DSpace at VNU: Differentiating of banked human umbilical cord blood-derived mesenchymal stem cells into insulin-secreting cells

DSpace at VNU: Differentiating of banked human umbilical cord blood-derived mesenchymal stem cells into insulin-secretin...

Differentiating of banked human umbilical cord

blood-derived mesenchymal stem cells

into insulin-secreting cells

Pham Van Phuc&Truong Hai Nhung&

Dang Thi Tung Loan&Doan Chinh Chung&

Phan Kim Ngoc

Received: 20 May 2010 / Accepted: 18 October 2010 / Published online: 17 November 2010 / Editor: J Denry Sato

# The Society for In Vitro Biology 2010

Abstract Umbilical cord blood (UCB)-derived mesenchymal

stem cells (MSCs) are multipotent cells They are able to

differentiate into functional cells from not only mesoderm but

also endoderm Many researches showed that cells derived

from fresh human UCB could transdifferentiate into

insulin-secreting cells In this study, transdifferentiating potential of

cryopreserved human UCB-derived MSCs into

insulin-secreting cell was investigated Fresh human UCB was

enriched the mononuclear cells by Ficoll–Paque centrifugation

The mononuclear cell population was cryopreserved in

cryo-medium containing Iscove’s modified Dulbecco’s media

(IMDM) with 10% DMSO at−196°C for 1 yr After thawing,

mononuclear cells were cultured to isolate MSCs in medium

IMDM with 20% FBS supplemented with growth factors At

the fifth passages, MSCs were confirmed by flow cytometry

about expression of CD13, CD14, CD34, CD45, CD166, and

HLA-DR markers; after that, they were induced to differentiate

into adipocytes and osteoblasts After inducing with specific

medium for islet differentiation, there were many clusters of

cell like islet at day 14–28 Using real-time reverse transcription

polymerase chain reaction (RT-PCR) to analyze the expression

of functional genes, the result showed that Nestin, Pdx-1,

Ngn3, Ils-1, Pax6, Pax4, Nkx2.2, Nkx6.1, Glut-2, Insulin

genes expressed The results showed that MSCs derived from

banked cord blood can differentiate into functional pancreatic

islet-like cells in vitro If human MSCs, especially MSCs from

banked cord blood of diabetes patients themselves can be

isolated, proliferated, differentiated into functional pancreatic

islet-like cells, and transplanted back into them (autologous transplantation), their high-proliferation potency and rejection avoidance will provide one promising therapy for diabetes Keywords Cryopreserved umbilical cord blood Mesenchymal stem cells insulin-secreting cells Umbilical cord blood

Introduction Diabetic mellitus (DM) caused by an absolute insulin deficiency due to the destruction of insulin secreting pancreatic cells (type 1 DM) or by a relative insulin deficiency due to decreased insulin sensitivity (type 2 DM)

is one of the leading reasons of morbidity and mortality in many countries In recent years, cell replacement therapy for DM, especially type 1 DM, has received much more attention However, although islet transplantation could render many patients free from exogenous insulin injections, there are no sufficient organ donors and the recipients may face the risk of anti-rejection therapies (Ryan et al 2001)

Today, significant effort is being given to find alternative means to treat diabetes through stem cell therapy Several reports have been published concerning the differentiation

of many kinds of stem cells into insulin-producing pancreas islet beta cells, including embryonic stem cells (ESCs; Bonner-Weir et al 2000; Shapiro et al.2000; Zulewski et

al 2001), bone marrow-derived MSCs (Petropavlovskaia and Rosenberg 2002), pancreatic stem cells (Lumelsky et

al 2001; Gao et al 2003; Leon-Quinto et al 2004), and umbilical cord blood (UCB stem cells; Sun et al.2007; Gao

et al.2008)

P V Phuc ( *):T H Nhung:D T T Loan:D C Chung:

P K Ngoc

Laboratory of Stem Cell Research and Application,

University of Science, Vietnam National University,

Hanoi, Vietnam

e-mail: pvphuc@hcmuns.edu.vn

DOI 10.1007/s11626-010-9356-5

ESCs have been assumed to be able to differentiate into

any kind of cell lineages However, ethical impediments

and limited resource are obstacles of research on ESCs

Furthermore, even though insulin-secreting cells were

produced by ESCs, teratoma formation was reported after

transplantation into animals (Jahr and Bretzel2003) Adult

stem cells, such as bone marrow mesenchymal stem cells

and pancreatic stem cells, have high immunogenic property

Fetal stem cells, especially cord blood stem cells, have

advantages to become a tool for stem cells therapy in clinic,

mainly because of their low immunogenic property and

relatively simple collecting resource

As the use of autologous or allogeneic hematopoietic

stem cell transplantation in the treatment of various diseases

has grown rapidly in recent years, the idea of UCB banking

for future use has drawn great interest More than 100,000

units of UCB have been collected, frozen, and stored

worldwide in anticipation of their clinical use Study on the

potential of cryopreserved UCB is of great importance for

its future clinical use and we have made an attempt to

investigate the capabilities In this research, we report that

mononuclear cell fractions from cryopreserved UCB

contained stem cells MSCs and they could be differentiated

into insulin-secreting cells The success of this research will

open a new hope to apply umbilical cord blood in diabetic

treatment using stem cell therapy, especially banked

umbilical cord blood

Material and Methods

UCB collection and banking UCB collection Human

UCB was obtained from Hung Vuong Hospital, HCM city,

Vietnam UCB was collected from the umbilical cord vein

with informed consent of the mother A bag system

containing 17 ml of anticoagulant (citrate, phosphate, and

dextrose) was used All UCB units were processed within

3 h after delivery

Isolation of mononuclear cells To isolate mononuclear

cells (MNCs), each UCB unit was diluted 1:1 with

phosphate-buffered solution (PBS) and carefully loaded

onto Ficoll–Hypaque solution (1.077 g/ml, Sigma-Aldrich

Co, USA) After density gradient centrifugation at 800×g

for 16 min at room temperature, MNCs were removed from

the interphase, washed twice with PBS, and resuspended in

Iscove’s modified Dulbecco’s media (IMDM) medium

MNCs were resuspended in cryo-medium (IMDM, 10%

DMSO) at 107–108

cells/ml was cryopreserved

Banking The sample was transferred to a controlled rate

freezer (Planer, Kryo 10, series III; Middlesex, UK) that was

pre-cooled to 0°C The sample was then cooled at 1°C/min

to−12°C, cooled at 20°C/min to −60°C, followed by warming

of the sample at 15°C/min to−18°C, cooled at 1°C/min to −60°C and finally, 3°C/min to−100°C After completion of the freezing protocol, the units were removed from the controlled rate freezer and stored in the vapor phase of nitrogen

Isolation and culture of banked UCB After 1 year cryopreservation, the mononuclear cells were thawed by putting the cryotube into water bath 37°C Prior to further processing, samples were drawn from every unit for viability assessment After that, cell suspension was transferred to T25 culture flask with 3 ml IMDM 20% FBS, 10 ng/ml FGF, 20 ng/ml EGF, 1% antibiotic-mycotic (all bought from Sigma-Aldrich, St Louis, MO) Cultures were maintained at 37°C in a humidified atmo-sphere containing 5% CO2and the medium was changed 2 d later When fibroblast-like cells at the base of the flask reached confluence, they were harvested with 0.25% trypsin EDTA (Sigma-Aldrich, St Louis, MO) and subcultured at 1:3 dilution as passage one

In vitro differentiation Osteogenic differentiation For differentiation into osteogenic cells, the UCB-MSCs at fifth passage were plated at 1×104cells/well in 24-well plates

At 70% confluence, the cells were cultured for 14–21 d in IMDM supplemented with 10% FBS, 10−7 mol/L dexamethasone (Sigma-Aldrich), 50 μmol/L ascorbic acid-2 phosphate (Sigma-Aldrich) and 10 mmol/L β-glycerol phosphate (Sigma-Aldrich; Lee et al 2004) Osteogenic differentiation was confirmed by RT-PCR for osteocalcin and osteopontin gene expression

Adipogenic differentiation For differentiation into adipogenic cells, the cells at fifth passage were plated at 1×104cells/well in 24-well plates At 70% confluence, the cells were cultured for 14–21 d in IMDM supplemented with 0.5 mmol/L 3-isobutyl-1-methylxanthine (Sigma-Aldrich), 1μmol/L dexamethasone, 0.1 mmol/L indomethacin (Sigma-Aldrich) and 10% FBS (Lee

et al 2004) Adipogenic differentiation was evaluated by observing the cells containing lipid oil under microscope Pancreatic endocrine differentiation For pancreatic endo-crine differentiation, expanded MSCs from fifth passage were allowed to reach 80–90% confluence and induced to differentiate into insulin secreting cells by an enhanced three-step protocol (Gao et al 2008) In step 1, the cell monolayer was treated for 24 h with high glucose DMEM (H-DMEM, 25 mmol/L glucose) supplemented with 10% FBS and 10−6mol/L retinoic acid (Sigma-Aldrich), then the medium was changed to H-DMEM with only 10% FBS for

2 d In step 2, the medium was changed to L-DMEM, supplemented with 10% FBS, 10 mmol/L nicotinamide (Sigma-Aldrich) and 20 ng/ml epidermal growth factor

(EGF, Sigma-Aldrich) for 6 d In step 3, to mature the

insulin-secreting cells, the low glucose medium was

supplemented with 10% FBS and 10 nmol/L exendin-4

(Sigma-Aldrich) for 6 d Cellular differentiation was

monitored by observation of three-dimensional formation

of islet like cell clusters, the expression of genes related to

pancreatic endocrine cell development and insulin production

As a control group, cells were cultured in L-DMEM

containing only 10% FBS

Reverse transcription real-time polymerase chain reaction

RNA isolation Cell suspensions were centrifuged at

3,000 rpm, 22°C for 5 min Supernatant was poured away

and discarded Of the of TRI Reagent (Sigma), 1 ml was

added into each 1.5 ml tube and mixed by trituration Then,

tubes were centrifuged at 3,000 rpm, 22°C for 5 min The

supernatant was collected from each tube and transferred

into another new tube In each new tube, 200 μl of

chloroform was added into each tube with the concentration

of 0.2 ml/ml of TRI reagent The tubes were incubated at 4°C

for 5 min before being centrifuged at 12,000 rpm, 4°C for

15 min of The upper aqueous phase, 150μl was collected and

transferred into a new tube Isopropyl alcohol (500μl) was

added into each tube and incubated at room temperature for

10 min for precipitation of RNA After the incubation period,

tubes were centrifuged at 12,000 rpm, 4°C for 10 min

Supernatant was poured away and discarded into waste

beaker To each tube, 1,000μl of 75% ethanol was added,

of which the gel-like RNA pellet was resuspended in Tubes

were centrifuged again at 12,000 rpm, 4°C for 5 min and the

supernatant obtained was removed and discarded RNA

sample was left to air dry briefly for 5 min After drying,

20μl of nuclease-free water was added to dissolve the RNA

pellet

RT-PCR RT-PCR reaction carried out by real-time PCR

one step-one tube using SYBR (QR0100, SYBR Green

Quantitative RT-PCR Kit, Sigma) The primer sequences

were as follows: GAPDH (573 bp), and forward:

AT C A C C AT C T T C C A G G A G C G - 3′, reverse:

5′-GTTCTTCCACCACTTCGTCC-3′; insulin (263 bp): forward

GCAGCCTTTGTGAACCAACA, reverse GTTGCAG

TAGTTCTCCAGGTG; Ngn3 (313 bp): forward GGTA

G A A A G G AT G A C G C C T C ; r e v e r s e C C G A G T T

GAGGTCGTGCAT; Pax4 (496 bp): forward AGGAGGAC

CAGGGACTACCGT; reverse, TTTAGGTGGGGTGT

CACTCAG; Glut-2 (298 bp) forward GTACAATGACA

GAAGATAAG; reverse TGCTACTAACATGGCTTTGA;

Pdx-1 (220 bp) forward GGATGAAGTCTACCAAAGCT

CACGC; reverse, CCAGATCTTGATGTGTCTCTCGGTC;

Pax6 (81 bp): forward TGCGACATTTCCCGAATTCT;

reverse GATGGAGCCAGTCTCGTAATACCT; Isl-1

(493 bp): forward AGCATCAATGTCCTCTCAACTTCC;

reverse TGTTTGGCAAGGCAATGACC; Nkx6.1 (84 bp): forward TCTTCTGGCCCGGAGTGA; reverse CCAA CAAAATGGATCCTTGATGA; Nkx2.2 (154 bp) forward

T C T A C G A C A G C A G C G A C A A C ; r e v e r s e TTGTCATTGTCCGGTGACTC; NeuroD1 (450 bp) forward TCG TTC AGA CGC TTT GCA AG; reverse AGA TTG ATC CGT GGC TTT GG; osteocalcin (266 bp): forward AGG GCA GCG AGGTAG TGA AGA; reverse AAG GGCAAG GGG AAG AGG AAA GAA; osteopontin (330 bp): forward CTAGGCATCACCTGTGCCATACC; reverse CTACTTAGACTACTTGACCAGTGAC nestin (495 bp): forward AGAGGGGAATTCCTGGAG; reverse CTGAGGACCAGGACTCTCTA

CORNING® 8-strip PCR tubes were labeled with the respective genes of interest In each tube, the following was added: to a total volume of 25:12.9μl of PCR Master Mix, 9.6 μl of nuclease-free water, 0.5 μl of forward primer (gene of interest), 0.5 μl of reverse primer (gene of interest), 1.5μl of RNA template After complete addition

of all the components, tubes were centrifuged at 3,000 rpm, 4°C for 3 min Tubes were then loaded into the Eppendorf realplex4Mastercycler epgradient S real-time PCR machine according to the template created using the realplex® program PCR was carried out for 35 cycles, which consisted of pre-soak for 4 min at 94°C, denaturing for

30 s at 94°C, annealing for 30 s at 55–60°C, and extension for 1 min at 72°C, with additional 7-min incubation at 72°C after completion of the cycle

Immunohistochemistry and flow cytometry Immunohisto-chemistry Induced cells were fixed in 4% paraformaldehyde and washed three times by PBS, then incubated with PBS containing 0.3% Triton X-100 (Sigma) and 10% normal serum for 40 min at room temperature Especially for nuclear antigens, the concentration of TritonX-100 was adapted to 0.5% and incubation time to 1 h The cells were then incubated with the primary antibody: mouse anti-human C-peptide antibody (Abcam) and further incubated with the respective secondary antibody: fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Abcam) In all immunochemistry assays, negative staining controls were carried out by omitting the primary antibody Nuclei were detected by Hoescht 33342 (Sigma) staining Images were captured using Carl Zeiss microscope Cell Observer with monochromatic cool camera (Carl Zeiss)

Flow cytometry Antibodies against human antigens CD13, CD14, CD34, CD45, CD166, and HLA-DR were purchased from BD Sciences (San Jose, CA) A total of

5 × 105 cells were resuspended in 200 μl PBS and incubated with FITC- or phycoerythrin (PE)-conjugated antibodies for 20 min at room temperature The fluorescence intensity of the cells was evaluated by flow cytometry using a

flow cytometer (FACScan; BD Sciences) and the data were

analyzed with the CELLQUEST Pro software (BD Sciences)

Diabetic mice model and transplantation Prior to

trans-plantation, streptozotocin (STZ, Sigma) was injected i.p at

40 mg/kg/d into 4–6-wk-old mice for 5 d to induce

experimental diabetes Blood glucose was measured by

Glucometter from snipped tail Only mice with blood glucose

levels stably above 200 mg/dL after the STZ injections were

used in these transplantation experiments For transplantation,

about 1×106differentiated cells in the final induction stage

were injected into the pancreas region near to spleen

Results

Isolation and characterization of human UCB-MSCs The

duration of storage in frozen state for UCB was 1 yr, and

there were no differences in viability depending on the

storage duration When thawed, UCB-derived cells were

recovered with more than 90% viability Frozen

UCB-derived mononuclear cells were plated at a density of 3×105

cells/cm2and formed adherent heterogeneous cell populations

after 4–7 d in culture, which consisted of round and

spindle-shaped cells In the initial passage of culture, the cells

proliferated slowly and gave rise to confluence in 14–21 d

When subcultured, the heterogeneous cell populations changed

into a homogeneous one with flat and fibroblast-like shape

Figure1 shows that the UCB-derived cells closely resembled

BM-MSCs in morphology

Immunophenotypic characterization of UCB-derived

MSCs Fibroblast-like, rapidly dividing cells (Fig 1)

arising from limiting dilution were extensively expanded,

and characterization by flow cytometry revealed that the

cells isolated by the described method were negative for

CD14 (monocyte), CD34 (heamatopoietic stem cell),

CD45 (leukocyte common antigen), indicating these cells

are not of hematopoietic origin Cells were also negative

for HLA-DR UCB-derived cells were found to be positive

for matrix receptors CD166 (Fig.2)

In vitro differentiation of osteocytes and adipocytes from

banked UCB-derived MSCs To investigate the osteogenic

potential of the banked UCB-derived cells, fifth- to

seventh-passage cells were plated at a density of 3×103

cells/cm2 and cultured under conditions appropriate for

inducing differentiation for each lineage When induced to

differentiate under serum-free osteogenic conditions, the

spindle shape of UCB-derived cells flattened and broadened

with increasing time of induction (Fig.3B) The osteoblastic

phenotype was also shown by the expression of marker

genes osteopontin (hOSP) and osteocalcin (hOC) expression (Fig 3D) After 21 d of induction, cells were positive for real-time PCR for osteopontin, osteocalcin (Fig.3D) UCB-derived cells also can be differentiated into adipocytes with lipid vacuoles in cytoplasm (Fig 3B) compare to undifferentiated cells (Fig.3A)

In vitro differentiation of UCB-MSC to insulin-secreting cells Morphological changes of MSC differentiation Under inversed microscope, undifferentiated MSCs were typical of adherent spindle and fibrocyte like However, underdifferentiation, these spindle-like cells changed rapidly into round or oval types with confluence These cells were abundant in endocrinal granules, similar to those differentiated islet cells from ES cells These grape-like cells lasted for at least

2 wk Some cells changed into neuron-like cells with typical processes

Some methods differentiated MSC from fresh UCB successfully Therefore, we tried the similar method to

Figure 1 Phase contrast images of MSCs from human banked UCB UCB-derived cells at 12 –14 d (A) 24–27 d (B) Cells were isolated by direct adherence in our culture medium and pictured after two passages All experiments were performed in triplicate.

induce the banked UCB stem cells into b-like cells without

nestin-positive cells selection After 5–7 d, treated by a

differentiation medium, some cells gathered together and

formed the pancreatic island-like structure (Fig 4A, B)

Immunostaining was applied for detecting the expression of

insulin (Fig 4E; green color) These islet-like structures

were positive for insulin staining

UCB-MSCs were induced to transform into insulin

secreting cells by a three-step protocol At step 1, changes

in cell morphology could not be observed During further

culturing, the rate of cell proliferation decreased and these

spindle-like cells became short and conversed to round

epithelial like cells by the end of step 2—around 9 d after

differentiation Meanwhile, some new islet-like clusters

started to appear, ranging from 200 to 350μm in diameter

At step 3, more islet like clusters were formed (Fig.5)

Gene expression analysis To determine whether

UCB-MSCs had differentiated into insulin-secreting cells,

clusters of cells were identified for gene expression

profiles for pancreatic β-cell differentiation markers were

assessed by real-time RT-PCR After differentiation, all of clusters expressed some genes such as: Nestin, Pdx-1, Ngn3, Isl-1, Pax6, Pax4, Nkx2.2., Nkx6.1, Glut-2, and Insulin Insulin-producing cell transplantation The diabetes treat-ment potential of insulin-producing cells (IPCs) was tested

in vivo in STZ induced diabetes mouse model The blood sugar level of the mice was over 200 mg/dL and did not decreased in 20 d after the last STZ injection These mice were used for the next experiment

Three diabetes mice were grafted with 5×106 IPCs in 0.01 ml PBS The blood sugar level of IPCs grafted mice decreased after 3 d (third d=287.3±31 mg/dl compared to 0th d=306±0 mg/dl); whereas the blood sugar level of PBS-injected diabetes mice continued to increase (third d= 390.7±39.4 mg/dl compared to 0th d=306±0 mg/dL) In the 30 d after graft, although the IPCs grafted mice’s blood sugar level did not decrease to the normal blood sugar level (<120 mg/dl), it did not increase like the control PBS-injected diabetes mice (0th d=306±0 mg/dL com-pared to 30th d=577.5±39.5 mg/dL) and was stable

Figure 2 Immunophenotyping of MSCs from human cryopreserved

UCB Cells were labeled with FITC- or PE-conjugated antibodies and

examined by flow cytometry Histograms demonstrating the

expres-sion of surface molecules were plotted against control (anti-IgG) The

immunophenotypical profile of the UCB-MSCs were positive for

MSC-specific markers such as CD166 (ALCAM), CD13 while negative for CD14 (monocyte antigen), CD34 (HSCs antigen), and CD45 (leukocyte common antigen) and HLA-DR All experiments were performed in triplicate.

(0th d = 306 ± 0 mg/dL compared to 30th d = 342,7 ±

33,8 mg/dL) The normal mice’s weight continued to

increase and was higher than the IPCs- and PBS-injected

diabetes mice’s The weight of control mice decreased

(0th d=28±0 compared to 30th d=21.5±0.5 g), whereas

the IPCs grafted’s increased (0th d=28±0 g compared to

30th d=29.3±1.9 g)

The HPLC result showed that there was no insulin in the

control group, but there was insulin in the IPCs grafted group

In normal mouse serum, insulin was detected (peak time was

29.161 min of normal mice compared to 29.173 min of

standard insulin) There was no insulin in diabetes mice (no

peak time in the standard peak time region) and no insulin in the

control mice In IPCs grafted diabetes mouse serum, insulin

was detected (peak time was 29.212 min of IPCs grafted mice

compared to 29.173 min of standard insulin sample)

Although IPCs could keep the blood sugar level not

increase much, they could not help to decrease the level

Moreover, the grafted cell dose might be small; thus, the diabetes treatment effect was not good So that higher cell density graft studies should be carried out

After 30 graft day, IPCs grafted mice’s blood sugar level was stable Although the blood sugar level was not decreased, it was not increased like the control mice, which tended to increase The vitality of IPCs grafted mice increased and the insulin was presented in the serum of those mice Therefore, IPCs had positive effect on the 30-d diabetes treatment process in mouse model

Discussion Successfully isolating of mesenchymal stem cells from banked cord blood UCB as the power of HSCs has been increasingly used for various clinical settings since 1988

Figure 3 Mesenchymal differentiation potential of MSCs from

human banked UCB After incubation for 2 –3 wk in respective

induction media, banked UCB-MSCs expressed osteoblast with flatten

in shape (B) and positive with two gene osteoclacin and osteopontin

(GAPDH, RT-PCR internal control) (D); formed lipid vacuoles in cytoplasm (C) indicating osteogenic, adipogenic differentiation, respectively All experiments were performed in triplicate.

Since then, hundreds of thousands of UCB collections have

been frozen and stored throughout the world, in anticipation

of their potential use to treat various disorders Thus, study

on the long-term storage of UCB-derived stem cells

including HSCs and MSCs is of critical importance We

have investigated whether MNC fractions from banked

UCB-contained stem cells which represented typical

characteristics of MSCs When thawed, the

UCB-derived cells were recovered with more than 90%

viability, regardless of the storage duration within 1 yr

The adherent fibroblast-like cell populations obtained in

this study gave rise to MSC characteristics in regard to

morphology, immunophenotypes, and differentiation

potential

The primary culture initially consisted of two main

populations such as round and spindle-shaped cells As the

culture progressed with trypsinization, the CD14 and

CD45-positive round and spindle-shaped cells gradually

decreased and eventually disappeared by week 4–6

Fibroblast-like cells remained homogeneous in morphology and they were CD44 and CD166 (activated leukocyte cell adhesion molecule; ALCAM)-positive These cells showed prolonged proliferative capacity without any morphological changes for more than six passages (over 3 mo) and had a differentiation potential to mesenchymal derivatives including osteoblast, adipocyte These characteristics were consistent with the results from BM-MSCs originally described by Fridenstein et al and fresh cord blood (Lee et al.2004) These observations elucidated that specific genes for multi-lineages are present in the banked UCB-derived cells, allowing these cells to multi-lineage differentiation

Our results, together with other studies including the works of Erices et al and Rosada et al., provide strong evidence for the presence of circulating non-hematopoietic stem cells including MSCs in human UCB units The assessment of the growth factors, and prolonged prolifera-tion and differentiaprolifera-tion of these circulating stem cells remain to be investigated, and further studies are necessary

Figure 4 Morphological changes in endocrine differentiation (A)

after 9 d: cells became aggregate to form clusters, (B) after 21 d: the

clusters became more condensed (C) A cell cluster was captured in

normal light, (D) stained nuclei with Hoechst 3342, (E) stained with anti-human C-peptide antibody (FITC).

to explore the full potential of these cells Also, the origin

and the mechanisms of homing of the cells to various

stromal cell compartments such as bone marrow remain to

be determined In summary, this is the first report to show

MSCs with the high proliferative and differentiation

potential present in the cryopreserved human UCB The in

vitro isolation, expansion, and characterization of

UCB-MSCs can be used for the development of basic research

and therapeutic strategies such as cellular and genetic

therapy

Mesenchymal stem cells from banked cord blood can

differentiate into insulin-producing cells Multipotent stem

cells within pancreas and outside could develop into

insulin-secreting islet cells (Jensen et al.2000; Soria et al

2000; Assady et al.2001; Guz et al.2001; Lumelsky et al

2001; Hori et al.2002; Shiroi et al.2002; Gao et al 2003;

Hardikar et al 2003; Kim et al 2003) However,

differentiation of various stem cells into islet cells has two

major obstacles preventing clinical application As these

stem cells do not originate from DM patients, these cells

transplanted would be rejected by DM recipients The

source is not enough to provide abundant stem cells Cord

blood-derived mesenchymal cells are multipotent and can

differentiate into lineages of mesenchymal tissues, such as bone, cartilage, fat, tendon, muscle, adipocytes, chondrocytes, and osteocytes (Pittenger et al 1999; Krause et al 2001; Jiang et al.2002) MSCs could differentiate into endodermal and epidermal cells, such as vascular endothelial cells, neurocytes, lung cells, and hepatocytes (Petersen et al

1999; Schwartz et al 2002; Davani et al 2003) MSCs as differentiation donors are of advantages compared with other stem cells as ESC or stem cells from organs MSCs are of great multiplication potency Cell-doubling time is 48–72 h, and cells could be expanded in culture for more than 60 doublings (Reyes et al.2001) Functional cells differentiated from MSCs transplanted into MSC donors (autologous transplantation) would not cause any rejection

Differentiation of MSCs derived from banked cord blood into functional pancreatic islet cells is not yet reported Ianus et al (2003) reported, using a CRE-LoxP system, bone marrow from male mice with an enhanced green fluorescent protein (GFP) replacing insulin expression was transplanted into lethally irradiated recipient female mice After 4–6 wk, recipient mice revealed both Y chromosome and GFP positivity in pancreatic islets These GFP positive cells expressed insulin, glucose transporter-2 and other islet cell-related markers Cells from fresh bone marrow, cord

Figure 5 The HPLC result

showed that there was no

insulin in the control group A,

but there was insulin in the IPCs

grafted group B Blue line

standard insulin sample,

red line mouse serum.

blood were able to differentiate into islet cells MSCs could

differentiate into hepatocytes (Petersen et al 1999;

Schwartz et al 2002; Davani et al.2003), precursor cells

of hepatocytes could differentiate into pancreatic islet cells,

adult hepatic stem cells could trans-differentiate into

pancreatic endocrine hormone-producing cells (Deutsch et

al.2001; Yang et al.2002)

We found that banked cord blood-derived MSCs could

successfully differentiate into pancreatic islet-like cells

These cells were morphologically similar to pancreatic islet

cells More importantly, they could also transcript, translate,

and excrete insulin Cells were injected mice models,

although lack of statistical data, these MSC-derived cells

could regulate blood glucose level Nestin was regarded as

a marker of precursors of pancreatic islet cells In our study,

nestin, Glut-1, insulin and some another genes were also

positive in prepancreatic islet MSCs, suggesting that MSCs

could differentiate into islet cells

Conclusion

In conclusion, MSCs derived from banked cord blood can

differentiate into functional pancreatic islet-like cells in

vitro If human MSCs, especially MSCs from banked cord

blood of diabetes patients themselves can be isolated,

proliferated, differentiated into functional pancreatic

islet-like cells, and transplanted back into them (autologous

transplantation), their high proliferation potency and

rejection avoidance will provide one promising therapy

for diabetes

References

Assady S.; Maor G.; Amit M.; Itskovitz-Eldor J.; Skorecki K L.;

Tzukerman M Insulin production by human embryonic stem

cells Diabetes 50: 1691 –1697; 2001.

Bonner-Weir S.; Taneja M.; Weir G C.; Tatarkiewicz K.; Song K H.;

Sharma A et al In vitro cultivation of human islets from

expanded ductal tissue Proc Natl Acad Sci USA 97: 7999 –8004;

2000.

Davani S.; Marandin A.; Mersin N.; Royer B.; Kantelip B.; Herve P.;

Etievent J P.; Kantelip J P Mesenchymal progenitor cells

differentiate into an endothelial phenotype, enhance vascular

density, and improve heart function in a rat cellular cardiomyoplasty

model Circulation 108(Suppl 1): II253 –258; 2003.

Deutsch G.; Jung J.; Zheng M.; Lora J.; Zaret K S A bipotential

precursor population for pancreas and liver within the embryonic

endoderm Development 128: 871–881; 2001.

Gao F.; Wu D.; Hu Y.; Jin G Extracellular matrix gel is necessary for

in vitro cultivation of insulin producing cells from human

umbilical cord blood derived mesenchymal stem cells Chinese

Medical Journal 121(9): 811 –818; 2008.

Gao R.; Ustinov J.; Pulkkinen M A.; Lundin K.; Korsgren O.;

Otonkoski T Characterization of endocrine progenitor cells and

critical factors for their differentiation in human adult pancreatic cell culture Diabetes 52: 2007 –2015; 2003.

Guz Y.; Nasir I.; Teitelman G Regeneration of pancreatic beta cells from intra-islet precursor cells in an experimental model of diabetes Endocrinology 142: 4956–4968; 2001.

Hardikar A A.; Marcus-Samuels B.; Geras-Raaka E.; Raaka B M.; Gershengorn M C Human pancreatic precursor cells secrete FGF2 to stimulate clustering into hormone-expressing islet-like cell aggregates Proc Natl Acad Sci USA 100: 7117–7122; 2003 Hori Y.; Rulifson I C.; Tsai B C.; Heit J J.; Cahoy J D.; Kim S K Growth inhibitors promote differentiation of insulin-producing tissue from embryonic stem cells Proc Natl Acad Sci USA 99:

16105 –16110; 2002.

Ianus A.; Holz G G.; Theise N D.; Hussain M A In vivo derivation

of glucose-competent pancreatic endocrine cells from bone marrow without evidence of cell fusion J Clin Invest 111: 843 – 850; 2003.

Jahr H.; Bretzel B Insulin positive cells in vitro generated from rat bone marrow stromal cells Transplant Proc 35: 2140 –2141; 2003.

Jensen J.; Heller R S.; Funder-Nielsen T.; Pedersen E E.; Lindsell C.; Weinmaster G.; Madsen O D.; Serup P Independent development

of pancreatic alpha- and beta-cells from neurogenin3-expressing precursors: a role for the notch pathway in repression of premature differentiation Diabetes 49: 163–176; 2000.

Jiang Y.; Jahagirdar B N.; Reinhardt R L.; Schwartz R E.; Keene C D.; Ortiz-Gonzalez X R.; Reyes M.; Lenvik T.; Lund T.; Blackstad M.; Du J.; Aldrich S.; Lisberg A.; Low W C.; Largaespada D A.; Verfaillie C M Pluripotency of mesenchymal stem cells derived from adult marrow Nature 418: 41 –49; 2002 Kim D.; Gu Y.; Ishii M.; Fujimiya M.; Qi M.; Nakamura N.; Yoshikawa T.; Sumi S.; Inoue K In vivo functioning and transplant table mature pancreatic islet-like cell clusters differentiated from embryonic stem cell Pancreas 27: E34 –E41; 2003.

Krause D S.; Theise N D.; Collector M I.; Henegariu O.; Hwang S.; Gardner R.; Neutzel S.; Sharkis S J Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cells Cell 105: 369 –377; 2001.

Lee O K.; Kuo T K.; Chen W M.; Lee K D.; Hsieh S L.; Chen T H Isolation of multipotent mesenchymal stem cells from umbilical cord blood Blood 103: 1669–1675; 2004.

Leon-Quinto T.; Jones J.; Skoudy A.; Burcin M.; Soria B In vitro directed differentiation of mouse embryonic stem cells into insulin producing cells Diabetologia 47: 1442 –1451; 2004 Lumelsky N.; Blondel O.; Laeng P.; Velasco I.; Ravin R.; McKay R Differentiation of embryonic stem cells to insulin secreting structures similar to pancreatic islets Science 292: 1389 –1394; 2001.

Petersen B E.; Bowen W C.; Patrene K D.; Mars W M.; Sullivan A K.; Murase N.; Boggs S S.; Greenberger J S.; Goff J P Bone marrow as a potential source of hepatic oval cells Science 284:

1168 –1170; 1999.

Petropavlovskaia M.; Rosenberg L Identification and characterization

of small cells in the adult pancreas: potential progenitor cells? Cell Tissue Res 310: 51 –58; 2002.

Pittenger M F.; Mackay A M.; Beck S C.; Jaiswal R K.; Douglas R.; Mosca J D.; Moorman M A.; Simonetti D W.; Craig S.; Marshak D R Multilineage potential of adult human mesenchymal stem cells Science 284: 143 –147; 1999.

Reyes M.; Lund T.; Lenvik T.; Aguiar D.; Koodie L.; Verfaillie C M Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells Blood 98: 2615 –2625; 2001 Ryan E A.; Lakey J R T.; Rajotte R V.; Korbutt G S.; Kin T.; Imes

S et al Clinical outcomes and insulin secretion after islet transplantation with the Edmonton protocol Diabetes 50: 710 – 719; 2001.

Schwartz R E.; Reyes M.; Koodie L.; Jiang Y.; Blackstad M.; Lund

T.; Lenvik T.; Johnson S.; Hu W S.; Verfaillie C M Multipotent

adult progenitor cells from bone marrow differentiate into

functional hepatocyte-like cells J Clin Invest 109: 1291 –1302;

2002.

Shapiro A M.; Lakey J R.; Ryan E A.; Korbutt G S.; Toth E.;

Warnock G L et al Islet transplantation in seven patients with type

1 diabetes mellitus using a glucocorticoid-free immunosuppressive

regime N Engl J Med 343: 230–238; 2000.

Shiroi A.; Yoshikawa M.; Yokota H.; Fukui H.; Ishizaka S.; Tatsumi

K.; Takahashi Y Identification of insulin-producing cells derived

from embryonic stem cells by zinc-chelating dithizone Stem

Cells 20: 284 –292; 2002.

Soria B.; Roche E.; Berna G.; Leon-Quinto T.; Reig J A.; Martin F.

Insulin-secreting cells derived from embryonic stem cells

normalize glycemia in streptozotocin-induced diabetic mice Diabetes 49: 157 –162; 2000.

Sun B.; Roh K.-H.; Lee S.-R.; Lee Y.-S.; Kang K.-S Induction of human umbilical cord blood-derived stem cells with embryonic stem cell phenotypes into insulin producing islet-like structure Biochemical and Biophysical Research Communications 354: 919–923; 2007.

Yang L.; Li S.; Hatch H.; Ahrens K.; Cornelius J G.; Petersen B E.; Peck A B In vitro trans-differentiation of adult hepatic stem cells into pancreatic endocrine hormon producing cells Proc Natl Acad Sci USA 99: 8078 –8083; 2002.

Zulewski H.; Abraham E J.; Gerlach M J.; Daniel P B.; Moritz W.; Muller

B et al Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes Diabetes 50: 521 –533; 2001.