Expression analysis of y TMT AND FAD2 gene in escherichia coli and transgenic trichoderma reesei

THESIS OF PHILOSOPHY DOCTOR EXPRESSIONAL ANALYSIS OF  -TMT AND FAD2 GENES IN Escherichia coli AND Trichoderma reesei Specialty : Biochemistry Engineering Research field : Microbiolog

Trang 1

我郑重声明：本人恪守学术道德，崇尚严谨学风。所呈交的学位论文，是本人在导师的指导下，独立进行研究工作所取得的结果。除文中明确注明和引用的内容外，本论文不包含任何他人已发表过或者描写过的内容。论文为本人亲自描写，并对所写内容负责。

论文作者签名：陈武海

2013 年 5 月 4 日

Trang 2

UDC： _

华东理工大学学位论文

Trang 3

THESIS OF PHILOSOPHY DOCTOR

EXPRESSIONAL ANALYSIS OF  -TMT AND FAD2 GENES IN

Escherichia coli AND Trichoderma reesei

Specialty : Biochemistry Engineering

Research field : Microbiology & Gene Technology

PhD student : Tran Vu Hai

Student ID : 010090147

Advisors : Prof PhD Wei Dong Zhi

PhD Wang Wei

Shanghai-China, May 4, 2013

Trang 5

ABSTRACT

Tocopherols, with antioxidant properties, are synthesized by photosynthetic organisms and play important roles in human and animal nutrition In the major oilseed crops, -tocopherol, the biosynthetic precursor to α-tocopherol, is the predominant form found in the leaves This suggests that the ﬁnal step of the α-tocopherol biosynthetic pathway was catalyzed by γ-tocopherol methyltransferase

The full-length -PfTMT was obtained from the total RNA of Perilla frutescens leaves by

RT-PCR Sequence analysis indicates that -PfTMT consisted the open reading frame of 894 nucleotides encoding the protein of 34 kD polypeptide Our results demonstrated that the E Coli

BL21(DE3) expression of the -PfTMT resulted in the α-tocopherol contents (and -tocopherol

conversion yield) from 18% in the reaction products Transgenic Trichoderma reesei Rut-C30 strains, over-expressing the γ-PfTMT was also generated by Agrobacterium tumefaciens- mediated transformation The presence of hph and γ-PfTMT gene in the transformants were confirmed by PCR analysis The expression of the γ-PfTMT gene of the transgenes was demonstrated by SDS-PAGE Furthermore, we demonstrated that the Trichoderma reesei Rut- C30 expression of the γ-PfTMT gene resulted in the tocopherol composition 5.9-fold increase in

α-tocopherol content by using high-performance liquid chromatographic (HPLC) method The

increase in the α-tocopherol content indicates that a regulatory function of the γ-PfTMT protein

converts -tocopherol to α-tocopherol

The full-length -BoTMT was obtained from the total RNA of Brassica oleracea leaves by

RT-PCR Sequence analysis indicates that -BoTMT consisted the open reading frame of 1041 nucleotides encoding the protein of 39 kD polypeptide Our results demonstrated that the E Coli

BL21(DE3) expression of the -BoTMT resulted in the α-tocopherol contents (and -tocopherol conversion yield) from 23% of the reaction products by using HPLC method Transgenic

Trichoderma reesei Rut-C30 strains, over-expressing the γ-BoTMT gene was also generated by Agrobacterium tumefaciens-mediated transformation The presence of hph and γ-BoTMT gene in the transformants were confirmed by PCR analysis The expression of the γ-BoTMT gene of the

transgenes was demonstrated by SDS-PAGE

Fatty acids are the main groups of components of plant membrane lipid and seed storage lipid, and the major source of energy in plant According to bioinformation analysis of the cDNA

Trang 6

sequence, the specific fragment of FAD2 from immature maize embryos was isolated by

RT-PCR Results of sequence analysis indicate that FAD2 fragment contains the open reading frame

of 1,236 bp long coding for the 46 kD polypeptide Transgenic Trichoderma reesei Rut-C30

strains, over-expressing the FAD2 gene from maize were generated by Agrobacterium

tumefaciens-mediated transformation The presence of hph and FAD2 gene in the transformants

were confirmed by polymerase chain reaction (PCR) analysis The expression of the FAD2 gene

of the transgenes from Trichoderma reesei and E coli BL21 were demonstrated by SDS-PAGE

In this study, we developed novel plasmids containing three plasmids designated

pBI121-TMT, pCAMBIA1301S-FAD2 and pCAMBIA1301S-FAD2-TMT that incorporate modiﬁed and

improved expression omega-3 and vitamin E content in seeds of the plant transformation The

FAD2 and -PfTMT genes of each plasmid were driven by the constitutive CaMV 35S promoter

which is mostly used for driving trangene expressions in both monocot and dicot plant

transformation The binary vector pCAMBIA1301S-FAD2 and vector pBI121-TMT contains

FAD2, -PfTMT genes respectively, whereby the binary vector pCAMBIA1301S-FAD2-TMT

contains both FAD2 and -PfTMT gene All three plasmid vectors were introduced into A

tumefaciens EHA105 by electroporation

Keywords FAD2 gene; -TMT; Perilla frustescens; Brassica oleracea; tocopherol; HPLC;

Trichoderma reesei; Agrobacterium tumefaciens

Trang 7

CONTENTS

ABSTRACT ………

CONTENTS………

LIST OF FIGURES………

LIST OF TABLE ………

NOMENCLATURE ………

Chapter 1 Biodiversity and phylogeny of Trichoderma ………

1.1 Characteristics of Trichoderma spp ………

1.2 Tools for genetic manipulation of Trichoderma ………

1.3 Defense mechanisms and their exploitation ………

1.4 Trichoderma’s strategies for combat ………

1.5 Regulatory mechanisms triggering the defense of Trichoderma ………

1.6 Trichoderma as a protector of plant health ………

1.7 Secondary metabolites ………

1.8 Trichoderma spp as industrial workhorses ………

1.9 Cellulases and plant cell wall-degrading enzymes ………

1.10 Heterologous protein production ………

1.11 Food industry ………

1.12 Human pathogenic species ………

Chapter 2 Agrobacterium-mediated transformation of Trichoderma reesei overexpressing the Perilla frutescens -tocopherol methyltransferase gene ………

2.1 Introduction ………

2.2 Materials and methods ………

2.2.1 Strains, plasmid, media and major reagent ………

2.2.2 Primer design ………

2.2.3 RNA Isolation ………

2.2.4 Reverse Transcriptase Reactions PCR ………

2.2.5 Transformation plasmid into DH5a strain of Escherichia coli ………

2.2.6 Vector construction ………

2.2 7 Transformation of A tumefaciens with plasmid DNA (binary vector system) …

2.2 7.1 Preparation of competent cells ………

I III VII

IX

X

1

2

3

4

5

6

7

8

9

10

11

14

15

16

17

19

Trang 8

2.2 7.2 Electroporation ………

2.2.8 Agrobacterium tumefaciens-mediated fungal transformation ………

2.2 9 Molecular analysis of transformants ………

2.2.10 Expression -PfTMT gene in Trichoderma viride ………

2.2.11 Expression -PfTMT gene in E coli BL21 ………

2.2.12 The enzyme activity assay of the recombinant -PfTMT ………

2.2.13 Chemical analysis ………

2.3 Results ………

2.3.1 Characterization of -PfTMT gene ………

2.3.2 Agrobacterium-mediated fungal transformation ………

2.3.3 Molecular analysis of transformants ………

2.3.4 Expression of -PfTMT in Trichoderma reesei ………

2.3.5 Expression of -PfTMT in E coli ………

2.3.6 The enzyme activity assay of the recombinant -PfTMT protein ………

2.4 Discussion ………

2.5 Conclusion ………

Chapter 3 Agrobacterium-mediated transformation of Trichoderma reesei overexpressing the Brassica oleracea γ -tocopherol methyltransferase gene ………

3.2 7 Expression -BoTMT gene in Trichoderma reesei ………

3.2.8 Expression -BoTMT gene in E coli BL21 ………

3.2.9 The enzyme activity assay of the recombinant -BoTMT ………

3.2.10 Chemical analysis ………

19

20

21

22

23

24

27

28

29

30

33

35

36

37

38

40

41

42

Trang 9

3.3 Results ………

3.3.1 Characterization of -BoTMT ………

3.3.4 Expression of -BoTMT in Trichoderma reesei ………

3.3.5 Expression of -BoTMT in E coli ………

3.3.6 The enzyme activity assay of the recombinant -BoTMT protein ………

Chapter 4 Agrobacterium-mediated transformation of Trichoderma reesei overexpressing the FAD2 gene ………

4.2.3 RNA Isolation, Reverse Transcriptase Reactions PCR ………

4.2.8 Expression FAD2 gene in E coli and Trichoderma reesei ………

4.3 Results ………

4.3.1 Characterization of maize FAD2 gene ………

4.3.4 Expression of FAD2 in Trichoderma reesei ………

Chapter 5 Novel plant transformation vectors containing γ-PfTMT and FAD2 genes

43

44

46

47

48

49

51

52

55

56

57

58

59

60

62

64

65

66

67

68

Trang 10

5.2.1 PCR Overlapping Extension ………

5.2.3 Transformation of A.tumefacient with plasmid DNA ………

5.2.3.1 Preparation of competent cell ………

5.2.3.2 Electroporation ………

5.3 Results and discussion ………

5.3.1 PCR Overlapping Extension ………

5.3.2 Construction of plasmid vector pCAMBIA1301S-FAD2, pCAMBIA1301S-TMT and pCAMBIA1301S-FAD2-TMT ………

5.3.3 Transformation of A.tumefacient with plasmid DNA ………

Chapter 6 Conclusion and Future direction ………

6.2 Future direction ………

REFERENCE ………

ACKNOWLEDGEMENT ………

AUTHOR’S INTRODUTION ………

APPENDIX ………

70

74

75

77

80

81

82

83

84

112

113

116

Trang 11

LIST OF FIGURES

Fig 1.1 Expression of DsRed2 in transformed fungi ………

Fig 2.1 Chemical structures of α-, β-, γ-, and δ-tocopherols ………

Fig 2.2 -TMT enzymatic reaction -TMT adds a methyl group to ring carbon 5 of  -tocopherol ………

Fig 2.3 Schematic diagram of the binary vectors pPK5-PfTMT ………

Fig 2.4 Schematic diagram of the expression vectors pET28a-TMT-Pf ………

Fig 2.5 PCR amplification of -PfTMT gene ………

Fig 2.6 Alignment of γ-TMT protein sequences from Perilla frutescence and three other organisms using ClustalW2 software ………

Fig 2.7 Colony morphology of T reesei Rut-C30 transformants on solid media ………

Fig 2.8 The plasmid pPK5-PfTMT was tested by electrophoresis ………

Fig 2.9 A PCR analysis of the hph gene inserted in genomic DNA of T reesei Rut-C30 transformation; B PCR analysis of the -PfTMT gene inserted in genomic DNA of T.reesei Rut-C30 transformation ………

Fig 2.10 Expression of the recombinant -PfTMT in T reesei Rut-C30 ………

Fig 2.11 Purification of His-tagged -PfTMT fusion protein ………

Fig 2.12 Expression of the recombina -PfTMT in E coli ………

Fig 2.13 A Separation of - and -tocopherol product standards; B HPLC analysis of  -tocopherol production in T reesei Rut-C30 untransformed control; C HPLC analysis of -tocopherol production for T reesei Rut-C30 transformation ………

Fig 2.14 HPLC analysis of -tocopherol production in E coli Cells; A Separation of - and -tocopherol product standards; B E coli BL21(DE3)/pET30a controls; C E coli BL21(DE3)/pET-PfTMT transformation ………

Fig 3.1 Schematic diagram of the binary vectors pPK5-BoTMT ………

Fig 3.2 Schematic diagram of the expression vectors pET28a-TMT-Bo ………

Fig 3.3 PCR amplification of -BoTMT gene ………

Fig 3.5 The plasmid pPK5-BoTMT was tested by electrophoresis ………

Fig 3.6 PCR analysis of the hph and -BoTMT gene inserted in genomic DNA of T

5

12

13

18

24

25

26

27

29

30

31

32

39

40

46

43

44

Trang 12

reesei Rut-C30 transformation ………

Fig 3.7 Expression of the recombinant -BoTMT in T reesei Rut-C30 ………

Fig 3.8 Expression of the recombinant -BoTMT in E coli ………

Fig 3.9 HPLC analysis of -tocopherol production in E coli Cells ………

Fig 4.1 Schematic diagram of the binary vectors pPK5-FAD2 ………

Fig 4.2 Schematic diagram of the binary vectors pET-FAD2 ………

Fig 4.3 PCR amplification of FAD2 gene from maize genomic DNA ………

Fig 4.4 Alignment of FAD2 protein sequences from Zea mays and four other organisms using ClustalW2 software using ClustalW2 software ………

Fig 4.6 The plasmid pPK5-FAD2 was tested by electrophoresis ………

Fig 4.7 A PCR analysis of the hph gene inserted in genomic DNA of T reesei Rut-C30 transformation; B PCR analysis of the FAD2 gene inserted in genomic DNA of T reesei Rut-C30 transformation ………

Fig 4.8 Expression of the recombinant FAD2 ………

Fig 5.1 Site directed mutagenesis using double stranded megaprimers ………

Fig 5.2 A The binary vectors pCAMBIA1301-FAD2; B The binary vectors pBI121-TMT; C The binary vectors pCAMBIA1301-FAD2-TMT ………

Fig 5.3 PCR amplification of -PfTMT gene from Perilla frutescens genomic DNA …

Fig 5.4 The plasmids were tested by electrophoresis ………

Fig 5.5 The plasmids were tested by restriction enzyme ………

Fig 5.6 The A tumefaciens EHA105 transformed with the recombinant vector …………

Fig 5.7 PCR of A tumefaciens containing every plasmids pCAMBIA1301-FAD2, pCAMBIA1301-TMT, and pCAMBIA1301-FAD2-TMT transformants showing presence of FAD2, -BoTMT and -PfTMT gene ………

45

47

48

49

57

58

60

61

62

63

64

65

71

73

76

78

80

81

Trang 13

LIST OF TABLES

Table 2 Primers used in -PfTMT gene ………

Table 3 Primers used in -BoTMT gene ………

Table 4 Primers used in FAD2 gene ………

Table 5 Primers used in γ-PfTMT and FAD2 gene ………

14

38

56

70

Trang 14

NOMENCLATURE

-BoTMT Brassica oleracea γ -tocopherol methyltransferase

-PfTMT Perilla frutescens -tocopherol methyltransferase

-TMT -tocopherol methyltransferase

A tumefaciens Agrobacterium tumefaciens

AMT Agrobacterium-mediated transformation

EDTA Ethylenediaminetetraacetic acid

FAD Fatty acids desaturases

MCS Multiple cloning site

Nos-ter Nopaline synthase terminator

OCS Octopine synthase terminator

REMI Restriction enzyme mediated integration

Trang 15

RT-PCR Reverse transcription PCR

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

T reesei Trichoderma reesei

Trang 17

Chapter I

BIODIVERSITY AND PHYLOGENY OF TRICHODERMA

Trichoderma was first proposed as a genus by Persoon in 1794 [181], and several species of

Hypocrea have been linked in 1865 [248] Nevertheless, the different species allocate to the

genus Trichoderma/Hypocrea were not easy to distinguish morphologically It was intended to reduce taxonomy to Trichoderma viride species Therefore, the development of a conception for

classification was introduced until 1969 [194, 204] After that, multiple new species of

Trichoderma/Hypocrea were observed, and the genus already consisted of more than 100

phylogenetically determined species in 2006 [54] In some condition, misidentification of certain

species has appeared in recently reports, for Trichoderma harzianum which has been applied to

many different species [126] Nevertheless, it is difficult to certainly correct these misunderstanding without studying the strains originally used Therefore, we summarized the data using the names as originally published In recently years, by development of an oligonucleotide barcode (TrichOKEY) and a customized similarity search tool (TrichoBLAST) safe classification of new species was significantly make easy [278, 53, 113] An additional useful tool for the new characteristic isolated Trichoderma species are phenotype microarrays, which permit for analysis of carbon utilization patterns for 96 carbon sources [17, 119, 55] The

prolongation application to elucidate diversity and geographical occurrence of Trichoderma/ Hypocrea follow on detailed demonstration of the genus in the world [203, 30, 95, 276]

The Index Fungorum database [277] at present lists 471 different names for Hypocrea species and 165 records for Trichoderma Even so, many of these names have been innovated

long before molecular methods for species classification were obtainable They are likely to have get obsolete in the meanwhile Nowadays, the International Subcommission on

Trichoderma/Hypocrea lists 104 species [279], which have been identified at the molecular level 72 species of Hypocrea have been characterized in temperate Europe [95] However, a appreciable number of putative Hypocrea strains and Trichoderma strains, for which sequences have been saved in GenBank, are still without safe characterization [54] Species of the genus get

a broad array of pigments from brightly greenish yellow to reddish, even though some of them are also colorless Likewise, conidial pigmentation varies from colorless to severally green shades and even also gray or brown Other species of pigments classification within the genus is

Trang 18

not easy because of the narrow class of modification of the uncomplicated morphology in

Trichoderma [71]

1.1 Characteristics of Trichoderma spp.

Trichoderma spp are universal colonizers of cellulosic materials and can thus frequently be

create wherever decaying plant material is availability [121, 95] besides in the rhizosphere of

plants, where they can induce systemic resistance opposed pathogens [82] The searching for

potent biomass degrading enzymes and organisms also run to insulation of these fungi from

unexpected material, example of cockroaches [267], marine mussels and shellfish [200, 199], or

termite guts [230] Trichoderma spp are identified by quick growth, mainly bright green conidia

[71]

In spite of the early indicated connection between Trichoderma and Hypocrea [248], this

anamorph teleomorph correlation of Trichoderma reesei and Hypocrea jecorina was only

demonstrated more than 100 years later [125] However, because all attempts to cross the

attainable strains of this species had unsuccessful, T reesei was then named a clonally, asexual

derivative of H jecorina Trichoderma species brought more than ten up to a sexual cycle was

published [217] The further studies on molecular evolution of this species go to the finding of a

detail sympatric agamospecies Trichoderma parareesei [51] First of all, the industrial

consideration of T reesei, the usefulness of a sexual cycle was a groundbreaking finding and

paves the way for elucidation of sexual growing in other members of the genus now

Trichoderma spp are greatly successful colonizers of their habitats It is presented both by

their efficient utilization of the substrate at hand and their emission ability for enzymes and

antibiotic metabolites They are know-how deal with such other environments as the dark and the

fermentation bioprocess fermentor or shake flask besides the rich and diversified of tropical

rainforest ecology Therefore, they react to their environment by regulation of growth,

conidiation, enzyme production, and so adapt their lifestyle to present conditions such as light

Trichoderma has for a long duration of studying about the light effection on its physiology and

evolution from 1957 and much paralleled which of Phycomyces blakesleeanus [207] In addition,

growth conidiation, enzyme production, and secondary metabolite biosynthesis, the cellulase

gene expression has affected in fungi [207] By a study on carbon source utilization using

phenotype microarrays in different condition of light, the direct connection between light

responsive and metabolic processes was advanced supported [67] The research about the light

Trang 19

affection for the molecular basis discovered interconnections between the signaling pathways of light response, heterotrimeric G-proteins, the cAMP pathway, sulfur metabolism, and oxidative

stress are operative in Trichoderma [207, 241]

In recently years, studying with Trichoderma has been promoted importantly by genomes sequencing of three strains representing the most crucially applications of this genus: The

genome sequence of T reesei [147, 274], besides that, in spite of its significance in industrial cellulase production, its genome contain the fewest many genes encoding cellulolytic and hemicellulolytic enzymes Analysis and explanation for genomes of two important biocontrol

species as Trichoderma atroviride and Trichoderma virens [275] is still in research now As the result, the genomes of two important species are significantly better than that of T reesei, they

comprise roughly 2000 genes This substantial difference in genome sizes in the physiology of

these fungi will be interesting on research Further studies are milestones for Trichoderma,

which provided intriguing insights into their lifestyle, physiology, and adaptive evolution at the molecular level [25, 147, 212, 133, 218]

1.2 Tools for genetic manipulation of Trichoderma

Because of the industrial application of T reesei, the developmental genetic toolkit for this fungus is the great expansion of the genus, although also studying with other species is unlimited

by technical obstacles and most tools can also be used for all species with slight transformation Modification of many species is acceptable, and different advance such as protoplasting [75],

transformation of Agrobacterium-mediated [271], or transformation of biolistic [139] were applied The range of selectable marker cassettes such as hygromycin [142] and benomyl resistance [182, 213], the Aspergillus nidulans amdS gene, which possible growth on acetamide

as sole nitrogen matterial [178] besides the auxotrophic markers, pyr4 [75], arg2 [10], and hxk1

[79] accept of multiple modification construction, which is now facilitated by the available of a

T reesei strain with perturbed nonhomologous endjoining pathway [78] Sequential gene deletions despite a restriction number of selectable markers became able to by the use of a blaster cassette comprising direct repeats for homologous recombination and excision of the marker gene selection [84] Besides knockout strategies for functional analysis of transgenic, also through over-expression or antisense knockdown [195, 156, 211] was studied for Trichoderma, and RNAi has been expressed to function in T reesei [18] The results indicated that, a sexual

cycle in T reesei [217] more boosts the adaptability of T reesei was applied both industrial and

Trang 20

basic research

1.3 Defense mechanisms and their exploitation

Fortunate colonization of a given habitat by any organism is crucially dependent on its

capability to defend its ecological niche and to thrive and prosper in spite of contention for light,

space, and nutrients in many fungi In particular, Trichoderma is masters of this competition [89,

83, 255] Their defense reaction comprised enzymatic, as well as chemical weapons, which make

Trichoderma spp efficient mycoparasites, antagonists, and biocontrol agent specific that can be

taken advantage by using Trichoderma spp or the metabolites secreted by these fungi as

biological control of plant disease caused by pathogenic fungi [229, 254, 253, 166] By that,

Trichoderma spp plays a very important factor role in the three way fundamental interaction

both the plant and the pathogen [140, 262]

1.4 Trichoderma’s strategies for combat

After discovering of Trichoderma lignorum (later found to be T atroviride) in 1932 [259],

studying on antagonistic properties of Trichoderma spp progressed quickly At present, the most

essential species in this field are T atroviride, T harzianum, T virens, and Trichoderma

asperellum [13], hence T reesei can a little seen as a model organism used because of the

determined molecular biological methods and available recombinant strains [216]. Trichoderma

spp are possible control ascomycetes, basidiomycetes, and oomycetes [155, 13], and have

recently been reported [42, 129, 72] In my laboratory, our team used the DsRed2 gene as a

reporter to test the applicability of the newly constructed vectors in T reesei We constructed

expression vectors pWEF31-red by insertion of the DsRed2 gene The vectors were introduced

into T reesei by Agrobacterium-mediated transformation Positive transformants, F1

(pWEF31-red transformation) was selected and then screened for further observation of DsRed2 expression

in both the conidia and mycelia under a ﬂuorescence microscope (Fig 1.1) The results indicated

that both vectors were capable of expressing an exogenous gene in fungi

In their defensive actions, Trichoderma spp produce a range of hydrolytic enzymes [123,

257], proteolytic enzymes [116, 235, 31], ABC transporter membrane pumps in the interaction

with different plant-pathogenic fungi[198], diffusible or volatile metabolites [29, 62], and other

secondary metabolites [190] as active measures against their hosts or they succeed by their

impairing growth conditions of pathogens [13] Interestingly, the accomplishment of these

actions is notonlyindependent of the surrounding temperature [162], but also crucial for the use

Trang 21

as a biocontrol agent in climate change Large scale researches on a functional gene product during biocontrol at least in part represent these discovering [74, 146, 202] and reveal supplemental components with potential effectivity such as a superoxide dismutase [74] and amino acid oxidase [247] Furthermore, the response of Trichoderma to its host has also been

explained to include stress response, nitrogen shortage response, cross pathway control, lipid metabolism, and signaling proceeding [218]

Fig 1.1 Expression of DsRed2 in transformed fungi DsRed2 was observed in the mycelia and

conidia of T reesei transformed with the binary expression vector pWEF31-red The hygromycin

resistant transformants were subcultured and observed under a ﬂuorescence microscope Olympus

BX50 [Unpublished studies of my group]

1.5 Regulatory mechanisms triggering the defense of Trichoderma

Signal transduction pathways triggering the genes were included in biocontrol and mycoparasitism have been applied in appreciable depth and include heterotrimeric G-protein signaling, mitogen activated protein kinase (MAPK) cascades, and the cAMP pathway [269] Especially the MAP-kinase TVK1, characterized in T virens [148, 161, 149] both itsorthologs

in T asperellum [274] and T atroviride [192], is important in regulation mechanisms and signaling pathways of active biocontrol Transcript levels of the specific genes rised on

symbiotic interaction with plant roots in T virens and T asperellum [274] T reesei TMK1 deletion caused decreased mycoparasitic activity and advanced protection against Rhizoctonia

solani [192] Moreover, lack of T virens TVK1 extensively raises effective fungal biological

control agents [148]

According to the activity of the pathway of heterotrimeric G-protein signaling, two genes

Trang 22

have been found out with a show to biocontrol mechanisms relation in Trichoderma spp.: the

class I (adenylate cyclase inhibiting) G-alpha subunits TGA1 of T atroviride and TgaA of T

virens both the class III (adenylate cyclase activating) G-alpha subunits TGA3 of T atroviride

and GNA3 of T reesei TGA1 plays an important role in regulation of coiling around host

hyphae and regulates production of antifungal metabolites TGA1deficiency follows on

enhanced growth inhibition of the host fungi [195, 191] Such as TgaA, a host specific shown

incase of the activity of MAP kinases has been studied [160] Besides that, TGA3 was all

important for biological control since deletion of the corresponding gene of the avirulent strains

[270] Carrying constitutive activation of GNA3 in T reesei is recommended to positively affect

by species of mycoparasitism [243] With analysis of cAMP signaling components, the report

also indicated a positive role of cAMP in biological control [158] Moreover, significantly role in

biological control of T virens was studied for the homolog of the VELVET protein, which called

light dependent regulator protein [159]

In the past, we could be done distinguish effective from non efficient biological control

strains isolated from nature to know characteristics between these genes and enzymes regulation

interaction of Trichoderma with a pathogen [243, 206]

1.6 Trichoderma as a protector of plant health

The advantage of Trichoderma spp is unlimited to fighting against pathogens; they have also

been demonstrated to be opportunistic plant symbionts, induced systemic resistance of plants

[266, 222], an answer which is enhancing by ceratoplatanin family proteins [50, 218]

Conception of the signals transmitted by Trichoderma in the plant demand for the important role

both a MAPK [221] the fungus itself, a MAPK signaling is crucial for full establishment of

systemic response in the plant [256] By colonizing plant roots, which is not only important

improved by swollenin [19], but also their accomplished through soil and occupy new niches

This interaction with plants besides their rhizosphere competence as biological control agents of

microbial plant pathogens result increased root proliferation, growing, and protection for the

plants against toxic chemicals and Trichoderma spp as a remarkable resistance Consequently,

Trichoderma spp is hope agent to apply for remediation of polluted natural by treatment of

appropriate plants with spores [81]

1.7 Secondary metabolites

Fungi was applied as well as enzymatic weapons and potent arsenal for chemical warfare at

Trang 23

their disposal [255] Therefore, both potential antibiotics (for example the peptaibols) and mycotoxins and more than 100 metabolites with antibiotic activity together with polyketides, pyrones, terpenes, metabolites obtained from amino acids, and polypeptides [226] were identified in Trichoderma spp A large variety of peptaibols was discovering in Trichoderma

thereafter [47, 48, 49, 233] Nevertheless, the development of peptaibol creation seems to be too complex to admit for anticipation of peptaibol production profiles form phylogenetic relationships [44, 122, 167, 49] One of the first characterized secondary metabolites of

Trichoderma spp was the peptide antibiotic paracelsin [23, 22] Interestingly, the four

trichothecene mycotoxin producing species (Trichoderma brevicompactum, Trichoderma arundinaceum, Trichoderma turrialbense, and Trichoderma protrudens) are not nearly

correlated to those species used in biological control The application of biological control in agriculture pose a risk and these mycotoxins play a main role in the protection mechanisms of these fungi [170, 49] Recently, like many other fungi, Trichoderma spp had been reported to

out put a broad array of volatile organic mixing, which have taken more attention [233] Effective production of peptaibols predominantly happen in solid cultivation and correlates with conidiation [122, 241] Signaling molecules contained rank from the blue light photoreceptors BLR1 and BLR2 to the G-alpha subunits GNA3 (TGA3) and GNA1 as well as protein kinase A

[192, 112] Therefore, GNA3 is all important for peptaibol production besides that stimulant of peptaibol production in the non-appearance of BLR1 and BLR2 is still able to [112]

1.8 Trichoderma spp as industrial workhorses

The US army was discovered T viride QM6a in World War II [189], later on, the excellent efficiency of its cellulases led to prolonged research toward industrial enzyme applications After

that, this species was assigned a new name T reesei in honor of Elwyn T Reese [224] and became well-know the cellulase producer worldwide until now

1.9 Cellulases and plant cell wall-degrading enzymes

Higher energy costs and the global climate change are due to an increased attention to biofuel production [208, 197] Nowadays, research with T reesei is especially approaches in

improvement of a role of the enzyme cocktail produced so that decrease all in all price of production of bioethanol from cellulosic waste source [127] such as applications in the pulp, paper industry [28] and textile industry [69] After the early mutation programs [61] and strain development, the protein emission capacity of industrial strains now reaches very high High

Trang 24

levels of cellulase and hemicellulase by using in the synthesis of a functional gene product can

be achieved upon cultivation on cellulose, xylan, or a mixture of plant polymers [143] and on

lactose [214], all of which use of industrial byproducts in agricultural The natural persuader of

at least a subset of these enzymes is accepted to be sophorose, a transglycosylation output of

cellobiose [231] Targeted arrangements to be further better the efficiency of the enzymes

secreted to include elucidation of regulatory mechanisms both at the promoter level [143, 210]

and with respect to signal transduction [207] Nevertheless, auxiliary components acting on the

substrate could raise efficiency of its degeneration [201, 209]

In recent years, metabolic engineering has been applied successfully for contributed

intriguing insights into these processes [124], and investigation of the genome sequence of T

reesei showed that this industrial workhorse possesses the smallest number genes within

Sordariomycetes encoding the enzymes which made it so common plant cell wall-degrading

enzymes [66, 147] Utility of the genome sequence spurred genome full analysis of quickly

modification strains and discovery of putatively beneficial mutations, which caused their high

efficiency [133] As the result, it seems that even early for modification such as Rut-C30 bear

considerable alterations of T reesei genome [215] These new tools also facilitated

characterization of the enzyme cock-tails run off by these strains [88] In supplementation to

these effort’s enzyme technology approaches [11], improvement of the secretion machinery [37,

118] and screening of the enormous variety of plant cell wall degrading enzymes from nature

isolates [120] or other organisms secreting cellulases [45] and directed evolution [165]

complement the optimisation of the regulative mechanism of available production strains Today,

87% of energy consumed in the world comes from oil, coal or natural gas, the contaminating

sources [151] Thus, with the help of Trichoderma, economic reasonable production of 2nd

generation biofuels from waste products is an efficient method

1.10 Heterologous protein production

Filamentous fungi are versatile cell factories and often applied heterologous protein

expression [1], especially if they have generally regarded as safe status [169], as has T reesei

[168] The manufactured in the production of calf chymosin use of T reesei as a producer of

heterologous proteins begins more than 20 years ago [80, 249] At that time, the expression of

immunologically active antibody fragments [172] in T reesei was achieved, and numerous

enzymes and expression proteins followed Currently, T reesei is one of the most successful

Trang 25

used filamentous fungi for production of heterologous proteins[179,169].

Based on the efficient expression and the considerable information on regulation of cellulase genes, their promotors are routime used for heterologous protein production [179, 210] As a result, developments in cellulase transcription are also advantages for these applications However, also alternative promotors were also shown to be helpful for certain applications [105]

In general, the high efficiency and the inducibility of the cellulase promotors have proven useful

in many applications Apply the cellulase promotors, also relatively cheap carbon sources such

as cellulose or lactose can be used for production In spite of that, it had to consider that the large amount of enzymes secreted to the culture medium may be an issue in special purification of the heterologous protein, and the complex substrates used could induce extracellular proteases, which are deleterious for the yield of the process [105] For complementary improvement,

promotor mutations, for example with the chb1 promotor [138], can extend yields of the protein

to be expressed

1.11 Food industry

With their extended history of good industry for scale enzyme production, Trichoderma spp

has also been extensively used for production of food additives and related products [168, 16]

Nowadays, several Trichoderma enzymes are used to advance the brewing proceeding,

macerating enzymes in fruit juice production, feed additive in farm animal and for pet food Cellulases are mainly applied in baking, malting, and grain alcohol production [70]

Nevertheless, both enzymes and metabolites of Trichoderma spp are applied as additives The beginning productions isolated from T viride was a chemical with representative coconut like aroma, a 6-pentyl-α-pyrone [35, 173] An interesting ideal is the procedure of cell wall degrading

enzymes, for example of T harzianum, it is food preservatives and lost broad application

because of their antifungal effect [68] With a likewise aim, T harzianum mutanase can be

applied in toothpaste to avoid accumulation of mutant in dental plaque [260]

1.12 Human pathogenic species

Recent information suggests that fungi has function applied pathogenic as Candida, Aspergillus, or Crypotcoccus, also the genus Trichoderma comprises opportunism human pathogenic germ, which poses a dangerous and usually lethal threat, especially to HIV infected

persons and other immunocom intended patients Belonging to the emerging fungal pathogens, these fungi are usually not understood or diagnosed in a stadium when efficient treatment is

Trang 26

questionable [258] Trichoderma species have been published to make respiratory trouble due to

volatile organic compounds they produce [132], but after transplanting or suffering from

leukemia or HIV, they can infect immunocompromised patients (Trichoderma citrinoviride, T

harzianum, and Trichoderma longibrachiatum and Hypocrea orientalis) [115] The

characteristically poor prognosis of such infections is (besides delayed diagnosis) predominantly

due to the low susceptibility of these fungi to commonly apply antifungal agents [33, 114],

which usually in need of combined treatment with other drugs [114, 4] However, inconsiderable

information on observation of virulence factors of these fungi is available [117] According to a

report published before, T longibrachiatum as well as H orientalis among the clinical isolates

are the best common ones Surprisingly, no special phylogenetic characteristics of the clinical

isolate as compared to be environmental isolates could be detected, and no relation between

virulence or pathogenicity and genomic structure was found [6, 7, 52] Nevertheless, most

intriguingly, T longibrachiatum notonly causes disease infections; at the same time, it but also

seems to be a beginning for potential antifungal medicine efficient against both Candida and

Aspergillus species [251]

Trang 27

has been exploited as an industrial host for homologous and heterologous protein production

[180, 185] Although large amounts of homologous proteins can be found from this organism, the production of heterologous proteins is often rather low [37,185] Consequently, isolation of the genes consisted in protein secretion and characterization of their role, and pathways are crucial for fungal molecular biology, which may be approached by genetic mutagenesis analysis Besides, the establishment of high-throughput methods for discovering gene function in this production organism is becoming an urgent requirement Among diverse strategies for functional genomics in fungi, insertional mutagenesis has proven to be assigning a stimulating approach A function to regulate the expression/secretion of enzymes consisted, will be of fundamental highlight in the search for new therapeutic strategies, in the revelation of new drug targets, and in the control of microorganisms that are harmful to human being More recently, insertion of

mutagenesis via Agrobacterium-mediated transformation (AMT) has succeeded in natural plant

hosts as well as in yeast [27], Trichoderma reesei [265] and even human cells [128] AMT has tried and tested to be a simple and reproducible filamentous fungal transformation method in many presentatives [152]

Vitamin E found in eight different forms that involve four tocopherols and four tocotrienols Tocopherol is lipid soluble molecules essential to human nutrition, but they are only synthesized

by photosynthetic organisms, including all plants, algae and most cyanobacteria [92, 150] Depending upon the number and position of methyl groups in the chromanol ring of tocopherol, this includes four tocopherols which are α-, β-, γ- or δ-tocopherol [24, 60, 38](Fig 2.1)

Trang 28

Fig 2.1 Chemical structures of α-, β-, γ-, and δ-tocopherols

Among four tocopherols, α -tocopherol is the predominant in vitamin E synthesis in both

plasma and tissues and is in the form that has drawn the most attention Many epidemiological

studies have shown that human having lower vitamin E nutritional status is associated with

increased risk of certain types of cancers [101, 239, 73, 110, 145] Besides, γ-tocopherol has not

received much attention since the finding of vitamin E Recent researches show that γ-tocopherol

can also be important to human health as it possesses unique features that distinguish it from

α-tocopherol having stronger anti-inflammatory and anticancer activity Although, the

bioavailability as well as bioactivity of γ-tocopherol is lower than those of α- tocopherol [97, 98]

Nevertheless, γ-tocopherol is more important than α-tocopherol in the American diet and is

found in plant oils such as soybean, corn, cottonseed and to a lesser extent, in wheat germ oil

[246, 2] A tocopherol combination containing 58% γ-tocopherol, 24% δ-tocopherol, 13%

α-tocopherol, and 0.5% -tocopherol can be easily accessible as a by product of refining vegetable

oil [134, 100] The proposed pathway synthesis includes the phytylation of homogentisic acid to

form 2-methyl-6-phytylquinol, the beginning ring methylation at position 3 to yield

Trang 29

2,3-dimethyl-5-phytylquinol, cyclization to yield -tocopherol, and ﬁnally a second ring methylation

at position 5 to yield -tocopherol (Fig 2.2)

Fig 2.2 -TMT enzymatic reaction -TMT adds a methyl group to ring carbon 5 of tocopherol

-These investigations suggest that the lastest enzyme -tocopherol methyltransferase (-TMT)

of the α-tocopherol biosynthesis pathway, which catalyzes the methylation of -tocopherol to form α-tocopherol, is likely restricted in the seeds of most agriculturally important crop Methylation of -tocopherol to form α-tocopherol by chemical catalysis in vitro will not only

increase the production price, but also bring some other by products, which are harmful to human health However, the relationship between the expression pattern of -TMT gene and the content of α-tocopherol in plant organs is poorly understood Therefore, understanding the biochemical pathway of tocopherol biosynthesis will be open for the perspective for convalesing the nutritional high quality of crop plants [77] So that, regulating the expression of γ-PfTMT

through gene engineering will help to understand the -tocopherol biosynthesis pathway, and has potential contribution to human health

In this study, the full-length cDNA of -PfTMT was obtained from Perilla frucestens and these deduced amino acid sequences compared with other organisms γ-PfTMT gene was successfully transformed to Trichoderma reesei Rut-C30 by applying the AMT method We

Trang 30

attempted a detailed characterization of γ-PfTMT activities with respect to substrate speciﬁcities

was expressed in E coli and Trichoderma reesei Rut-C30

2.2 Materials and methods

2.2.1 Strains, plasmid, media and major reagent

E coli DH5α was from Fermentas (China), The A tumefaciens GV1301 was provided by Dr

Feng-ming Song from Zhejiang University, Trichoderma reesei Rut-C30 was provided by

Dong-huaJiang [138] The sequencing vector pMD19-T was from Jieli Biotech (Shanghai, China) For

general fungal culture, potato dextrose agar (PDA) media and Mandels medium was used PCR

primers were synthesized by Sangon (Shanghai, China) -, - tocopherols,

S-Adenosylmethionine (SAM) was purchased from Sigma (Deisenhofen, Germany)

Chromatographic materials and columns were obtained from Agilent Technologies, USA All

other chemical reagents were of analytical purity

2.2.2 Primer design

The following sequences are designed by Primer Premier 5.0 software (Table 2)

Table 2 Primers used in -PfTMT gene

AGGCCT(StuI)TTAAGATGCAGGTTTTCGGCATGTAATG

GGATCC(BamHI)GATGGCGGAGATGGAGACGGA

GTCGAC(SalI)TTAAGATGCAGGTTTTCGGCATGTA

TGGATATGTCCTGCGGGTAAATAG ATTTGTGTACGCCCGACAGTCC

2.2.3 RNA Isolation

Sterilized available plastic equipments are RNase free in general, thus they can be used in

this experiment We are only autoclaved microcentrifuge tubes and tips for micropipette for this

experiment Glass equipment and spatulas perform dry heat sterilization at 160ºC for one hours

Equipment which cannot do dry heat sterilized should be treated with 0.15 %

diethylpyrocarbonate (DEPC) solution at 37ºC for 24h then autoclaved (prevent RNA

Trang 31

carboxymethylation with DEPC) Leaves of Perilla frutescens frozen to liquid nitrogen and

4 Transfer the top liquid layer to new centrifuge tube, carefully without touching middle layer

5 Measure the amount of the top layer and add an equal amount or add up to 0.5 times of isopropanol and 0.5 times 0.8 M Sodium acetate +1.2 M NaCl of the top layer Mix together well and vortex Keep the mixture at room temperature after 10 minutes

5 Centrifuge at 12,000 × g for 10 minutes at 4 ºC to precipitate the RNA

6 Cleaning RNA precipitate

Carefully remove the supernatant without touch the pellet If some isopropanol remains that is not a problem Add 1 ml 75 % cold ethanol that was equivalent to the supernatant Clean the precipitate by vortexing for 5 minutes Now centrifuge the solution at 7,500 × g for 5 minutes at

4 ºC and discard the supernatant Be cared not to disturb the precipitate

7 Dissolving RNA

Dry the precipitate by leaving the tube open in the hood for several minutes After the precipitate

is dry, dissolved it with 50-100 ml appropriate amount of RNase-free water

2.2.4 Reverse Transcriptase Reactions PCR

Total RNA was isolated from Perilla frutescens was used for 1st strand cDNA synthesis

reaction by using PrimeScript™ II 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s instructions

1 Prepare the mixture in a microtube following

Trang 32

Reagent Volume

Oligo dT Primer (50 µ M) 1 µl dNTP Mixture (10 mM each) 1 µl Template RNA Total RNA：less than 5 µ g RNase free dH2O up to 10 µl

2 Keep for 5 minutes at 65°C; cool the mixture immediately on ice The efficiency of reverse

transcription will increase by denaturation of RNA template

3 Prepare the reaction mixture by combining the reagents to a total volume of 20 µl following

table

Template RNA and Primer Mixture 10 µl 5× PrimeScript® II Buffer 4 µl RNase Inhibitor (40 U/ µl) 0.5 µl (20 units) PrimeScript® II RTase (200 U/ µl) 1.0 µl (200 units) RNase free dH2O up to 20 µl

4 Mix reaction mixture gently

5 Incubate the reaction mixture immediately under the following conditions about 42°C for 30

min

6 Inactivate the enzymes by incubation at 95°C for 5 minutes in PCR equipment, followed by

cooling on ice

RNA samples (0.5-1g) were vacuum dried and used this material for RT (reverse transcriptase)

reactions 10 µL of PCR mixture containing 5 µL of Premix Taq Version 2.0 (TaKaRa), 1.0 µL

of dNTP (10 mmol/L), 20 pmol of forward primer P1PfTMT, 20 pmol of reverse primer

P2PfTMT (Table 2) and 5 ng of template DNA were used The experimental conditions of

RT-PCR were 95ºC for 5 min, then 30 cycles of 95ºC 30 s, 60ºC 30 s, 72ºC 1.5 min, followed by a

final extension at 72ºC for another 10 min

2.2.5 Transformation plasmid into DH5a strain of Escherichia coli

Amplification products were fractionated on 1% denaturing agarose gel electrophoresis from

which the selected band was purified The amplified DNA was inserted into the pMD19-T vector

(TaKaRa) and transformed into E coli DH5α One hundred microlitres of bacteria stock solution

Trang 33

were mixed with 100ng plasmid, chilled on ice for 30 min and put in 42ºC water bath for 2 min The mixture was put immediately on ice again for about 2 min, incubated in LB broth in shaking incubator (160 rpm) for 60 min at 37ºC and streaked onto different LB agar plates containing ampicillin (100 g/ml) The plates were incubated overnight at 37ºC and analysed The positive plaques were identified by PCR and then sequenced by Jieli Biotech (Shanghai, China) The

negative control would be untransformed E coli strain The bacteria plate was subcultured once

every week to make sure that the bacteria were fresh before every plasmid extraction process

2.2.6 Vector construction

-PfTMT gene was isolated from total RNA of Perilla frutescens leaves has been described in detail previously The full coding region of γ-PfTMT gene was amplified by PCR using pPfTMT

plasmid as template The upstream primer P3PfTMT (Table 2) was underlined is PacI site and a

translationally start codon The downstream primer P4PfTMT (Table 2) was underlined is StuI

site and a translationally the stop codon The PCR product was cloned into pMD19-T vector to

generate pPfTMT The pPfTMT plasmid was digested with PacI and StuI The fragments of

product were purified and cloned into the vector pWE32F00 to obtain the express vector PfTMT (Fig 2.3) The plasmids were then transformed into T reesei Rut-C30 by

pPK5-Agrobacterium-mediated transformation

The pPfTMT plasmid digested with BamHI / SalI, were inserted at the BamHI / SalI site of

plasmid pET28a to generate express vectors pET28a-TMT-Pf (Fig 2.4), respectively

Fig 2.3 Schematic diagram of the binary vectors pPK5-PfTMT (15 kb) will use for fungal

transformation, which was constructed by ligation of -PfTMT sequencing at the PacI and StuI

Trang 34

site of vector pWE32F00 The binary vector pPK5-PfTMT was containing -PfTMT gene and

hph gene The -PfTMT gene was driven by the constitutive Pcbh I promoter The hph gene was

under control Pgpd promoter of the Aspergillus nidulans gpd (glyceraldehydes-3-phosphate

dehy- drogenase) gene RB right border, LB left border

Fig 2.4 Schematic diagram of the expression vectors pET28a-TMT-Pf (6,269 bp)

2.2.7 Transformation of A tumefaciens with plasmid DNA (binary vector system)

2.2.7.1 Preparation of competent cells

1 Pick a single colony of the A tumefaciens strain GV1301of choice and inoculate 3 ml of LB

supplemented with 50 ug/ml of gentamycin in a 15 ml snap-cap tube (Falcon tube)

2 Inoculate two 500 ml flasks each containing 100 ml of LB with 0.5 ml (1/100 volume) of the

overnight culture and grow at 30°C with vigorous shaking until mid-log (OD600 of 0.5 - 1.0) It

takes 5 hours to get the cells to this stage It could probably cut down the time by increasing the

initial inoculum

3 Fill six 30 ml Corex tubes with the culture and spin 5 min at 10.000 rpm at 4°C Pour off

supernatant and drain tubes inverted for 60 seconds

4 Resuspend cells in each tube with 12-15 ml (1/2 volume) ice cold 10% glycerol Repeat spin

5 Resuspend cells to each tube in 4 ml of ice cold 10% glycerol Combine and aliquot into 2

tubes Repeat spin

6 Resuspend cells in each of the two tubes in 2ml of ice cold 10% glycerol Combine into one

tube Repeat spin (use a balance tube with water or 10% glycerol)

7 Resuspend final pellet in 1.5 ml ice cold 10% glycerol

Trang 35

8 Dispense 100ul aliquots into fifteen 1.5 ml microfuge tubes prechilled on ice Each tube will have enough cells for 2 transformations Quick freeze the tubes in liquid nitrogen and store at 80°C

3 Transfer cells pPK5-PfTMT to prechilled (on ice) electroporation cuvettes with either1 or 2

mm gap sizes Make sure the white cuvette holder from the Bio-Rad machine is also prechilled

8 Incubate plates 2 days at 28°C, at which time colonies should be seable

2.2.8 Agrobacterium tumefaciens-mediated fungal transformation

The transformation protocol was a modification of the method developed by [46] Protoplasts

of T reesei Rut-C30 was prepared as described by [39] with modifications T reesei Rut-C30

conidia were obtained by growing the strain on PDA plate for 5 days and washing the plate

gently with a sterile physiologic salt solution A tumefaciens strain GV1301, containing the

binary vector pPK5-PfTMT, was grown at 28°C for 18h in LB media supplemented with

kanamycin (50 μg/ml) and gentamycin (50 μg/ml) The A tumefaciens cells were diluted to

(optical density) OD 660 =0.15 in the induction medium (IM) with the presence or absence of

200 μM acetosyringone (AS) The cells were grown under the same conditions until an OD660

Trang 36

of 0.4–0.8 was reached before mixing them with an equal volume of a conidial suspension of the

Trichoderma reesei Rut-C30 This mix (200 μl per plate) was plated on a 90-mm diameter

cellophane sheet and placed on cocultivation medium (same as the induction medium except that

it contains 20 g agar per litre) in the presence or absence of 200 μM AS After incubation at 28°C

for 48 h, the membranes were transferred to M-100 plates that contained hygromycin B (600

g/ml) as the selection agent for fungal transformants and Cephalosporins (300 ug/ml) to inhibit

growth of A tumefaciens cells Putative transformants, visible 7 days later, were transferred to

M-100 + 600 g/ml of hygromycin B and plates were incubated as previously The obtained

transformants were further subcultured for 4 generations, and then examined the expression of 

-PfTMT gene

2.2 9 Molecular analysis of transformants

DNA was isolated from T reesei Rut-C30 transformants and wild-type strain using the

method of [135] with modiﬁcations Approximately 2 g of ﬁltered, frozen mycelia from a liquid

culture was ground to a powder and lysed using lysis buﬀer (50 mM Tris–HCl, pH 7.4, 50 mM

EDTA, 3% SDS, 10 mM -mercaptoethanol) at 65oC for 1 h The lysate was extracted once

using 1 volume of Tris-buﬀered phenol followed by two extractions with 1 volume of

chloroform/isoamyl alcohol (24:1) RNA was removed by treating with RNase (10 lg/ml) for 1 h

at 37oC DNA was precipitated and suspended in Tris-HCl (10 mM) After adding TE buﬀer,

samples were vortexed for 30s, and centrifuged at 13,000 rpm for 5 min The supernatant

containing DNA was transferred to a new tube and stored at -20oC until use in PCR For 

-PfTMT gene, 10 µL of PCR mixture containing 5 µL of Premix Taq Version 2.0 (TaKaRa), 5 ng

of template DNA, 20 pmol of forward primer P1PfTMT, 20 pmol of reverse primer P2PfTMT

(Table 2) were used For hph gene, 10 µL of PCR mixture containing 5 µL of Premix Taq

Version 2.0 (TaKaRa), 5 ng of template DNA, 20 pmol of forward primer P1hph, 20 pmol of

reverse primer P2hph (Table 2) were used The experimental conditions of PCR were 95ºC for 5

min, then 30 cycles of 95ºC 30 s, 55ºC 30 s, 72ºC 1.5 min, followed by a final extension at 72ºC

for another 10 min

2.2.10 Expression and purification -PfTMT gene in Trichoderma reesei

The T reesei Rut-C30 harboring plasmid pPK5-PfTMT was cultured in Glucose yeast

medium (NH4H2PO4 0.1% (w/v), KCl 0.02% (w/v), MgS04.7H2O 0.02% (w/v), glucose 1%

(w/v), 0.1% (v/v) 0.5% aqueous CuSO4.5H2O, 0.1% (v/v) 1% aqueous ZnS04.7H2O) on a rotary

Trang 37

shaker for 60-72 h (28°C, 180 rpm) Total protein was isolated from T reesei Rut-C30 was used

for SDS-PAGE by using RNA/DNA/Protein Isolation Kit (Omega Bio-Tek) according to the manufacturer’s instructions The protein concentration was measured by Bio-Rad Protein Assay

Total protein from T reesei Rut-C30 transformant was run 12% SDS-PAGE Gels were stained

with Coomassie Blue R250 and the quantity of the expressed protein was estimated by comparing the intensity of the protein bands

2.2.11 Expression -PfTMT gene in E coli BL21

The transformants harboring plasmid pET28a-TMT-Pf was cultured at 37ºC in LB medium until OD600nm reached 0.5-0.7 IPTG was added to final concentration of 0.5 mmol/L and the cultivation was continued for another 4-5 hours at 37ºC The cell was harvested by centrifugation The protein concentration was measured by Bio-Rad Protein Assay Total bacterial protein was analyzed by 12% SDS-PAGE

The protocol of purifying the recombinant -PfTMT was followed 100 ml of the induced

cells was incubated at 25°C for 4 h and harvested by centrifugation The pellets were resuspended in lysis buffer (10 mM imidazole, 300 mM NaCl and 50 mM NaH2PO4, PH 8.0) at

2 to 5 ml per gram wet weight and were sonicated on ice after adding lysozyme The supernatant was mixed with Ni2+-NTA resin, washed with wash buffer (pH 8.0) containing 50

mM NaH2PO4, 300 mM NaCl and 20 mM imidazole to remove impurities Finally, the recombinant -PfTMT with His6-tagged was eluted with elution buffer (250 mM imidazole,

300 mM NaCl and 50 mM NaH2PO4, pH 8.0)

2.2.12 The enzyme activity assay of the recombinant -PfTMT

About 107 spores of T reesei Rut-C30 strains carrying on pPK5-PfTMT were inoculated into

150 ml liquid minimal medium (LMM) and cultured for 48h at 200 rpm at 28℃ Then the mycelia were transferred to 150 ml cellulase-inducing medium in which 2% lactose (w/v) was substituted with 6% lactose (w/v) After cultivation for another 36 h, 100l of the culture supernatant was used for -PfTMT enzyme assays

E coli cells carrying pET28a-TMT-Pf and pET28a, respectively, were grounds with liquid

nitrogen and suspended in the fermentation medium Extracts were harvested by centrifugation

100l of supernatant were used for -PfTMT activity analysis

Trang 38

The assay for the -PfTMT enzyme is based on the methylation of exogenous - into 

-tocopherol in the presence of SAM A -PfTMT activity assay was performed as described by

[220] except that the final concentrations of -tocopherol and SAM was 0.02 mmol/L and 1

mmol/L, respectively The enzyme activity was measured by assessing the residual enzyme

activity after incubated in shaking incubator (150 rpm) at 30°C for 5h (E coli) and 10h (T

reesei)

2.2.13 Chemical analysis

The -, -tocopherol stock was prepared by dissolution 30 mg of -tocopherol in 100 ml of

methanol-acetonitrile (30:70 v/v), having a ﬁnal concentration of 300 mg/ml The stock was used

to hold working solutions of 0.75, 1.5, 3.0 and 6.0 µg/ml, which were stored at -20oC in the dark

For analysis of -tocopherol in samples, the stock solution and the samples were in all cases

analyzed together in the same condition, and analyte concentrations in samples were estimated as

the basis of peak areas from the result All samples were analyzed in 3 times

The reaction products were extracted according to [205] The residue was redissolved in 1

ml of the HPLC mobile phase (methanol–acetonitrile, 30:70 v/v), then membrane ﬁltered (pore

size 0.50 mm; Millipore, Bedford, MA, USA) Finally, a 20 l aliquot was injected in the HPLC

column Before injection, the extracts were maintained at -20°C in the dark -tocopherol

content was analyzed by 1100 high-performance liquid chromatography apparatus (Agilent

Technologies, USA) with a Hypersyl ODS2-C18 column (4.6×250 mm, 5m particle size), DAD

detector, and a quaternary pump system HPLC separation was carried out using methanol–

acetonitrile (30:70 v/v) as mobile phase The column was eluted with mobile phase at a ﬂow rate

of 1.0 ml/min The column was adjusted to 30°C The detection was by diode-array detector at a

wavelength of 205 nm

2.3 Results

2.3.1 Characterization of -PfTMT gene

Several pairs of primers were designed according to the cDNA sequences of 5'-end and

3'-end translated regions RT-PCR products only by primers P1PfTMT/P2PfTMT (Table 2) for

Perilla frutescens were obtained from leaves Then PCR product of the same length was

amplified from the Perilla frutescens genome Analysis of the sequences showed that all of

Perilla frutescens was 894 bp (Fig 2.5) and the sequences were consistent, indicative of no

Trang 39

intron in the -PfTMT gene These differences may be the results either of amplification artifacts

resulting from the inherent inaccuracy of DNA polymerase, or of some sequencing error The PfTMT open reading frame of 894 bp fragments encodes a predicted peptide of 297 amino acid residues with a molecular weight 34 kD The GenBank accession number for the -PfTMT

identified for this study is JN381069.1 Alignment of the deduced amino acid sequences of 

-PfTMT gene in Fig 2.6 shows an identity of about 72% between -PfTMT gene and Arabidopsis, 70% between Brassica oleracea -TMT and -PfTMT The Glycine max -TMT protein shares a high degree of amino acid sequence similarity with -PfTMT (74%) In conclusion,

alignment of the deduced amino acid sequences of -PfTMT showed the similarity of -TMT

genes from Arabidopsis

(A) (B)

(C)

Fig 2.5 PCR amplification of -PfTMT gene A The RNA leaf was tested by electrophoresis B

PCR amplification of -PfTMT gene from DNA leaf C PCR amplification of -PfTMT gene from E.Coli transformation

Trang 40

Fig 2.6 Alignment of -PfTMT protein sequences and three other organisms using ClustalW2

software The deduced amino acid sequences compared are from: Arabidopsis thaliana γ-TMT

gene (AF104220), Glycine max -TMT (AY960126), -BoTMT Brassica oleracea (JQ031515.1)

and -PfTMT Perilla frutescens (JN381069.1)

Nucleotide sequence accession numbers The GenBank accession number for the 

-PfTMT identified for this study is JN381069

2.3.2 Agrobacterium-mediated fungal transformation

A tumefaciens GV 1301 containing the binary vector pPK5-PfTMT was used to transform

Trichoderma reesei Rut-C30 The maps of pPK5-PfTMT, the -PfTMT gene and the htp cassette

are shown in Fig 2.3. Co-cultivation of the spores of Trichoderma reesei RUT C30 with A

Định dạng
Số trang	136
Dung lượng	3,3 MB