kupdf com lehninger principles of biochemistry test bank ch 26pdf

DNA-dependent synthesis of RNA Pages: 996-998 Difficulty: 2 Ans: A Which of the following statements about E.. coli RNA polymerase, the correct order of events for transcription initiat

Trang 1

Multiple Choice Questions

1 DNA-dependent synthesis of RNA

Page: 996 Difficulty: 2 Ans: B

RNA polymerase:

A) binds tightly to a region of DNA thousands of base pairs away from the DNA to be transcribed B) can synthesize RNA chains de novo (without a primer)

C) has a subunit called λ (lambda), which acts as a proofreading ribonuclease

D) separates DNA strands throughout a long region of DNA (up to thousands of base pairs), then copies one of them

E) synthesizes RNA chains in the 3' → 5' direction.

Pages: 996-998 Difficulty: 2 Ans: A

Which of the following statements about E coli RNA polymerase is false?

A) Core enzyme selectively binds promoter regions, but cannot initiate synthesis without a sigma factor

B) RNA polymerase holoenzyme has several subunits

C) RNA produced by this enzyme will be completely complementary to the DNA template

D) The enzyme adds nucleotides to the 3' end of the growing RNA chain

E) The enzyme cannot synthesize RNA in the absence of DNA

Pages: 996-999 Difficulty: 2 Ans: C

Which of the following statements about E coli RNA polymerase (core enzyme) is false?

A) In the absence of the σ subunit, core polymerase has little specificity for where initiation begins B) The core enzyme contains several different subunits

C) The core enzyme has no polymerizing activity until the σ subunit is bound

D) The RNA chain grows in a 5' → 3' direction

E) The RNA product is complementary to the DNA template

Page: 998 Difficulty: 2 Ans: D

RNA polymerase from E coli (core enzyme alone) has all of the following properties except that it:

A) can extend an RNA chain and initiate a new chain

B) is required for the synthesis of mRNA, rRNA, and tRNA in E coli

C) produces an RNA polymer that begins with a 5'-triphosphate

D) recognizes specific start signals in DNA

E) requires all four ribonucleoside triphosphates and a DNA template

Trang 2

The sigma factor of E coli RNA polymerase:

A) associates with the promoter before binding core enzyme

B) combines with the core enzyme to confer specific binding to a promoter

C) is inseparable from the core enzyme

D) is required for termination of an RNA chain

E) will catalyze synthesis of RNA from both DNA template strands in the absence of the core enzyme

Pages: 999-1001 Difficulty: 2 Ans: B

After binding by E coli RNA polymerase, the correct order of events for transcription initiation is:

A) closed complex formation, open complex formation, promoter clearance, start of RNA synthesis B) closed complex formation, open complex formation, start of RNA synthesis, promoter clearance C) open complex formation, closed complex formation, start of RNA synthesis, promoter clearance D) start of RNA synthesis, closed complex formation, open complex formation, promoter clearance E) start of RNA synthesis, open complex formation, closed complex formation, promoter clearance

Which one of the following statements about E coli RNA polymerase (core enzyme) is false?

A) It can start new chains de novo or elongate old ones

B) It has no catalytic activity unless the sigma factor is bound

C) It uses nucleoside 5'-triphosphates as substrates

D) Its activity is blocked by rifampicin

E) Its RNA product will hybridize with the DNA template

Page: 1002 Difficulty: 2 Ans: E

“Footprinting” or DNase protection is a technique used to identify:

A) a region of DNA that has been damaged by mutation

B) E coli cells that contain a desired, cloned piece of DNA

C) the position of a particular gene of a chromosome

D) the position of internally double-stranded regions in a single-stranded DNA molecule

E) the specific binding site of a repressor, polymerase, or other protein on the DNA

Which one of the following statements about eukaryotic RNA polymerases is correct?

A) All three eukaryotic RNA polymerases recognize the same promoters as prokaryotic

polymerases

B) None of the eukaryotic RNA polymerases recognizes prokaryotic promoters

C) Only eukaryotic RNA polymerase I recognizes prokaryotic promoters

D) Only eukaryotic RNA polymerase II recognizes prokaryotic promoters

E) Only eukaryotic RNA polymerase III recognizes prokaryotic promoters

Trang 3

Which of the following is not known to be involved in initiation by eukaryotic RNA polymerase II?

A) DNA helicase activity

B) DNA polymerase activity

C) Formation of an open complex

D) Protein binding to specific DNA sequences

E) Protein phosphorylation

11 RNA processing

Processing of a primary mRNA transcript in a eukaryotic cell does not normally involve:

A) attachment of a long poly(A) sequence at the 3' end

B) conversion of normal bases to modified bases, such as inosine and pseudouridine

C) excision of intervening sequences (introns)

D) joining of exons

E) methylation of one or more guanine nucleotides at the 5' end

Page: 1008 Difficulty: 2 Ans: C

The 5'-terminal cap structure of eukaryotic mRNAs is a(n):

A) 7-methylcytosine joined to the mRNA via a 2',3'-cyclic linkage

B) 7-methylguanosine joined to the mRNA via a 5' → 3' diphosphate linkage

C) 7-methylguanosine joined to the mRNA via a 5' → 5' triphosphate linkage

D) N6-methyladenosine joined to the mRNA via a 5' → 5' phosphodiester bond

E) O6-methylguanosine joined to the mRNA via a 5' → 5' triphosphate linkage

The excision (splicing) of many group I introns requires, in addition to the primary transcript RNA: A) a cytosine nucleoside or nucleotide and a protein enzyme

B) a guanine nucleoside or nucleotide (only)

C) a protein enzyme only

D) a small nuclear RNA and a protein enzyme

E) ATP, NAD, and a protein enzyme

A branched (“lariat”) structure is formed during:

A) attachment of a 5' cap to mRNA

B) attachment of poly(A) tails to mRNA

C) processing of preribosomal RNA

D) splicing of all classes of introns

E) splicing of group II introns

Trang 4

Splicing of introns in nuclear mRNA primary transcripts requires:

A) a guanine nucleoside or nucleotide

B) endoribonucleases

C) polynucleotide phosphorylase

D) RNA polymerase II

E) small nuclear ribonucleoproteins (snurps)

Which one of the following is not true of the mRNA for ovalbumin?

A) Exons are used for polypeptide synthesis

B) Introns are complementary to their adjacent exons and will form hybrids with them

C) The mature mRNA is substantially shorter than the corresponding region on the DNA D) The mRNA is originally synthesized in the nucleus, but ends up in the cytoplasm

E) The splicing that yields a mature mRNA occurs at very specific sites in the RNA primary transcript

Differential RNA processing may result in:

A) a shift in the ratio of mRNA produced from two adjacent genes

B) attachment of the poly(A) tail to the 5' end of an mRNA

C) inversion of certain exons in the final mRNA

D) the production of the same protein from two different genes

E) the production of two distinct proteins from a single gene

Pages: 1015-1016 Difficulty: 3 Ans: A

Which of the following statements about the synthesis of rRNA and tRNA in E coli is true?

A) Both rRNA and some tRNAs are part of the same primary transcript

B) Each rRNA sequence (16S, 23S, 5S) is transcribed into a separate primary transcript

C) Primary tRNA transcripts undergo methylation, but rRNA sequences are not methylated D) The tRNA sequences all lie at the 3’end of the rRNA transcripts

E) There is a single copy of the rRNA genes

Pages: 1018-1019 Difficulty: 2 Ans: C

Which of the following is not usually essential for the catalytic activity of ribozymes?

A) Correct base pairing

B) Correct base sequence

C) Correct interaction with protein

D) Correct secondary structure

E) Correct three-dimensional structure

Trang 5

Which one of the following properties of the L-19 IVS ribozyme is not shared with enzymes that are

purely protein?

A) It acts as a true catalyst

B) It can be competitively inhibited

C) It displays Michaelis-Menten kinetics

D) It exploits base-pairing with internal guide sequences

E) It makes use of covalent and metal ion catalysis

Which one of the following statements about mRNA stability is true?

A) Degradation always proceeds in the 5' to 3' direction

B) Degradation of mRNA by polynucleotide phosphorylase yields 5'-nucleoside monophosphates

C) In general, bacterial mRNAs have longer half-lives than do eukaryotic mRNAs

D) Rates of mRNA degradation ared always at least 10-fold slower than rates of mRNA synthesis E) Secondary structure in mRNA (hairpins, for example) slows the rate of degradation

22 RNA-dependent synthesis of RNA and DNA

Page: 1021 Difficulty: 2 Ans: A

The reverse transcriptase of an animal RNA virus catalyzes:

A) degradation of the RNA strand in a DNA-RNA hybrid

B) insertion of the viral genome into a chromosome of the host (animal) cell

C) RNA formation in the 3' → 5' direction

D) RNA synthesis, but not DNA synthesis

E) synthesis of an antisense RNA transcript

Reverse transcriptase:

A) can utilize only RNA templates

B) has a 3' → 5' proofreading exonuclease but not a 5' → 3' exonuclease

C) is activated by AZT

D) is encoded by retroviruses

E) synthesizes DNA with the same fidelity as a typical DNA polymerase

Compared with DNA polymerase, reverse transcriptase:

A) does not require a primer to initiate synthesis

B) introduces no errors into genetic material because it synthesizes RNA, not DNA

C) makes fewer errors in synthesizing a complementary polynucleotide

D) makes more errors because it lacks the 3' → 5' proofreading exonuclease activity

E) synthesizes complementary strands in the opposite directionfrom 3' → 5'

Trang 6

Page: 1024 Difficulty: 2 Ans: C

AZT (3'-azido-2',3'-dideoxythymidine), used to treat HIV infection, acts in HIV-infected cells by:

A) blocking ATP production

B) blocking deoxynucleotide synthesis

C) inhibiting reverse transcriptase

D) inhibiting RNA polymerase II

E) inhibiting RNA processing

Which one of the following statements about the reverse transcriptases of retroviruses and the RNA replicases of other single-stranded RNA viruses, such as R17 and influenza virus, is correct?

A) Both enzymes can synthesize either RNA or DNA from an RNA template strand

B) Both enzymes can utilize DNA in addition to RNA as a template strand

C) Both enzymes carry the specificity for the RNA of their own virus

D) Both enzymes have error rates similar to those of cellular RNA polymerases

E) Both enzymes require host-encoded subunits for their replication function

Pages: 1030 Difficulty: 2 Ans: C

Aptamers are:

A) double-stranded RNA products of nuclease action on hairpin RNAs

B) repeat sequence elements at the ends of transposons

C) small RNA molecules selected for tight binding to specific molecular targets

D) the RNA primers required for retroviral replication

E) the short tandem repeat units found in telomeres

Short Answer Questions

Page: 996 Difficulty: 2

Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence:

(5')ATCGTACCGTTA(3')

Ans: (3')UAGCAUGGCAAU(5') Also acceptable is (5')UAACGGUACGAU(3')

Pages: 996-998 Difficulty: 2

List one basic property that distinguishes RNA polymerases from DNA polymerases, and list one basic property they share

Ans: Among the distinguishing characteristics: RNA polymerase does not require a primer, but DNA

Trang 7

polymerase does; RNA polymerase lacks the 3' → 5' proofreading exonuclease activity present in

DNA polymerase Among the shared properties: both enzymes use nucleoside triphosphates as substrates, require Mg 2+ and Zn2+, produce an antiparallel complement to the template, and

synthesize nucleic acids in the direction 5' → 3'

Below, an RNA molecule is being transcribed from a strand of DNA Indicate the 5' and 3' ends of

the RNA molecule and of the strand of DNA that is complementary to the RNA molecule In which direction is synthesis occurring?

Ans:

For each of the following statements, indicate with a P if the statement applies only to prokaryotes, an

E if the statement applies only to eukaryotes, and an E & P if the statement applies to both eukaryotes and prokaryotes

_ RNA synthesis is blocked by actinomycin D

_ A single RNA polymerase transcribes genes that encode mRNAs, tRNAs, and rRNA _ Transcription of mRNA is blocked by α-amanitin

_ Sigma (σ) subunit detaches from RNA polymerase shortly after transcription has initiated

_ The 5' end of the mature mRNA begins with a triphosphate

_ The primary mRNA transcript is inacitve

_ Termination of transcription requires the protein ρ factor

Ans: E & P; P; E ; P; P; E; P

Trang 8

The specific sequences that E coli RNA polymerase usually binds to in E coli DNA before initiating

transcription generally contain more A=T base pairs than G≡C base pairs In no more than a few sentences, speculate on why this might be the case

Ans: Because A=T base pairs are stabilized by only two hydrogen bonds (compared with three for

G≡C pairs), double-stranded regions rich in A=T pairs are easier for RNA polymerase to bind and unwind in preparation for the transcription of one of the DNA strands

Describe the sequence of events in the initiation of transcription by E coli RNA polymerase

Ans: The core enzyme plus σ subunit, called holoenzyme, binds to the promoter region forming a closed complex (i.e., in which the DNA double helix is not unwound) This is converted to an open complex by the unwinding of a short region of the promoter Synthesis of the RNA chain begins within the complex The complex then moves along the DNA away from the promoter region and the

σ subunit dissociates

Pages: 1001, 1003 Difficulty: 2

In a ρ-independent terminator, there is a palindrome rich in G≡C base pairs, followed by 8–10 uridine residues Explain how each of the following changes might affect terminator function: (a)

Substitution of cytidines for the 8–10 uridines (b) Mutations in the palindrome that decrease its G≡C content (c) Elimination of half of the palindromic sequence

Ans: (a) This substitution would decrease terminator function by stabilizing the RNA-DNA hybrid

duplex (b) These mutations would decrease terminator function by destabilizing hairpin formation, and the RNA-DNA hybrid will be stabilized as a result (c) Without half the palindrome, the hairpin will not form, and the RNA-DNA hybrid will not be destabilized enough for the terminator to

function

Compare and contrast ρ-dependent and ρ-independent termination of transcription in prokaryotes

Ans: In both, the transcription complex pauses at specific sequences in the DNA template In ρ-independent termination, the formation of hairpin structures causes pausing which leads to

dissociation of the product RNA and the polymerase from the template DNA and hence to

termination In ρ-dependent termination, the features that cause pausing are unclear, and dissociation requires the presence of the ρ protein

The DNA molecule below is believed to contain a binding site for protein X It is labeled at the 5'

end of the top strand (*), then subjected to a footprinting experiment In the idealized gel below, there is a band for every base of the labeled strand On the DNA sequence, point out the binding site for protein X

Trang 9

CCTAAGATTATTTCATTGCGCAATGCTGAACC

[

Ans:

*(5')GGATTCTAATAAAGT|AACGCGTT|ACGACTTGG

CCTAAGATTATTTCA|TTGCGCAA|TGCTGAACC

binding site

Pages: 1003-1005 Difficulty:3

Describe briefly the process of initiation by eukaryotic RNA polymerase

Ans: One transcription factor (TBP) binds specifically to the TATA region of the promoter A

second factor (TFIIB) binds to the first factor, and RNA polymerase binds to the TFIIB-TBP

complex Additional factors bind to produce the complete closed complex that is converted to the open complex by the action of DNA helicases Phosphorylation of the polymerase results in a

conformational change that results in the actual initiation of the RNA chain (See Fig 26-9, p.1004.)

Indicate whether each of the following statements about eukaryotic cells is true (T) or false (F)

_ They have three distinct RNA polymerases

_ Their mRNAs are generally synthesized by RNA polymerase I

_ RNA polymerase III synthesizes only rRNAs

_ The 5S rRNA is synthesized by RNA polymerase I

_ Their RNA polymerases initiate transcription at specific promoter sites on the DNA

Ans: T; F; F; F; T

Name four general types of postsynthetic processing reactions that are observed in RNA Briefly (one sentence or less) point out an example of each type In your example, identify the type of RNA

Trang 10

molecule involved (tRNA, mRNA, rRNA, etc.), the type of “processing” involved, and whether the example is characteristic of eukaryotes or prokaryotes, or both Do not describe specific genes, sequences, complicated structures, or enzymes

Ans: Posttranscriptional reactions on mRNA in eukaryotes include: (1) the removal of introns, (2) the

addition of a 5' cap, and (3) addition of a poly(A) tail In prokaryotes and eukaryotes, tRNAs have

sequences that are (4) trimmed and (5) spliced, (6) bases already incorporated into tRNA are modified

(yielding, for example, pseudouridine and inosine), and (7) a 3'-CCA sequence is sometimes added to

the tRNA Eukaryotic tRNA is also subject to intron splicing and posttranscriptional modification of some bases In prokaryotes and eukaryotes, preribosomal RNAs are (8) cleaved to form individual rRNAs

Describe in words (not using structures) the important features of the structures present on the 5' and 3' ends of mature (processed) eukaryotic mRNAs

Ans: At the 5' end there is a cap consisting of a guanosine joined to the 5'-terminal nucleotide

through a 5' to 5' triphosphate group This guanine nucleotide is methylated on N-7 The next two nucleotides in the chain are also sometimes methylated on their 2'-OH groups At the 3' end is the

poly(A) tail consisting of a run of 80–250 adenylate residues

Describe the mechanistic difference that distinguishes the splicing of group I introns from that of group II introns

Ans: In the group I introns, the initial break in the RNA chain occurs as the hydroxyl group of a

guanine nucleoside or nucleotide makes a nucleophilic attack on the phosphodiester bond In group II

introns, the attacking species is the 2'-hydroxyl group of an adenylate residue in the intron itself

Describe the function of polyadenylate polymerase and name two properties that distinguish it from normal cellular RNA polymerases

Ans: Poly(A) polymerase is required to add the long polyadenylate tail onto the 3' end of eukaryotic

mRNAs Although it uses the ribonucleoside triphosphate ATP, releases pyrophosphate, and

proceeds in the 5' → 3' direction, as do cellular RNA polymerases, unlike them it is not template-directed and it does require a 3'-hydroxyl end to prime synthesis.

Beginning with the primary transcript containing a tRNA sequence, describe the steps in the

formation of a mature tRNA molecule in E coli

Ans: Short sequences at the 5' and 3' ends of the primary transcript are removed by RNase P and D,

respectively A specific enzyme adds —CCA at the 3' end Several bases are modified (e.g., forming

pseudouridine or methylguanosine) In some cases, an intron is spliced out

Định dạng
Số trang	12
Dung lượng	209,01 KB