên bệnh nhân

được can thiệp động mạch vành qua da

Tạp chí Y học thực hành (878), số 8/2013,

9 - 13

13 Ibrahim O, Oteh M, A Syukur

A et al (2013) Evaluation of Aspirin and

Clopidogrel resistance in patients with Acute Coronary Syndrome by using Adenosine

Diposphate Test and Aspirin Test Pak J Med Sci, 29(1): 97 – 102.

14 Yuanyuan Dong, Huasheng Xiao,

Qi Wang et al (2015) Analysis of genetic

variations in CYP2C9, CYP2C19, CYP2D6 and CYP3A5 genes using oligonucleotide

microarray Int J Clin Exp Med 8(10): 18917

– 18926

15 Liu Mao et al (2013) Cytochrome

CYP2C19 polymorphism and risk of adverse clinical events in clopidogrel-treated patients: A meta-analysis based on

23035 subjects Archives of Cardiovascular Disease 106: 517 - 527.

16 Scott S A., Sangkuhl K., Stein C

STUDY ON THE HYPOGLYCEMIC ACTION OF CF2 IN INDUCED TYPE 2-LIKE DIABETIC MICE MODEL

Ho My Dung¹, Vu Thi Ngoc Thanh¹, Pham Thi Van Anh¹,

Nguyen Thi Thanh Ha¹, Nguyen Thi Minh Hang²

¹Hanoi Medical University

²Institute of Marine Biochemistry - Vietnam Academy of Science and Technology

To investigate the hypoglycemic action of CF2 in a type 2-like diabetic mice model induced by high fat diet (HFD) combined with streptozotocin (STZ) injection Method: Model: mice were fed with HFD for 8 weeks, then injected with a dose of STZ (100 mg/kg body weight, intraperitoneal injection) Animal used: Swiss male mice Drugs: type 2-like diabetic mice with HFD and STZ treated with either gliclazide 80 mg/kg body weight, CF2 2 m/kg or CF2 4 mg/kg body weight daily by oral route of ad- ministration during 14 days Result: CF2 has blood glucose-lowering effect in type 2-like diabetic mice for 14 days treatment at doses of 2 mg/kg and 4mg/kg daily (p < 0.05) The blood glucose- lowering effect of CF2 at dose of 2 mg/kg daily is similar to gliclazide 80 mg/kg daily CF2 at dose of 4mg/kg

is more effective than that of 2 mg/kg and gliclazide 80 mg/kg in reducing blood glucose level clusion: CF2 has effect on lowering blood glucose level at doses of 2 mg/kg and 4 mg/kg daily for

Con-14 days in type 2-like diabetic mice, induced by HFD and STZ 100 mg/kg intraperitoneal injection.

Keywords: CF2, Callisia fragrans, ecdysteroid, type 2-like diabetic mice, STZ, HFD, blood glucose

I INTRODUCTION

The prevalence of diabetes mellitus is

increasing at an alarming rate globally

Ac-cording to a World Health Organization

re-port an estimated 422 million adults globally

were living with diabetes in 2014, compared

to 108 million in 1980 [1] The number of

people with diabetes aged 20 - 79 years was

predicted to rise to 642 million by 2040 [2] The health consequences of diabetes can overwhelm the health care systems due to the severity of the long term complications

of diabetes [1] Several oral hypoglycemic agent are available to lower blood glucose levels in diabetics However, their adminis-tration may cause side effects in patients [3; 4] Therefore, there is on urgent need to find new prevention strategies and treatments for diabetes Recently, many plant-based natural products that contain certain phy-

Corresponding author: Ho My Dung, Hanoi Medical

University.

Email: homydung@hmu.edu.vn

Received: 15 June 2017

abetic potential for their [5] Using an herbal

remedy as an alternative therapy for

diabe-tes treatment would reduce individuals

de-pendence on synthetic oral hypoglycemic

agents [6] The plant kingdom offers a wide

field of possible effective oral hypoglycemic

agents

Basket Plant (whose scientific name

is Callisia fragrans) has been used as a

tra-ditional therapy for pain, fever, digestive

disorders, heart diseases, diabetes,

can-cers and many other airments [7; 8] CF2

powder is extracted from the leaves, stems

and shoots of Basket Plant CF2 powder

contains the active component ecdysteroid

which can be used in treating diabetes;

preventing inflammation and osteomalacia;

protecting the nervous system; and

improv-ing the immune system [9; 10] However,

adequate characterization of CF2 effect is

yet to be done and no study has been

per-formed using a type 2 diabetes model The

objective of this study was to evaluate the

hypoglycemic action of CF2 in a model of

induced type 2-like diabetic mice Type-2

like diabetes was individual by high fat diet

(HFD) combined with streptozotocin (STZ)

injection

II MATERIALS AND METHODS

1 Materials

Experimental Medicine

CF2 powder extracted from leaves,

stems and shoots of Basket Plant was

sup-plied by Institute of Marine Biochemistry,

Viet Nam

Experimental Animals

Swiss male white mice, from 6 - 8 weeks

of age, and weighing between 23 - 27 grams, were used for this study The mice were obtained from National Institute of Hy-giene and Epidemiology, Viet Nam The ex-perimental animals were caged individually and acclimatised to laboratory conditions for 2 weeks prior to the experiment The study was carried out at the Pharmaceutical Department of Hanoi Medical University Machines and Chemicals

- Streptozotocin 1 g (Sigma-Aldrich, gapore), Buffer solution Citrate pH 4.5

Sin Diamicron (gliclazide) tablets 30 mg (Servier ,France)

- Blood glucose monitoring system On Call EZII (ACON Biotech, USA)

- Animal blood counter Vet Exigo (Bonle Medical AB, Sweden)

- Chemistry analyzer Erba and Test strips: blood triglyceride, HDL-C, cholester-

ol (Transasia, India)

2 Method

The study was divided into two stages [5]:

* The first stage:

Before ending the study, all mice line fasting glucose levels checked from pe-ripheral blood samples

base-+ Group 1: Control condition (n = 10) mice were randomized to one of two group: Normal fat diet regime (NFD) for 8 weeks.+ Group 2: Diabetic condition (n = 70): High fat diet regime (HFD) in 8 weeks fol-lowing Fabiola and Srinivasan method with 43% saturated fat combined siro fructose 55% [6]

After 8 weeks, the fasting glucose level

in all mice was checked Mice in group 2

were injected intraperitoneally with STZ at

a dose of 100 mg/kg Mice in group 1 were

injected intraperitoneally with citrate pH 4.5

After 72 hours (t0), the blood of all mice

of group 2 was checked The mice were

considered diabetic if their blood glucose

concentration was more than 10.0 mmol/L

at that time Diabetic mice were then

ran-domized into four groups from, group 2 to

group 5

* The second stage: The study was

car-ried out in a continuous 14-day period Mice

were divided into five groups of ten animals:

- Group 1: NFD regime + drinking

dis-tilled water;

- Group 2: HFD regime + STZ injection

100mg/kg + drinking distilled water;

- Group 3: HFD regime + STZ injection

After 7 days (t1) and 14 days (tc) of ment, the fasting glucose level of all mice were tested After 14 days of treatment, all animals blood lipid index (total cholester-

treat-ol (TC), triglyceride (TG), HDL-Chtreat-olestertreat-ol, LDL-Cholesterol) were checked Animals were subjected to a full gross necrospy From 30% of each group, mices livers and pancreas were removed for histopathology examination

Statistical analysis

Data was analyzed using Microsoft cel software version 2010 The levels of sig-nificance between groups were determined using student's t-test and Avant-après test Data is shown as mean ± standard devia-tion All data was considered significant at

Ex-p < 0.05

III RESULTS

The results in Figure 1 showed that the weight of mice in the HFD eating regime was nificantly higher than weight of mice in the NFD eating regime at the sixth week (p < 0.001) Hower, 72 hours after STZ injection in the NFD eating group, the weight of the mice in the HFD group was slightly reduced

sig-Table 1 The change in blood glucose level of mice in type 2-like diabetes model

Time

Blood glucose level (mmol/l)

2-1 (t- test Student)

Group 1: Normal control Group 2: Diabetic control

After STZ injection 72

*: p < 0.05: In comparison to before studying

Show in Table 1, the blood glucose level of mice in HFD regime group showed no ences compared to NFD regime group at the time before studying and after 8 weeks (p > 0.05) However, after STZ injection 72 hours, the blood glucose level of mice in group 2 was significantly increased compared to level in group 1 (p < 0.001)

differ-Table 2 Effect on blood glucose level of mice after 2 weeks of treatment

Group

Blood glucose level (mmol/l) (X ± SD) (n = 10)

t 0 (before treatment)

Figure 2 Effect on blood lipid content of mice after 2 weeks of treatment

The result of figure 2 shows lipid disorder conditions TC, TG, HDL-C, LDL-C were in creased in group 2 (diabetic control) in comparison to group 1 (normal control) Blood lip-

id disorders at gliclazide group and CF2 groups were improved, with reduction in TC, TG, LDL-C and increase of HDL-C content in comparison to diabetic control group However,

Histopathological examination of liver and pancreas shows that all mice in group 2 abetic control) were in degenerate condition when compared to group 1 (normal control) Histopathological examination of liver and pancreas of mice treated with gliclazide and two doses of CF2 were improved significantly in comparison to samples from group 2 The results are shown in Figure 3 and Figure 4.

(di-Figure 3 Histopathological image of mice liver after 2 weeks of treatment

Figure 4 Histopathological image of mice pancreas after 2 weeks of treatment

IV DISCUSSION

After 8 weeks of consuming a high fat

diet regime, the blood glucose level in mice

was increased but there was no significant

difference when compared to normal

con-trol mice After mice with HFD eating regime

were injected with STZ at a dose of 100 mg/

kg, the blood glucose level nearly 3 times

higher than before the injection This

mod-el was stably maintained during 2 weeks

of treatment and similar to the model of

ShaoYu [7] These results prove a rich

ener-gy eating regime combined with a low-dose

STZ injection has an effect on

hyperglyce-mia and successfully creates model of type

2 like diabetes

After 7 days and 14 days of treatment,

gli-clazide 80 mg/kg/day, CF2 at a low dose (2

mg/kg/day), and a high dose (4 mg/kg/day)

effectively in reduced blood glucose levels

in type 2-like diabetic mice when compared

to diabetic control group The blood

glu-cose-lowering effect of CF2 at dose of 2 mg/

kg daily was similar to gliclazide 80 mg/kg

daily CF2 at dose of 4mg/kg daily was more

effective than the dose of 2 mg/kg and

gli-clazide 80 mg/kg in reducing blood glucose

level CF2 powder is there a contains

ec-dysteroid which was proved to reduce blood

glucose level in experimental animals In

Ki-zelsztein’s study (2009),

20-hydroxyecdys-on at dose of 10 mg/kg/day reduces blood

glucose level in type 2-like diabetic mice

after 13 weeks through increasing

circulat-ing adiponectin levels [8] Another study by

Sumdaram showed that the administration

of 20-OH-ecdysone results in a significant

restoration towards normal levels of plasma

glucose, insulin, HbA1c, and key drate an enzymes [9]

carbohy-Besides reducing blood glucose, CF2 effected lipid disorder conditions CF2 at two doses of 2 mg/kg/day and 4 mg/kg/day reduced total cholesterol, triglyceride and LDL-C and increased HDL-C, however, differences were not significant This was similar to gliclazides 80 mg/kg/day effect

on regulating lipid disorders This is tent with previous research showing 20-hy-droxyecdyson in Quinoa extract decreased total cholesterol and triglyceride in diet-in-duced obesity mice [10]

consis-The result of histopathological tion showed that there was positive change

examina-in liver and pancreas structure of mice ter 2-week of treatment with either dose of CF2 The experimental medicine improved lipid disorders which is possibly low, it also reduced the degenerate condition of the liv-

af-er Another possible explanation for CF2 is regenerative effect on reason for recreating pancreas structure is the antioxidant activity

of Basket Plant [11]

V CONCLUSION

CF2 lower blood glucose level at doses

of 2 mg/kg and 4 mg/kg daily over 14 days

in type 2-like diabetic mice when compared

I would like to express my deepest

grat-itude to the Department of Pharmacology,

Hanoi Medical University for supporting us

in this study

REFERENCES

1 World Health Organization (2016)

Global report on diabetes 2016 WHO

2 K Ogurtsova, J D da Rocha

Fer-nandes, Y Huang et al (2017) IDF

Dia-betes Atlas: Global estimates for the

prev-alence of diabetes for 2015 and 2040

Diabetes Res Clin Pract, 128, 40 - 50.

3 Katzung B.G (2012), "Chapter

41: Pancreatic Hormones & Antidiabetic

Drugs" Basic and clinical Pharmacology,

The Mc GrawHill company, 743 - 765.

4 Standards of Medical Care in

betes (2017) Summary of Revisions

Dia-betes Care, 40(Suppl 1), S4 - S5.

5 Malviya N Jain S and Malviya S

(2010) Antidiabetic potential of medicinal

plants Acta Poloniae Pharmaceutica, Drug

Research, 67 (2), 113 - 118.

6 Suchý V., Zemlicka M., Svajdlenka

E et al (2008) Medicinal plants and

diabe-tes mellitus Ceska Slov Farm, 57(2), 78 -

84

7 Joash Ban Lee Tan, Wei Jin Yap,

Shen Yeng Tan et al (2014) Antioxidant

Content, Antioxidant Activity, and

Antibac-terial Activity of Five Plants from the

Com-melinaceae Family Antioxidants, 3(4), 758

- 769

8 Zilfikarov I.N Olennikov D.N.,

Toro-pova A.A et al (2008) Chemical

compo-sition of Callisia fragrans Wood Juice and

its antioxidant activity (in vitro) Chemistry

of plant raw material, 4, 95 - 100.

9 L Dinan (2009) The Karlson Lecture

Phytoecdysteroids: what use are they?

Arch Insect Biochem Physiol, 72(3), 126 -

41

10 Lafont R and Dinan L (2009)

In-novative and future applications for teroids Ecdysone: structures and functions

ecdys-Springer Science, New York, 551 – 578.

11 K Srinivasan, B Viswanad, L rat et al (2005) Combination of high-fat di-

As-et-fed and low-dose streptozotocin-treated rat: a model for type 2 diabetes and phar-

macological screening Pharmacol Res,

side, a hypoglycemic glucoside, on

hepat-ic regulating enzymes in diabethepat-ic mhepat-ice duced by a high-fat diet and streptozotocin

in-Acta Pharmacol Sin, 30(12), 202 - 208.

14 Kizelsztein P., Govorko D., Komarnytsky S et al (2009) 20-Hydroxy-

ecdysone decreases weight and cemia in a diet-induced obesity mice model

hypergly-Am J Physiol Endocrinol Metab, 296, 433

THE IMPACT OF SEMINAL ZINC AND FRUCTOSE

CONCENTRATION ON HUMAN SPERM CHARACTERISTIC

Vu Thi Huyen, Nguyen Thi Trang, Luong Thi Lan Anh,

Vu To Giang, Bui Bich Mai, Nguyen Xuan Tung

Department of Biomedical and Genetics, Hanoi Medical University, Hanoi, Vietnam

This study assessed the association between fructose and zinc concentration and various seminal characteristics Fructose and zinc in semen reflect the secretory function of seminal vesicles These tests may help in assessing the diagnosis and the management of male infertility Seminal plasma was gathered from 180 males who averaged 31.1 ± 3,6 in age A specific complexant was used

to form a stable coloured complex with fructose or zinc The colour intensity of the complex in a determining wavelength is proportional to the amount of fructose or zinc present in the sample The study found that seminal fructose concentration was significantly lower in the oligozoospermic group and the azoospermic group in comparison to the with normozoospermic group There were also many significant differences in zinc’s concentration in semen when two of three groups were compared with one another In conclusion, the role of seminal fructose concentration lie not only in the assessing seminal vesicle dysfunction, but also, in conjunction with other seminal properties could give a useful indication of male reproductive function, whilst seminal zinc concentration might not be most appropriate for the assessment of male reproductive dysfunction.

Keywords: infertility, seminal fructose, seminal zinc, azoospermia.

I INTRODUCTION

As many reasons cause male infertility, it

is essential to identify appropriate methods

to diagnose the underlying cause many

tests have been applied previously, such

as semen analysis, genetic tests and

hormone methods Recently, some of these

biochemical markers zinc and fructose, are

like increasingly recognized as important for

diagnosing the cause of male infertility Fructose is essential for spermatozoa metabolism and motility Fructose is

an energy source of spermatozoa It is produced by the seminal vesicles with some contribution from the ampulla of the ductus deferens [1; 2] Absence of fructose

in semen is indicative of ejaculatory duct obstruction or seminal vesicle dysfunction [3; 4]

Apart from fructose, zinc is another factor that is essential for the male reproductive system Deficiency of zinc in the reproductive system causes hypogonadism and gonadal

Corresponding author: Nguyen Thi Trang, Department

of Biomedical and Genetics,Hanoi Medical University.

Email: trangnguyen@hmu.edu.vn

Received: 03 June 2017

hypofunction [5; 6] Many studies have

shown that zinc plays an important role in

sperm mobility an the normal development

of the testicles and prostate [2; 7; 8]

However, in Vietnam, knowledge about

the relationship between seminal zinc and

fructose concentration in human sperm is

scare Therefore, the purpose of this study

was to determine the association between

fructose and zinc concentration and various

seminal characteristics in men

II SUBJECTS AND METHODS

1 Subjects

The study design was descriptive

Fructose and zinc concentration was

measured in the seminal plasma of 180

patients, who visited the Fertility Department

of Hanoi Medical University Hospital from

March, 2016 to March, 2017 after semen

analysis tests showing abnormal seminal

characteristics (sperm concentration, total

count, motility, progressive motility) All the

samples were analyzed according to the

World Health Organization criteria (1992)

On the basis of the assessed parameters,

sperm concentration and sperm motility

were considered as the most important

parameters

2 Method

Measuring the concentration of

fructose and zinc

After semen analysis, samples were

centrifuged at 1500 x g for 10 min and

zinc and fructose concentrations assayed

from the supernatant (i.e seminal

plasma) Zinc concentration was assessed

using spectrophotometry (5- Br- PAPS

method) – direct colorimetric test without deproteinization of the sample At pH 8.6, in a buffered media, zinc react with specific complexant 5-Br-PAPS form a stable color compound Fructose content

in seminal plasma was determined by the resorcinol method where fructose reacts with resorcinol in concentrated hydrochloric acid (HCl) solution to form a red compound Measure the coloric complex of Zinc and Fructose at a wavelength of 560 nm against blanks (ROE, 1976)

Statistical analysis

Statistical analysis was performed using SPSS version 16.0 The means were compared using student t test The statistical tests were considered to be significant at the p ≤ 0.05 level

3 Ethics

Ethical approval to conduct the study was sought from the Hanoi Medical University Permission to use data from the Hanoi Medical University Hospital was sought from the hospital authority All the information from the database was kept under strict confidentiality No names were recorded

± 48.215 billion/ mL), and the mean vitality (86.483 ± 3.218 %) and the mean progressive motility (11.250 ± 10.157 %) in

males with normozoospermia were significantly higher than that in males with oligozoospermia (5.633 ± 4.992 billion/ mL and 58.183 ± 18.14 % and 11.250 ± 10.157 % respectively) (p < 0.01)

Table 1 Seminal fructose and some characteristics of the semen

(Independent sample T – test)

Normozoospermia Mean± SD Oligozoospermia Mean± SD fructose test p-value of

Figure 1 Correlation between seminal fructose concentration (g/l)

and sperm concentration (billion/ml)

Figure 2 Correlation between seminal fructose concentration (g/l)

and sperm vitality (%)

Figure 3 Correlation between seminal fructose concentration (g/l)

and sperm progressive motility (%) Zinc concentration and seminal parameters

Table 2 shows the following:

• The progressive mobility of the low zinc concentration group was 16.87 ± 10.67%, lower than that of the normal zinc concentration group (49.93 ± 15.35%) This difference is statistically significant (z= -11.481, p < 0.01)

• There was no statistically significant difference in mean non- progressive motility

of males with low zinc concentration compared to males with normal zinc concentration (p= 0.19)

Table 2 Seminal zinc concentration and motility of the sperm

(Mann – Whitney test)

Low zinc concentration (n = 84)

Normal zinc concentration (n = 96)

Progressive

motility (%) 16.87 ± 10.67 49.93 ± 15.35 - 11.481 < 0.01 Non- progressive

motility (%) 3.64 ± 2.07 4.07 ± 4.63 - 1.301 > 0.05 Immotile (%) 73.00 ± 21.42 44.07 ± 15.43 10.433 < 0.01

The low zinc concentration group had an immotile percentage of 73.00 ± 21.42% was higher than the normal zinc concentration group (44.07 ± 15.43%) (z = 10.433) This difference was statistically significant with p < 0.001

Seminal zinc concentration showed a significant positive correlation (r = 0.596) with sperm progressive motility (p < 0.01) Negative correlations with sperm immotile (r = - 0.527) which were observed reached statistical significance (p < 0.01)

Figure 4 Correlation between seminal zinc concentration (g/l)

and sperm progressive motility (%) (r = 0.596; p < 0.01) ( Spearman test)

IV DISCUSSION

Fructose is a main carbohydrate source

in seminal plasma and necessary for

sperm motility [9; 10] The measurement

of seminal fructose has been used in

many laboratories Therefore, the World

Health Organization manual recommends

measurement of seminal fructose as a

marker of seminal vesicular function [11]

Methods for determination of seminal

fructose include gas chromatography,

indole coloration, and resorcinol coloration

In particular, the resorcinol method has

been used widely in clinical andrology

laboratories for its simplicity operational,

and high specificity

Fructose is the primary source of

energy for all sperm activities The higher

the sperm concentration, vitality, and,

motility the lower fructose will be [2; 4] Lu

Figure 5 Correlation between seminal zinc concentration (g/l)

and sperm immotile (%) (r = - 0.527; p < 0.01) ( Spearman test)

(2007) reported that when sperm motility increased, fructose decreased, and in vitro, sperm continued using fructose [4] Normal seminal fructose concentration confirms normal levels of testosterone and function

of vesicles and vas deferens [12] Biswas et

al (1978) also reported that when seminal fructose concentration decreased, sperm concentration and mobility increased [13] Furthermore, Lewis Jones et al.,1996 found that fructose concentrations were inversely ratio to sperm motility with R = - 0,062 (p

< 0.05) [7] However, Andrade Rocha (2001) found contrary evidence that that seminal fructose concentration was related

to sperm concentration, survival, motility and morphology, but the association was not statistically significant [14] In Amidu (2012), seminal fructose concentration negatively correlated with sperm motility

(R = - 0.04) but was also not statistically

significant [15] Fructose concentration was

inversely celated to sperm concentration (R

= - 0.21) anh this correlation was significant

at 0.05 [16] Determination of seminal

fructose concentration has been used in

the examination of obstructive azoospermia

and inflammation of male accessory glands

[11; 12; 15] Inflammation may lead to

atrophy of the seminal vesicles and low

seminal fructose concentration When

ejaculatory ducts are blocked, fructose

concentration in seminal plasma usually

decreases and may become undetectable

[12; 17] Additionally, determination of

seminal plasma fructose concentration is

useful for auxiliary diagnosis of obstructive

and nonobstructive azoospermia Seminal

fructose concentration in non-obstructive

azoospermia is usually higher than or

equal to that in males of normal fertility

[9] However, the fructose concentration

in seminal plasma of patients with

obstructive azoospermia is usually absent

or significantly lower than that in men of

normal fertility [12; 15] Absence of seminal

fructose has also been found in patients with

congenital vas deferens-seminal vesicle

developmental defect (Kise et al., 2000;

Kumar et al., 2005) Therefore, our results

are consistent with those reported studies

in other international

One of the biochemical processes

related to genital fluid mixing is the

regulation of the fraction of free seminal

zinc, which can interact with spermatozoa

Zinc is first secreted in prostatic fluid in 2

forms available for sperm cells (free zinc and

however, a partial redistribution of the ion from citrate to very high affinity vesicular ligands reduces the unbound zinc fraction [18 - 20]

The measurement of zinc in human seminal plasma is important in the evaluation of male infertility In the present study, the level of zinc in seminal plasma was found to be mor frequently immotile

in the zinc concentration group was higher (73.00 ± 21.42%) than in the group with normal zinc concentration (44.07 ± 15.43%) (z = 10.433) A positive correlation between zinc levels and sperm concentration and motility was also observed in our study This isin accordance with previous studies of Doshi et al., Hussain et al., Badade et al., Atig et al., and Abed [21 - 25] Eliasson and Lindholme et al., in contrast could not find any correlation between zinc concentration and sperm density, motility, or morphology [26]

Fuse et al., found a positive correlation between zinc and sperm concentration and motility, but no correlation with sperm morphology was observed [27] Mankad

et al., found a positive correlation between zinc and sperm count, but no significant correlation between zinc and sperm motility [28]

Thus, it seems that zinc is important for semen quality The low zinc levels in infertile men in our study might be attributed to disorders in the prostate excretory function

or possibly to asymptomatic prostate infection

Omu (1998), Hadwan (2013), and others found that sperm motility increased after

- 33] However, Omar F Abdul-Rasheed

(2009) found no correlation between zinc

concentrations in semen and sperm motility

[34]

V CONCLUSION

The seminal fructose concentration of

the normozopermia group is significantly

lower than oligozoospermia group Fructose

seminal concentration correclated with

sperm motility

The progressive motility in the low zinc

concentration group is significantly lower

than that of the normal zinc concentration

group The number of immotile sperm in the

low zinc concentration group is significantly

higher than that of the normal zinc

concentration group Zinc concentration has

a positive correlation with sperm progressive

motility and a negative correlation with

immotile both are statistically significant

Acknowledgements

The authors would like to take this

opportunity to extend their sincere thanks to

the Ministry of Health for providing financial

support for the study They also are grateful

for the technical support form the Hanoi

Medical University Hospital for assaying of

seminal fructose and zinc

REFERENCES

1 Schoenfeld C, Amelar RD, Dubin

L, Numeroff M (1979) Prolactin,fructose,

and zinc levels found in human seminal

plasma Fertil Steril 32(2) , 206 - 208.

2 Biswas S., Ferguson K.M.,

Stedronska J et al (1978) Fructose and

hormone levels in semen: their correlations

with sperm counts and motility Fertility and Sterility, 2, 200 - 204.

3 Aumuller G, Riva A (1992)

Morphology and functions of the human

seminal vesicle Andrologia 24(4): 183 -

196

4 Lu C.J (2007) Standardization and

quality control for determination of fructose

in seminal plasma Journal of Andrology, 28

(2), 207 - 213.

5 Sandstead HH, Prasad AS, Schulert AR, Farid Z, Miale A, Jr., Bassilly

S, et al (1967) Human zinc deficiency,

endocrine manifestations and response to

treatment Am J Clin Nutr 20(5):422 - 442.

6 Omu A.E, Dashti H, Al Othman S (1998) Treatment of asthenozoospermic

with zinc sulphate: andrological ,

immunological and obstetric outcome Eur J Obstet Gynecol Reprod Biol, 79, 179 - 184.

7 Lewis Jones D.I., Aird I.A., Biljan M.M (1996) Effects of sperm activity

on zinc and fructose concentrations in

seminal plasma Oxford Journals, Human Reproduction, 11 (11), 2465 – 2467.

8 Basil Oied Mohammed Saleh, Nawal Khiry Hussain, Ali Yakub Majid

et al (2008) Status of Zinc and Copper

Concentrations in Seminal Plasma of Male Infertility and Their Correlation with Various

Sperm Parameters The Iraqi postgraduate medical journal, 7, 76 - 80.

9 Buckett WM, Lewis-Jones DI (2002) Fructose concentrations in seminal

plasma from men with nonobstructive

azoospermia Arch Androl; 48 , 23 – 27.

10 Santiani A., Huanca W., Sapana R., Huanca T., Sepulveda N., Sanchez

R.(2005) Effects on the quality of

frozen-thawed alpaca (Lama pacos) semen using

two different cryoprotectants and extenders

Asian J Androl, 7 , 303 – 309.

11 World Health Organization (1999)

Laboratory Manual for the Examination of

Human Semen and Sperm-Cervical Mucus

Interaction 4th ed Cambridge, United

Kingdom: Cambridge University Press; 1 –

10

12 WHO (1987) Laboratory manual

for the examination of human semen

and semen - cervical mucus interaction,

Cambridge University Press.

13 Biswas S., Ferguson K.M.,

Stedronska J et al (1978) Fructose and

hormone levels in semen: their correlations

with sperm counts and motility Fertil Steril,

2, 200 – 204.

14 Andrade Rocha F.T (2001) Sperm

parameters in men with suspected infertility

Sperm characteristics, strict criteria sperm

morphology analysis and hypoosmotic

swelling test J Reprod Med., 46, 577 –

582

15 Amidu N., Owiredu W.K.B.A,

Bekoe M.A.T (2012) The impact of seminal

zinc and fructose concentration on human

sperm characteristic Journal of Medical

and Biomedical Sciences, 1 (1), 14 – 20.

16 Yassa D.A., Idriss W.K., Atassi

M.E et al (2001) The diagnostic value of

seminal α – glucosidase enzyme index for

sperm motility and fertilizing capacity Saudi

Medical Journal, 22 (11), 987 – 991.

17 Coppens L (1997) Diagnosis and

treatment of obstructive seminal vesicle

pathology Acta Urol Belg, 65 (2): 11 - 19.

Influence of seminal vesicular fluid on the

zinc content of human sperm chromatin Int

J Androl, 13, 232 - 237.

19 Arver S, Eliasson R (1982) Zinc

and zinc ligands in human seminal plasma

II contribution by ligands of different origin

to the zinc binding properties of seminal

plasma Acta Physiol Scand, 115, 217 - 224.

20 Kvist U, Kjellberg S, Björndahl

L, Soufir JC, Arver S.(1990), Seminal

fluid from men with agenesis of the wolffian ducts: zincbinding properties and effects on

sperm chromatin stability Int J Androl,13,

245 - 252

21 Doshi H, Heana O, Hemali T, Minal

M, Sunil K (2008) Zinc levels in seminal

plasma and its relationship with seminal

characteristics Journal of Obstetrics and Gynecology of India, 58, 152 - 155.

22 Hussain NK, Rzoqi SS, Numan

AW, Ali DT (2011) A comparative study of

fructose, zinc and copper levels in seminal

plasma in fertile and infertile men Iraqi Journal of Medical Sciences 9 (1):48.

23 Badade ZG, More KM, Narshetty

JG, Badade VZ, Yadav BK (2011) Human

seminal oxidative stress: correlation with antioxidants and sperm quality parameters

Annals of Biological Research, 2 (5), 351 –

25 Abed AA (2013) Essence of some

trace elements in seminal fluid and their role

in infertility Int J Chem and Life Sciences,

26 Eliasson R, Lindholme C (1971)

Zinc in human seminal plasma Andrologia,

39(4):147 – 153.

27 Fuse H, Kazama T, Ohta S,

Fujiuchi Y(1999) Relationship between

zinc concentrations in seminal plasma and

various sperm parameters Int Urol Nephrol,

31(3), 401 – 08.

28 Mankad M, Sathawara NG,

Doshi H, Saiyed HN, Kumar S (2006)

Seminal plasma zinc concentration and

á-glucosidase activity with respect to semen

quality Biol Trace Elem Res, 110 (2), 97 –

106

29 Marmar J.L, Katz S, Praiss D.E et

al (1975) Semen zinc levels in infertile and

postvasectomy patients and patients with

prostatitis Fertil Steril, 26,1057 – 1063.

30 Hartoma T.R, Nahoul K, Netter A

(1977) Zinc, plasma androgens and male

sterility Lancet, 2, 1125 – 1126.

31 Mahajan S.K, Abbasi A.A, Prasad A.S et al (1982) Effect of oral zinc

therapy on gonadal function in hemodialysis

patients A double-blind study Ann Intern Med, 7, 357 – 361.

32 Wong W.Y, Merkus H.M, Thomas C.M et al (2002) Effects of folic acid and zinc

sulfate on male factor subfertility: a blind, randomized, placebo-controlled trial

infertile men Saudi Med J, 30, 485 - 489.

EFFECT OF ICH TRI VUONG CAPSULE ON PLASMA

LIPID LEVEL AND DEGREE OF ATHEROSCLEROSIS IN

CHOLESTEROL-FED RABBITS

Le Thi Minh Phuong 1 , Nguyen Tran Thi Giang Huong 1 ,

Do Thi Phuong 1 , Nguyen Thi Tuyet Nga 2

1 Faculty of Traditional Medicine, Hanoi Medical University,

2 Military Institute of Traditional Medicine

Ich Tri Vuong capsules (ITV) (components Ginkgo biloba, Radix Salviae miltiorrhi zae, Radix Astragali membranacei and Radix Angelicae sinensis) is used to treat diseases caused by atherosclerosis This study was designed to assess the effects of ITV on plasma levels of total cholesterol, triglyceride, Low-density lipoprotein (LDL), High-density lipoprotein (HDL) and degrees of aorta atherosclerosis in rabbits with induced atherosclerosis by high cholesterol feeds 50 New Zealand White rabbits were divided into 5 groups, 10 per group Experiment conditions were carried out for 8 weeks Normal group: fed with water 2 ml/kg/day Control group: fed cholesterol 0.5 g/kg/day + water 2 ml/kg Atorvastatin group: fed cholesterol 0.5 g/kg/day + Atorvastatin 5 mg/kg/day ITV dose 1 group (60 mg/kg/day): fed cholesterol 0.5 g/kg/day+ ITV 60 mg/kg/day ITV dose 2 group (180 mg/kg/day): fed cholesterol 0.5 g/kg/ngày + ITV 180 mg/kg/day The results suggest that Ich Tri Vuong 180 mg/kg/day may decrease plasma levels of Total cholesterol and LDL and reduce atherosclerotic lesions of rabbits with induced atherosclerosis by high cholesterol feeds when compared to control group These effects were equivalent to Atorvastatin 5 mg/kg/day and better than Ich Tri Vuong 60mg/kg/day There were

no significant differences in HDL and Triglyceride of ITV groups when compared to control group.

Key works: Ich Tri Vuong, Atherosclerosis, plasma lipid

I INTRODUCTION

Atherosclerosis is a disease of large and

medium arteries Lesions begin as fatty

streaks, caused by massive accumulation

of LDL oxidative product [1; 2] with high

blood cholesterol LDL is increased in

the plasma as well, and LDL is subject to

oxidative modifications in the subendothelial

space Monocytes attache to endothelial

cells Adherent monocytes migrate into the subendothelial space and differentiate into macrophages Uptake of oxLDL by macrophages via scavenger receptors leads to foam cell formation Interactions between macrophage foam cells establish

a chronic inflammatory process Smooth muscle cells migrate to the side of inflammation Necrosis of macrophage and smooth muscle cell-derived foam cells leads to the formation of a necrotic core and accumulation of extracellular cholesterol, creating a plaque Macrophage

Corresponding author: Le Thi Minh Phuong, Faculty

of Traditional Medicine, Hanoi Medical University

Email: lethiminhphuong@hmu.edu.vn

Received: 05 June 2017

neovascularization contribute to weakening

of the fibrous plaque The ruptured plaque

is exposed to plasma components,

causing the recruitment of platelets, and

the formation of a thrombus on the medial

portion of the arterial wall The thrombus

proliferates and secretes extracellular

matrix proteins that form a fibrous plaque

[1] Atherosclerosis progresses slowly over

years, and can cause stroke, myocardial

infarction, and peripheral artery disease

These are the mojor causes of disability

and mortality Therefore, treatment of lipid

metabolism disorders, especilly high special

LDL, plays an important role in preventing

atherosclerosis requires [2] Recently,

research show that many herbal medicines

that are used for treating diseases caused

by atherosclerosis have an effect on lipid

metabolism and preventing atherosclerosis

[3; 4]

Ich Tri Vuong capsule component

include: Folium Ginkgo biloba, Radix Salviae

miltiorrhi zae, Radix Astragali membranacei,

and Radix Angelicae sinensis This capscule

is used in the treatment of chronic vertigo,

headache, and insomnia caused by cerebral

atherosclerosis Ich tri vuong components

were used in the “Angelica decoction

for enriching plasma” (Radix Astragali

membranacei, Radix Angelicae sinensis),

a traditional medicine formula which

effects plasma lipid and the expression

of genes related to foam cell formation in

the early stages of atherosclerosis [5]

Other components of Ich Tri Vuong, Folium

Ginkgo biloba and Radix Salviae miltiorrhi

zae, also effect plasma lipids in in-vitro and

in-vivo [6 - 8] Research has shown that Ich

Tri Vuong capsule has no acute and sub acute toxicities [9] To hlear more about Ich Tri Vuong capsule is mechanism of action,

this study was designed to assess the effect

of Ich Tri Vuong capsule on plasma level of

total cholesterol, triglyceride, LDL, HDL and the degree of aorta atherosclerosis in an induced atherosclerosis by high cholesterol feeds rabit model

II SUBJECTS AND METHODS

1 Animal

New Zealand and White rabbits (both male and female gender, body weight 1.8 – 2.5 kg) were supplied by Son Tay Goat and Rabbit Research Center The rabbits were fed with standard rabbit food in the laboratory 7 days prior to the experiment

2 Material

Ich Tri Vuong capsule

Ich Tri Vuong capsule (ITV) components

include 40 mg Folium Ginkgo biloba extract,

150 mg extract of Radix Salviae miltiorrhi zae, and Radix Astragali membranacei, Radix Angelicae sinensis ITV capsules were supplied by the National Institute of Drug Quality Control and stored at room temperature Dose 1 in rabbit was 60 mg/kg/day, dose 2 in rabbit was 180 mg/kg/day

Atorvastatin

Atorvastatin 20 mg tablet, product

of Standa Vietnam, stored at room temperature Dose in rabbits was 5mg/kg/day

Cholesterol oil

Pure cholesterol (product of Germany) was dissolved in peanut oil (product of Tuong An company)

Merk-3 Methods

Rabbits were devided to 5 groups of 10

animals each Experiment conditions were

carried out for 8 weeks.

Normal group: fed water 2 ml/kg/day

Control group: fed cholesterol oil 0.5 g/

kg/day, 1ml/kg, 2 hours later fed water 2 ml/

kg/day

Atorvastatin group: fed cholesterol oil

0.5 g/kg/day, 1ml/kg, 2 hours later fed

Atorvastatin 5mg/kg/day

ITV dose 1 (60 mg/kg/day): fed

cholesterol oil 0.5 g/kg/day, 1ml/kg, 2

hours later fed Ich Tri Vuong 60 mg/kg/day

(equivalent to clinical dose)

ITV dose 2 (180 mg/kg/day): fed

cholesterol oil 0.5 g/kg/day, 1ml/kg, 2 hours

later fed Ich Tri Vuong 180 mg/kg/day (three

time higher than clinical dose)

Determination of plasma lipid levels

The plasma triglycerides (TG), total

cholesterol (TC), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) were determined by commercial assay kits (Hospitex Diagnostics Italy and DIALAB GmbH Austria.) after 4 weeks and 8 weeks

Quantification of gross atherosclerotic lesions

At the end of the 8 week - experiment, 30% of the rabbit aorta was collected for analysis of the aortic lesions The progression of atherosclerosis was graded according to American Heart Association guidelines dividing atherosclerotic lesions into I-VI morphological types [10]

4 Statistical analysis

2 way ANOVA test and Mann–Whitney U test was used to analyze data, and p values less than 0.05 were considered statistically significant

III RESULTS

8 weeks of the high cholesterol diet induced high blood lipids and atherosclerosis in rabbits

of group 2, 3, 4, and 5 with significantly the increases TC, TG, LDL - C, and HDL - C plasma (p < 0.05), and lesions of aorta atherosclerosis seen on histological examination Meanwhile,

in group 1, there was no significant difference in lipids plasma levels with comparable to the begin (p > 0.05), and no lesion of atherosclerosis was seen in the aorta on histological examination

Plasma Lipids level

To assess the effect of Ich Tri Vuong on plasma lipid level, we measured and compared

plasma level of TC, TG, LDL - C, HDL - C at the beginning of the experiment (W0), after 4 weeks (W4) and after 8 weeks (W8)

Figure 1 Plasma level of Total Cholesterol (TC)

In Figure 1, after 4 weeks and 8 weeks, plasma TC level of the Atorvastatin group (10.74

± 8.18 mmol/l and 10.71 ± 6.17 mmol/l) was significantly lower than the control group (21.13

± 9.98 mmol/l and 22.35 ± 10,31 mmol/l) and ITV dose 1 group (23.97 ± 14.28 mmol/l and 17.31 ± 9.56 mmol/l) (p < 0.05) ITV dose 2 group (13.91 ± 9.36 mmol/l and 12.76 ± 7,13 mmol/l) was significantly lower than Control group and had no significant difference to Atorvastatin (p > 0.05) The amount TC increased over 8 weeks in the Atorvastatin group (7.74 ± 5.84 mmol/l) and the ITV dose 2 (10.72 ± 6.77 mmol/l) group was significantly lower than the TC increase in the control group (19.57 ± 9.34 mmol/l) (p < 0.05) There was no significantly difference in the amount TC increased over 8 weeks in the ITV dose 2 group when compared to the Atorvastatin group (p > 0.05)

Figure 2 Plasma level of LDL

In Figure 2, after 4 weeks and 8 weeks, plasma LDL - C level of the Atorvastatin group

(9.35 ± 7.31 mmol/l and 8.98 ± 5.35 mmol/l) were significantly lower than the control group (18.55 ± 9.18 mmol/l and 19.51 ± 9.66 mmol/l) and ITV dose 1 group (21.30 ± 3.12 mmol/l and 14.96 ± 8.58 mmol/l) (p < 0.05) ITV dose 2 group (11.96 ± 8.18 mmol/l and10.59 ± 6.23 mmol/l) was significantly lower than control group (p < 0.05) and had no significant difference

to the Atorvastatin group (p > 0.05) After 8 weeks, increasing levels of plasma LDL level

of Atorvastatin group (6.64 ± 5.13 mmol/l) and ITV dose 2 (9.11 ± 6.01 mmol/l) group were significantly lower than the control group (17.31 ± 8.82 mmol/l) (p < 0.05) The ITV dose

1 group had no significant difference in amount of LDL - C increase over 8 weeks when compared to the control group (p > 0.05) There was no significant difference in ithe amount LDL - C increased over 8 weeks in the ITV dose 2 group when compared to the Atorvastatin group (p > 0.05)

In Figure 3, after 4 weeks and 8 weeks, plasma HDL - C level of the Atorvastatin group (1.39 ± 0.89) and 1.73 ± 0.83 mmol/l) were significantly lower than the control group (2.59 ± 0.91 mmol/l and 2.84 ± 0.69 mmol/l) (p < 0.05) ITV dose 1 group (2.68 ± 1.26 mmol/l and 2.35 ± 1.01 mmol/l) and ITV dose 2 group (1.94 ± 1.20 mmol/l and 2.17 ± 0.94 mmol/l) had

no significant difference to the Control group (p > 0.05) After 8 weeks, the amount that HDL

- C increase over 8 weeks in the Atorvastatin group (1.10 ± 0.74 mmol/l) was significantly lower when the control group (2.26 ± 0.67 mmol/l) (p > 0.05) however the ratio of HDL/LDL in the Atorvastain group (0.19) was higher than the Control group (0.15) There was no significant difference the amount HDL - C increase over 8 weeks in the ITV dose 2 group when compared to the Atorvastatin group (p > 0.05)

Figure 3 Plasma level of HDL

In figure 4, after 4 weeks and 8 weeks, plasma triglyceride level of 5 group had no significantly difference (p > 0.05)

Figure 4 Plasma level of Triglyceride

In figure 4, after 4 weeks and 8 weeks, plasma triglyceride level of all 4 groups had no significant difference when compared to the control (p > 0.05)

Lesions of aortic atherosclerosis

In Figure 5, after 8 weeks, all samples of Normal group and 2/3 sample of Atorvastin group and ITV dose 2 group had no aortic atherosclerotic gross lesions, 3/3 samples of Control group and 2/3 sample of ITV dose 1 had a gross lesion of aortic atherosclerosis

A Normal Control Atorvastatin ITV dose 1 ITV dose 2

Figure 5 Lesion of aortic atherosclerosis

Figure 5: Lesion of aortic atherosclerosis

(A) Aortic arch and histological examination of groups

(B) Degree lesions in aortic arch sections histological examination

In Figure 5, after 8 weeks, all samples of Normal group and 2/3 sample of Atorvastin group and ITV dose 2 group had no aortic atherosclerotic gross lesions, all samples of Control group and 2/3 sample of ITV dose 1 had a gross lesion of aortic atherosclerosis

Histological examination of aortic arch sections were examined to quantify the degree

of atherosclerotic lesions All samples of the Control group and 2/3 samples of ITV dose 1 group had type III lesions There were fewer intimal lession in the Atorvastatin group (with 1/3 sample had type II of lesion, 2/3 sample was normal) and ITV dose 2 group (with 1/3 sample had type II of lesion, 2/3 sample was normal), when compared to the control group

Ich Tri Vuong capsule components

include Folium Ginkgo biloba, Radix Salviae

miltiorrhi zae, Radix Astragali membranacei,

and Radix Angelicae sinensis Capsules

have been used in the treatment chronic

vertigo, headache and insomnia caused by

cerebral atherosclerosis

The results show that ITV dose 180

mg/kg/day and Atorvastatin 5 mg/kg/day

significantly lower plasma level of total

cholesterol and LDL when compared with

the control group ITV dose 180 mg/kg/

day and 60 mg/kg/day had no significant

difference in HDL when compared with the control group The increase over 8 week

of plasma total cholesterol and LDL of the Atorvastatin group (7.74 ± 5.84 mmol/l and 6.64 ± 5.13 mmol/l) and the ITV dose

2 (10.72 ± 6.77 mmol/l and 9.11 ± 6.01 mmol/l) group were significantly lower than the control group (19.57 ± 9.34 mmol/l and 17.31 ± 8.82 mmol/l) (p < 0.05) ITV dose 60mg/kg/day had plasma levels of Total cholesterol significantly lower than the Control group, but had no significant difference in LDL compared with the Control

Normal group Control group Atorvastatin

group ITV dose 1group ITV dose 2group

Type IINormal

group There was no significant difference of

the increase over 8 weeks of plasma lipids

of the ITV dose 2 group when compared

with the Atorvastatin group (p > 0.05)

These effects of Ich Tri Vuong may be

due to effects of its components Previous

studies have shown that Ich Tri Vuong

components had an effect on plasma

lipids, expression of genes related to

foam cell formation in the early stage of

atherosclerosis in a diabetic rat model [5]

Folium Ginkgo biloba and Radix Salviae

miltiorrhi of Ich Tri Vuong also had effects

on plasma lipid in in-vitro and in-vivo model

[6 - 8]

Hypercholesterolemia is a major risk

factor for atherosclerosis [1; 2] In this

research ITV dose 2 group and ITV dose

1 group decreased atherosclerosis lesion

in histological examination of the aortic

arch, when compared with the Control

group The decrease in atherosclerosis

lesions effected by Ich Tri Vuong 180 mg/

kg/day was equivalent to that of Atorvastatin

5 mg/kg/day Atherosclerotic lesions

begin as massive accumulations of LDL

oxidative productions So the lowering

Total cholesterol and LDL effects of Ich

Tri Vuong could mediate the reduction in

atherosclerosis Although Atorvastatin 5

mg/kg/day decreased LDL more than Ich

Tri Vuong 180 mg/kg/day, the eddect on

atherosclerosis lesions of Atorvastatin 5

mg/kg/day was equivalent to the effect of

Ich Tri Vuong 180 mg/kg/day Therefore

Ich Tri Vuong effect on atherosclerosis

pathology may be mediated by more than

one pathway

V CONCLUSION

These results suggest that in an induced

- atherosienrosis rabbit model Ich Tri Vuong

180 mg/kg/day may decrease plasma levels

of Total cholesterol and LDL, and reduce atherosclerosis lesion when compared to control group The effect of ITV 180 mg/kg/day was equivalent to Atorvastatin 5 mg/kg/

day and better than Ich Tri Vuong 60 mg/kg/

day There was no significant difference in HDL and Triglyceride of ITV groups when compared to the control group

Acknowledgments

We would like to thank the staff that participated This work was supported by a research grant of Hanoi Medical University

REFERENCE

1 James S Forrester (2008), The

Pathogenesis of Atherosclerosis and Plaque Instability, Atherosclerosis and Oxidant Stress: A New Perspective, Springer, 1 – 7

2 Judith A Berliner, Mohamad Navab, Alan M Fogelman et al (1995),

Atherosclerosis: basic mechanisms Oxidation, inflammation, and genetics, Circulation, 91(9), 2488 - 2496

3 Hao Xu, Dazhuo Shi, Keji Chen (2012), Atherosclerosis: An Integrative

East-WestMedicine Perspective, Based Complementary and Alternative Medicine, Vol 2012, Article ID 148413, 4 pages, doi:10.1155/2012/148413

Evidence-4 Qing Liu, Jianping Li, Adam Hartstone-Rose et al (2015), Chinese

Herbal Compounds for the Prevention and Treatment of Atherosclerosis: Experimental

Evidence and Mechanisms, Evidence-Based

Complementary and Alternative Medicine,

Vol 2015, Article ID 752610, 15 pages,

http://dx.doi.org/10.1155/2015/752610

5 Zhang H, Chen S, Deng X et al

(2006), The effects of Danggui-Buxue-Tang

on plasma lipid and expression of genes

related to foam cell formation in the early

stage of atherosclerosis in diabetic GK rats,

Diabetes Res Clin Pract, 2006, DOI: http://

dx.doi.org/10.1016/j.diabres.2006.11.005

6 Kobuchi H, Droy-Lefaix MT,

Christen Y et al (1997), Ginkgo bilobu

extract (EGb 761): Inhibitory effect on nitric

oxide production in the macrophage cell line

RAW 264.7, Biochem Pharmacol, 53, 897 -

903

7 Barth SA, lnselmann G,

Heidemann HT (1991), Influences of

Ginkgo bilobu on cyclosporin A induced lipid

peroxidation in human liver microsomes in

comparison to vitamin E, glutathion and

N-acetylcysteine, Biochem Pharmacol, 41,

1521 - 1526

8 S Xu, Z Liu, Y Huang et al

(2012), Tanshinone II-A inhibits oxidized

LDL-induced LOX-1 expression in macrophages by reducing intracellular superoxide radical generation andNF-kB activation, Translational Research, 160 (2),

EFFECT OF TD0014 ON INTRACAVERNOUS PRESSURE ELICITED WITH ELECTRICAL STIMULATION OF THE

CAVERNOUS NERVE IN MALE RATSMai Phuong Thanh 1 , Pham Thi Van Anh 1 , Nguyen Trong Thong 1 ,

Nguyen Thi Huong Lien 2

1 Department of Farmacology, Hanoi Medical University, 2 Sunstar Joint Stock Company

This study aimed to determine the effects of an herbal formula named TD0014 on the induced erection in a rat model Eighteen sixteen-week-old male Wistar rats were used The intracavernous pressure and the arterial blood pressure were simultaneously monitored during cavernous nerve electrical stimulation before and after the administration of TD0014 (1.8 g/kg) Statistical analysis was performed on measurements of maximal intracavernous pressure (MIP), mean arterial blood pressure (MAP) and the MIP/MAP The administration of TD0014 resulted in a significant increase in the baseline level of intracavernosal pressure (ICP) before stimulation in comparison to the control group (P < 0.05) The findings also showed that the maximal ICP and the area under the curve (AUC time × ICP curves)

electrostimulation-in TD0014 group were greater than distilled water group, however, this difference was not significant TD0014 had no significant effect on the mean arterial pressure These results indicated that the herbal formulation TD0014 may have positive and selective effects on improving erectile functions in male rats.

Keywords: TD0014, cavernous nerve stimulation, intracavernous pressure, rat

I INTRODUCTION

Erectile dysfunction (ED) is a term

recommended by a panel of experts in

1992 to replace the term “impotence” [1]

ED is when a man is unable to get and/or

keep an erection It is not a disease, but

a symptom of some other problem, either

physiological, psychological or a mixture

of both [2] Although physiological ED

itself is not life threatening, it is a strong

predictor of high-mortality diseases such as

cardiovascular disease [3] ED does directly

and negatively impact the quality of life of afflicted men and their spouse [4] Recently developed phosphodiesterase type-5 (PDE-5) inhibitors have been widely used as first-line therapeutics to treat ED [5] PDE5 is

an enzyme found primarily in the smooth muscle of the corpus cavernosum that selectively cleaves and degrades cGMP

to 5′-GMP PDE5 inhibitors are similar in structure to cGMP; they competitively bind

to PDE5 and inhibit cGMP hydrolysis The increased amounts of cGMP enhance the effects of NO a potent vasodicator This increase in cGMP in the smooth muscle cells

is responsible for prolonging an erection [6] Although large, multicenter clinical trials have shown the efficacy and tolerability of

Corresponding author: Mai Phuong Thanh, Department

of Pharmacology, Hanoi Medical University

Email: maiphuongthanh@hmu.edu.vn

Received: 05 June 2017

Accepted: 16 November 2017

these drugs in patients with ED of various

etiologies and a broad range of severity;

however, 30% to 35% of patients fail to

respond The use of PDE - 5 inhibitors may

result in several side effects, including visual

disturbances, headache, facial flushing,

rhinitis, and indigestion Other treatments

for ED include penile injection therapy or

penile implants However, such methods

are invasive and irreversible, and are

therefore not widely used [7] Thus, there

is a continued need for the development of

new noninvasive and effective therapies to

treat patients with ED

Despite the remarkable developments

of modern medicine, many people are

still favorably disposed towards herbal

medicines owing to the aggressive

treatment protocols, toxicity, and drug

tolerance associated with modern therapies

The widespread use of herbal medicines,

however, requires scientific verification of

their effects

TD0014 is a preparation which

comprises of thirty-three medicinal plants

The composition of TD0014 has several

medicinal herbs that have been studied

and used since ancient times in traditional

folk medicine as an aphrodisiac [8 - 15]

However, no studies have shown reliable

evidence of their effect on reproductive

function, or toxicity when taken in TD0014

Therefore, the purpose of this study was to

explore the impact of TD0014 on erectile

capacity in adult male rats

II MATERIALS AND METHODS

1 Materials

Herbal formula TD0014 preparation

TD0014 was manufactured as hard pills according to the quality standard of Sunstar Joint Stock Company, Vietnam The major ingredients of the herbal formula are obtained from thirty-three plants (per 7.5g of serving): Tribulus terrestris (4 g), Chrysanthemum sinense (1.83 g), Prunus persica (1.14 g), Vigna cylindrica (1.14 g), Eurycoma longifolia (0.69 g), Sophora japonica (0.57g), Dioscorea persimilis (0.43 g), Dioscorea tokoro (0.4 g), Polygonum multiflorum (0.4 g), Citrus deliciosa (0.34 g), Polyscias fruticosa (0.34 g), Tinospora sinensis (0.29 g), Chaenomeles lagenaria (0.29 g), Passiflora foetida (0.29 g), Zizyphus sativa (0.29 g), Rehmannia glutinosa (0.23 g), Angelica sinensis (0.23 g), Alisma plantago-aquatica L var orientalis Samuelsson (0.23 g), Achyranthes bidentata (0.23 g), Schizandra chinensis (0.23 g), Morinda offcinalis (0.23 g), Rosa laevigata (0.23 g), Allium sativum (0.2 g), Lycium sinense (0.17 g), Glycyrrhiza uralensis (0.14 g), Panax ginseng (0.11 g), Ligusticum wallichii (0.11 g), Cistanche tubulosa (0.11 g), Atractylodes macrocephala (0.11 g), Radix Codonopsis (0.11 g), Cuscuta sinensis (0.11 g), Psoralea corylifolia (0.06 g), Cornu Cervi parvum (7.2 mg) The experimental animals drank the test drug mixed with pure water

Animal groups

Wistar male rats (250 - 300 g), 16 weeks

of age, were used in our study They were housed in groups of six rats per cage in a 24

- hour air - conditioned room with access to standard certified rodent diet and water ad libitum They were acclimated to housing for