Expression of long noncoding RNA GAS5 associated with clinic pathologic factors of gastric cancer

Corresponding author: Nguyen Trong Tue, Center forGene and Protein Research, Hanoi Medical University E-mail: ntt.bio@gmail.com Received: 06 November 2016 Accepted: 10 December 2016 EXPR

Corresponding author: Nguyen Trong Tue, Center for

Gene and Protein Research, Hanoi Medical University

E-mail: ntt.bio@gmail.com

Received: 06 November 2016

Accepted: 10 December 2016

EXPRESSION OF LONG NONCODING RNA GAS5 ASSOCIATED WITH CLINIC PATHOLOGIC FACTORS OF GASTRIC CANCER

Nguyen Dang Bao 1 , Nguyen Trong Tue 2 , Tran Hieu Hoc 3 , Nguyen Van Hung 3 , Tran Van Khanh 2 , Pham Duc Huan 4 , Ta Thanh Van 2

1

General surgery Department, Gialai General Hospital, 2 Center for Gene - Proteine Research,

Hanoi Medical University, 3 Bach mai Hospital, 4 Hanoi Medical University Hospital Gastric cancer is the world’s third most common cause of cancer-related death It remains difficult to cure, particularly in less developed countries Several recent studies revealed that long noncoding RNAs (lncRNAs) could play a critical role in tumor biology Dysregulation of lncRNA expression has been reported

in different types of cancers, including gastric cancer, but its role in gastric cancer remains unknown This study was designed to investigate the expression pattern, biological role and clinical significance of lncRNA GAS5 in gastric cancer LncRNA GAS5 was isolated from 48 cancer tissues and 48 non - cancer gastric tissues of gastric cancer patients in Vietnam LncRNA GAS5 levels were determined via quantitative reverse -transcription polymerase chain reaction (Qrt - PCR) and normalized to the expression of GAPDH Differences between groups were tested for significance using the 2 -ΔΔCt method Our results show that expression of GAS5 was lower in gastric cancer tissues than in normal gastric tissues and was associated with tumor size, invasion depth and pathologic stage GAS5 may represent a new marker of prognosis for gastric cancer patients.

Keywords: Gastric cancer, Long noncoding RNA, GAS5, tumor suppressor, marker cancer

I INTRODUCTION

prevails as the third most common cause of

cancer - related death Estimations suggest

that 35% of affected patients present with

syn-chronous distant metastases [1]

Approxi-mately 9.5 million new gastric cancer cases

and 7.2 million deaths are recorded annually

[2] Despite improvements in diagnostic

tech-niques and advances in treatments, patients

with advanced or metastatic gastric cancer

continue to face a poor prognosis Moreover,

the average survival period after diagnosis is

less than 1 year [3] One of the major causes

of cancer mortality is tumor metastasis; thus, early diagnosis of gastric cancer is of particu-lar significance to prevent early death

Eukaryotic genomes encode numerous long non - coding RNAs (lncRNAs), which represent a class of RNA molecules longer than 200 nucleotides without open reading frames of significant length or with limited protein - coding potential [4] Recently, many studies have revealed that lncRNAs could play

a critical role in regulating gene expression at various levels, e.g., chromatin modification, transcription and post - transcriptional proc-essing [5], Furthermore, they also play an importnat role in many biological processes, including cellular differentiation, invasion, and metastasis [6; 7] Based on their functions, lncRNAs can be roughly divided into onco-genic and tumor - suppressor groups [8]

Indeed, it is now widely acknowledged that

lncRNAs are likely to be of crucial importance

in the pathogenesis of cancer; therefore, a

better understanding of lncRNA biology may

lead to novel and better approaches for cancer

diagnosis and treatment

LncRNA expression has been reported in

different types of cancers, including lung

can-cer, breast cancer, hepatocellular carcinoma

and gastric cancer [9 - 13] In addition, levels

of circulating lncRNAs have been used for

cancer diagnosis and prognosis [14; 15] and

have also been considered as potential

biomarkers and therapeutic targets for gastric

cancer [12] GAS5 lncRNA is a transcript of

the growth arrest - specific 5 (GAS5) gene, a

non-protein coding gene It was first isolated in

1988 during a search for novel tumour

suppressors, where subtractive cDNA cloning

was used to identify genes that are

preferen-tially expressed in growth - arrested cells [16]

GAS5 lncRNA negatively regulates the growth

of cell line in various cancers [17] and the

ot-her systems demonstrate that GAS5 exerts

complementary effects on cell proliferation

(inhibitory) and apoptosis (stimulatory) and

together these are likely to form the main

ba-sis of its tumour suppressor activity in vivo

[17] Furthermore, another study showed that

GAS5 was significantly downregulated in

gastric cancer tissues of Chinese patients and

that GAS5 expression was associated with

larger tumor size and advanced pathologic

stage Patients with low GAS5 expression

levels had poorer disease - free survival and

overall survival than those with high GAS5

expression [12] Nevertheless, the overall

ncRNA in other cancers For example, GAS5 and/or its snoRNAs have been shown to be aberrantly expressed in breast cancer, head

glioblastoma multiforme and non-small-cell lung cancer [18] Abnormally low levels of GAS5 expression may therefore reduce the effectiveness of chemotherapeutic agents [19] Previous studies have also shown that lncRNA GAS5 was downregulated and served as a tumor-suppressor lncRNA in prostate cancer cells, renal cell carcinoma, cells and breast cancer cells [8; 19; 20] In this study, we investigated the potential relationship between GAS5 lncRNA level in gastric cancer tissues and the clinicopathologic features of the disease, as well as the clinical outcome

II SUBJECTS AND METHODS

1 Subjects

Tissue collection

Samples were obtained from 48 patients who had undergone surgery at the Hanoi Medical University Hospital, Viet Duc Hospital,

or Bach Mai Hospital from October 2015 to August 2016 The patients were diagnosed with gastric cancer based on histopathological evaluation Clinicopathologic information was available for all samples (Table 1) These pa-tients did not receive any treatment before the operation All specimens were immediately frozen in liquid nitrogen and stored at −80°C until RNA extraction

2 Methods

RNA extraction and qRT-PCR analyses

by using qScript™ cDNA SuperMix (Quanta

BioScience, America) Real-time PCR

analy-ses were performed with "PerfeCTa® SYBR®

America) Results were normalized to the

expression of GAPDH The PCR primers for

GAS5 or GAPDH were as follows:

GAS5 - F1: 5’ -CCTGTGAGGTATGGTGCTGG

- 3’

GAS5 - F2: 5’ -CTGTGTGCCAATGGCTTGAG

- 3’

GAPDH - F1: 5’-

CTTCTTTTGCGTCGCC-AGCCG - 3’

GAPDH - F2: 5’- CTTCCCGTTCTCAGCCTTGAC

- 3’

qRT - PCR and data collection were

per-formed on Effpendor Realplex mastercycler

The relative expression of GAS5 was

ana-lysed using the 2−ΔΔCtmethod for relative

quan-titation and normalized to GAPDH

Statistical analysis

Group comparisons, correlations and

asso-ciations were performed using SPSS statistical

software (version 16.0, SPSS Inc) and the Chi

-Square test A p-value less than 0.05 was

considered statistically significant when

com-paring the differences between patient groups

3 Research ethics: This research was

approved by the ethics committee of the Hanoi

No.187-HMUIRB, signed February 20, 2016

III RESULTS

Expression of GAS5 is down - regulated

in human gastric cancer tissues

GAS5 RNA levels in 48 pairs of gastric cancer samples and adjacent, histologically normal tissues were examined by qRT - PCR and normalized to GAPDH Figure 1 showed that the GAS5 level was significantly de-creased in 62.5% (30/48) of gastric cancer tissues compared with corresponding adjacent non - tumorous tissues Moreover, in cancer-ous tissues, GAS5 expression in the cancer tissues was at a lower level than that of the normal comparison specimens These data indicate that abnormal GAS5 expression may

be related to gastric cancer pathogenesis

The relationship between GAS5 expres-sion and clinicopathologic factors in patients with gastric cancer

The clinical pathology of the 48 gastric car-cinoma patients included in this study are shown in table 1 The patients were divided into two groups according to the relative GAS5 expression in their tumor tissues: a relative high - GAS5 expression group (n = 30, GAS5 expression ratio ≥ 1) and a relative low - GAS5 expression group (n = 18, GAS5 expression ratio ≤ median ratio) (Figure 1) Clinicopa-thologic features were compared between the two groups (table 2) The low - GAS5 group was found to have greater tumor size (p = 0.032), higher TNM stage (p = 0.001), greater invasion depth (p = 0.037), more regional lymph nodes (p = 0.001) and more lymphatic metastases (p = 0.001) However, GAS5 expression level was not associated with other parameters such as gender (p = 0.431), age (p = 0.662), tumor location (p = 0.179) and histologic differentiation (p = 0.574) (table 2)

Table 1 Clinicopathological characteristics and GAS5 expression in 48 tissue samples of

patients with gastric cancer

Age (years)

Gender

Location

Size

Histologic diffentiation

Invasion depth

TNM Stages

Clinical parameter n (%)

Lymphatic metastasis

Regional lymph nodes

Distant metastasis

Figure 1 Relative expression of GAS5 in gastric cancer tissues (n = 48) compared with

corresponding non - tumor normal tissues (n = 48)

GAS5 expression was examined by qRT - PCR and normalized to GAPDH expression Data was presented as fold - change in tumor tissues relative to normal tissues Patients’ GAS5 expression was classified into two groups based on relative GAS5 expression in tumor tissues: a relative high - GAS5 expression group (n = 18, red columns) and a relative low-GAS5 expression group (n = 30, blue columns)

Table 2 Correlation between GAS5 expression and clinicopathological characteristics in

patients with gastric cancer

Clinical parameter

GAS5 (number of case) Chi - Square test

p-value

High - GAS5 group Low - GAS5 group Age (years)

0.662

Gender

0.431

Location

0.179

Size

0.032

Histologic differentiation

0.574

Invasion depth

0.037

Clinical parameter

GAS5 (number of case) Chi-Square test

p-value

High-GAS5 group Low-GAS5 group TNM Stages

0.001

Lymphatic metastasis

0.001

Regional lymph nodes

0.001

Distant metastasis

0.048

IV DISCUSSION

Long non - coding RNAs are a class of

recently discovered non-protein coding RNAs

> 200 nucleotides in length, with a role in

differentiation Their dysregulation has been

detected in various diseases, most notably

cancer Recent studies have shown that many

lncRNAs are dysregulated in various solid

tumors Several lncRNAs can regulate cancer

metastasis by directly targeting chromatin modification complexes, indicating that the abnormal expression of lncRNAs increases the chance of tumorigenesis and cancer development However, at present, only a few lncRNAs have been functionally studied in detail and many important questions remain unanswered [21] Therefore, identification of cancer - associated lncRNAs and investigation

of their clinical significance and functions may

provide a missing piece of the well - known

oncogenic and tumor suppressor network

puzzle

Human GAS5 is encoded at 1q25, a locus

that has been associated with abnormalities in

several types of cancer cells, including

prostate cancer cells, renal cell carcinoma

cells and breast cancer cells [8; 19; 20] Low

GAS5 expression is an adverse prognostic

factor for survival in breast cancer, cervical

cancer, and gastric cancer [22; 12]

Converse-ly, over-expression of GAS5 has been

attribu-ted to the prevention of several cancer cell

lines through regulation of apoptosis and the

cell cycle, under basal conditions as well as in

some chemotherapeutic agents These results

suggest that GAS5 may have clinical

signifi-cance in the development of signifi-cancer therapies

[8; 12; 19; 20]

This is the first study to investigate the

expression pattern and prognostic significance

of GAS5 in Vietnamese patients with gastric

cancer GAS5 expression was retrospectively

analyzed in 48 patients with gastric carcinoma

Its expression levels in gastric cancer tissues

were compared with those found in distal

normal tissue from the same patients A clear

reduction of more than 62% in GAS5

expres-sion level in the gastric cancer tissues

compared with normal tissues was observed

(Figure 1) This reduction was statistically

sig-nificant, suggesting that the reduction

in GAS5 expression level is related to the

development of gastric cancer

Our results showed that GAS5 expression

was significantly decreased in gastric cancer

tissues Patients’ GAS5 expression levels

ciated with increased tumor size, higher TNM stage, greater invasion depth and increased regional lymph nodes (table 2) Our findings

were similar to a previous study by Sun, M et

al (2014) in Chinese gastric cancer patients,

but unlike Sun, et al.’s study, our findings re-vealed that low GAS5 was correlated with lym-phatic metastasis (table 2) Furthermore, ecto-pic expression of GAS5 was demonstrated to decrease gastric cancer cell proliferation and induce apoptosis, while downregulation of en-dogenous GAS5 could promote cell

prolifera-tion in vitro and in vivo [12] These findings

indicate that GAS5 may play a key tumor-suppressor role and may be a novel prognostic markers for gastric cancer

V CONCLUSION

Our study reveals that GAS5 expression level in gastric cancer tissue is associated with tumor size, TNM stage, invasion depth, num-ber of regional lymph nodes and extent of lym-phatic metastasis Our results indicate that GAS5 might represent a potential biomarker for the diagnosis and management of gastric cancer

Acknowledgements

We would like to express our sincerest gratitude to the Center for Gene-Protein research at the Hanoi Medical University for their help with our experiments We would also like to thank the Hanoi Medical University Hospital, Viet Duc Hospital and Bach Mai hospital for giving us patient samples

REFERENCES

therapeutic approach of gastric cancer liver

metastases Indian J Gastroenterol, 35(5), 331

- 336

2 Catalano, V., Labianca R., Beretta G.

D et al (2009) Gastric cancer Crit Rev Oncol

Hematol, 71(2), 127 - 164.

3 Vogiatzi, P., Vindigni C., Roviello F et

al (2007) Deciphering the underlying genetic

and epigenetic events leading to gastric

carci-nogenesis J Cell Physiol, 211(2), 287 - 295.

4 Crew, K D and Neugut A I (2006).

Epidemiology of gastric cancer World J

Gastroenterol, 12(3), 354 - 362.

5 Cao, J (2014) The functional role of

long non-coding RNAs and epigenetics Biol

Proced Online, 16, 11.

6 Pinheiro, H., Bordeira-Carrico R.,

Seixas S et al (2010) Allele-specific CDH1

downregulation and hereditary diffuse gastric

cancer Hum Mol Genet, 19(5), 943 - 952.

7 Guttman, M., Amit I., Garber M et al

(2009) Chromatin signature reveals over a

thousand highly conserved large non-coding

RNAs in mammals Nature, 458(7235), 223

-227

8 Qiao, H P., Gao W S., Huo J X et al

(2013) Long non-coding RNA GAS5 functions

as a tumor suppressor in renal cell carcinoma

Asian Pac J Cancer Prev, 14(2), 1077 - 1082.

9 Ponting, C P., Oliver P L., Reik W.

(2009) Evolution and functions of long

non-coding RNAs Cell, 136(4), 629 - 641.

10 Xu, N., Chen F., Wang F et al (2015).

Clinical significance of high expression of

circulating serum lncRNA RP11-445H22.4 in

breast cancer patients: a Chinese

populationbased study Tumour Biol, 36(10), 7659

-7665

11 Yuan, S X., Wang J., Yang F et al

(2016) Long noncoding RNA DANCR

increa-ses stemness features of hepatocellular

carci-noma by derepression of CTNNB1

Hepatolo-gy, 63(2), 499 - 511.

12 Sun, M., Jin F Y., Xia R et al (2014).

Decreased expression of long noncoding RNA GAS5 indicates a poor prognosis and

promo-tes cell proliferation in gastric cancer BMC

Cancer, 14, 319.

13 Arita, T., Ichikawa D., Konishi H et al (2013) Circulating long non-coding RNAs in

plasma of patients with gastric cancer

Anti-cancer Res, 33(8), 3185 - 3193.

14 Zhang, E., He X., Yin D et al (2016).

Increased expression of long noncoding RNA TUG1 predicts a poor prognosis of gastric cancer and regulates cell proliferation by

epi-genetically silencing of p57 Cell Death Dis, 7,

e2109

15 Qi, P., Zhou X Y and Du X (2016).

Circulating long non-coding RNAs in cancer:

current status and future perspectives Mol

Cancer, 15(1), 39.

16 Schneider, C., King R M., Philipson

L (1988) Genes specifically expressed at

growth arrest of mammalian cells Cell, 54(6),

787 - 793

17 Pickard, M R and Williams G T (2015) Molecular and Cellular Mechanisms of

Action of Tumour Suppressor GAS5 LncRNA

Genes (Basel), 6(3), 484 - 499.

18 Renganathan, A., Kresoja-Rakic J., Echeverry N et al (2014) GAS5 long

non-coding RNA in malignant pleural

mesothelio-ma Mol Cancer, 13, 119.

19 Pickard, M R., Mourtada-Maarabouni

M and Williams G T (2013) Long

non-coding RNA GAS5 regulates apoptosis in

prostate cancer cell lines Biochim Biophys

Acta, 1832(10), 1613 - 1623.

20 Mourtada-Maarabouni, M.,Pickard M.

R., Hedge V L et al (2009) GAS5, a

non - protein - coding RNA, controls apoptosis

and is downregulated in breast cancer

Onco-gene, 28(2), 195 - 208.

21 Gibb, E A., Brown C J and Lam W.

L (2011). The functional role of long

non-coding RNA in human carcinomas Mol

Cancer, 10, 38.

22 Cao, S., Liu W., Li F et al (2014).

Decreased expression of lncRNA GAS5

pre-dicts a poor prognosis in cervical cancer Int J

Clin Exp Pathol, 7(10), 6776 - 6783.