Isolation and expression analyses of dazl, vasa and sox3 genes in the seabass (lates calcarifer)

Chapter1 Introduction 1.1 Germ cell development Reproduction in most animal species involves determination and differentiation of germ cells and sexes.. In Drosophila, C.elegans and Xen

Chapter1 Introduction

1.1 Germ cell development

Reproduction in most animal species involves determination and differentiation of germ cells and sexes From flies to humans, reproduction beginsearly development with the segregation of primordial germ cells (PGCs) from the somatic lineage and the allocation

of these cells to the germ celllineage It continues with mitotic proliferation, entryand progression through meiosis, and finally culminates withmaturation of immature germ cells into fully-differentiatedand functional sperm and eggs that fertilize to generate a new life

The commitment to PGCs is either induced by tissues in mammals (Tam and

Zhou, 1996; Lawson et al., 1999) or pre-determined by maternal germplasm, an

oosplasmic region containing polarized determinants for the germline which is asymmetrically localized after fertilization in most of the non-mammals (Saffman and Lasko, 1999) The germ plasm is characterized by the presence of polar granules – electron dense structures associated with mitochondria, fibrils and RNA proteins Because of its cloudy appearance under electron microscope, the germ plasm is also termed nuage Nuage exists not only in PGCs, but also in oogonia, oocytes, spermatogonia, spermatocytes and spermatids and has been documented in at least 8 animal species including the insects, fishes, amphibians and mammals (Eddy, 1975) In

Drosophila, C.elegans and Xenopus the germ plasm plays a critical role in germ cell

determination and the early specification of the germline Transplantation experiments in

Drosophila and Xenopus together with genetic studies in Drosophila and C.elegans

demonstrated that germ plasm is required for germ cell specification (Illmensee and

Mahowald, 1974; Okada et al., 1974; Nieuwkoop and Sutasurya, 1979; Ephrussi et al.,

1991; Seydoux and Strome, 1999) In contrast, morphologically distinct germplasm has

so far not been identified in early mammalian embryos

In the mammals, germ cell determination occurs later during development, and is not directly dependent on maternal molecules In these species germ cell determination is governed by an induction mode involving cell – cell interactions In the mouse, transplantation experiments showed that cells are not initially committed to the germline, and its cell-cell interactions just before gastrulation induce cells to become PGCs (Tam and Zhou, 1996) ) The formation of PGCs was shown to depend on the bone

morphogenetic protein 4 (Bmp4) in the mouse embryos (Ying and Zhao, 2001; Ying et al., 2001) Embryological experiments also suggest that polarity does not contribute to

germ cell specification (Zernicka-Goetz, 1998)

Most of the non-mammalian species have a pre-deterimined germ cell lineage that

is specified by cytoplasmic germ cell determinants laid in the oocyte In the Xenopus,

germ plasm is synthesized and transported to the vegetal cortex during oogenesis Germ plasm is inherited by the vegetal-most blastmomeres of newly fertilized embryos, within the presumptive endoderm, and segregated into a few cells at the blastula stage (Houston

and King 2000b; Kloc et al., 2001) Those cells that inherit germ plasm will give rise to

PGCs, and sister cells that do not inherit germ plasm become somatic endoderm Similarly, germ cells are pre-determined by maternally inherited germ plasm in the

chicken (Tsunekawa et al., 2000)

In fish, the specification of germ cellswas controversial before the discovery of germ cell specific markers Nuage-like structures are detected duringoogenesis and late

embryogenesis, and the origin of germ cellshas been traced to different germ layers in different fish (Selmanet al 1993) Therefore, it was difficultto assign a specific time point and event to germ cell specification in fish The recent identification of the

zebrafish vasa orthologue indicatesthat germ cell precursors are separated early from somatic cells,and they can be traced throughout embryogenesis (Olsen et al.1997; Yoon

et al 1997; Weidinger et al 1999; Braat et al 1999) Recently, Knaut et al (2000) has shown that vasa RNA is a component of a germplasmlike structure, and maternal signals induce a change in germ plasm segregation,which results in germ plasm activation and consequently in germlinespecification

1.1.1 Germ cell genes in Drosophila

An important mechanism for the specification of the animal germline is the localization

of specific molecules to the germ plasm The germplasm components include RNA binding proteins or transcription factors and their RNAs RNA maternal germplasm and its regulations are achieved via translation of vegetally-localized mRNAs (Micklem, 1995; Grunert and St Johnston, 1996; Macdonald and Smibert, 1996) Germ plasm

components, or germ cell genes, have been best studied in Drosophila where twelve genes belonging to the “posterior group” maternal effect genes (cappuccino, spire, staufen, oskar, vasa, valois, mago nashi, tudor, nanos, pumilio, par-1 and pipsqueak) have been identified for the formation of the pole cells Mutations in these genes could

result in loss of polar granules, disruption of the pole plasm and lack of germ cells In the

Drosophila embryo, ectopic germ cells are formed if oskar RNA is mislocalised to the

anterior pole (Ephrussi and Lehmann, 1992) Ectopic Oskar protein causes the

accumulation of nanos mRNA, which is both a zinc finger protein and translational

regulator that is required for germcell migration (Kobayashi et al., 1986; Forbes and

Lehmann, 1998) Vasa and Tudor proteins are required for nanos RNA localization in

PGC determination (Schupbach and Wieschaus, 1986; Wang et al., 1994; Boswell and

Mahowald, 1985) Immunocytological studies have shown that Oskar, Vasa and Tudor

proteins colocalised with the polar granules (Bardsley et al., 1993; Breitwieser et al., 1996; Hay et al., 1988a, b) Nanos protein was shown to be involved in establishing and

maintaining germline stem cells (GSCs) by preventing their precocious entry into oogenesis in Drosophila ovaries (Wang and Lin, 2004) Several additional maternal genes which encode RNA-binding proteins are well characterized in non-mammalian organisms

including teleost species Tong et al (2000) has identified the first maternal gene identified in the mouse; female mice homozygous for a mutation at the mater (maternal

antigen that embryos require) locus developed normally, and produced normal eggs

Following fertilization, eggs of mater -/- females developed up to two cell stage Mater is

a single-copy gene expressed only in oocytes

1.1.2 Identification of germ cells

Many approaches have been used to investigate the origin of germline In teleost, PGCs were previously recognized histologically through their morphological characteristics and cells with such traits have been identified after gastrula stage In birds, PGCs at early developmental stages were identified by the presence of high glycogen content PGCs in mouse embryos have been distinguished by their characteristicalkaline phosphatase (AP)

activity (Hahnel et al., 1990; Ginsburg et al., 1990) Although AP is described as a

classical marker for PGCs, positive reaction was shown in different tissues of mouse

embryos (MacGregor, 1995) Other methods to detect the presence of PGCs include

Oct-3/4 expression (Okazawa et al., 1991; Yeom et al., 1996), several cell-surface antigens

recognized by monoclonalantibodies such as SSEA-1 (Fox et al., 1981), 4C9 (Yoshinaga

et al., 1991) and EMA-1 (Hahnel and Eddy 1986) However, all these methods are not

specific enough to distinguish cells destined to a germ cell fate frompluripotent stem

cells remaining in the undifferentiated state The subsequent discovery of vasa gene and

its homologs in many organisms have facilitated the identification of germ cells In the zebrafish, studies of vasa have allowed tracing of the germ cell lineage early in development (Yoon et al., 1997) Zebrafish PGCs were characterized (Braat et al., 2000) and the asymmetric segregation of vasa RNA which distinguishes germ cell precursors

from somatic cells and germ plasm segregation patterns in cleavage stage embryos were

described (Knaut et al., 2000) Additional studies using zebrafish as a model have greatly

enhanced our understanding of the mode of specification of PGCs, cell-fate maintenance and the migration of these cells towards the gonads, where they differentiate into gamates

(Raz, 2003) In the chicken, the isolation of vasa homolog gene (Cvh) has enabled a more

precise tracking for the origin of PGCs Immunohistochemical analyses using specific antibody raised against CVH protein indicate that CVH protein is localized in cytoplasm

of germ cells ranging from presumptive PGCs in uterine-stages embryos to spermatids

and oocytes in adult gonads (Tsunekawa et al., 2000) The identification of PGCs in the

development of pre-implantation rabbit embryos using mouse Vasa homologue protein in young rabbit embryos indicate that MH-vasa is more specific than current AP staining

(Montiel et al., 2001) The human VASA gene is specifically expressed in the germ cell

lineage and VASA protein expression in human germ cells has been characterized at

various stages of development, suggesting that VASA is a reliable marker of germ cells

(Castrillon et al., 2000)

1.1.3 Vasa family genes

The vasa gene was initially identified in Drosophila by genetic screens for

maternal-effect mutations that affected anterior-posterior polarity and caused a deficiency in pole

cells formation in embryos from mutant mothers (Hay et al., 1988; Lasko and Ashburner, 1988) The Vasa protein (Vas) can be detected in the germline cells of Drosophila

throughout their development, and in early embryos it is specifically localized to pole

granules The vasa gene of Drosophila has been shown to be a member of the DEAD (Asp-Glu-Ala-Asp) protein family of ATP-dependent RNA helicases (Liang et al., 1994)

The DEAD box proteins share eight characteristic sequence motifs, and are involved in nuclear and mitochondria splicing processes, RNA editing, rRNA processing,

translational initiation, nuclear mRNA transport and mRNA degradation (Luking et al.,

1998) Among the DEAD box proteins, the Vas- and PL10-related proteins are very similar to each other Vas-related genes have been reported in 18 animal species

including Hydra (Kazufumi et al., 2001), C.elegans (Roussel and Bennett, 1993), planarian (Shibita et al., 1999), oyster (Fabioux et al., 2004), Xenopus laevis (Komiya et al., 1994), chicken (Tsunekawa et al., 2000), mouse (Fujiwara et al., 1994), human (Castrillon et al., 2000), zebrafish (Yoon et al., 1997; Olsen et al., 1997), medaka (Shinomiya et al., 2000), tilapia (Kobayashi et al., 2000), trout (Yoshizaki et al., 2000), and seabream (Cardinali et al., 2004) The sequence similarity of the Vas- and PL-10

related proteins and the restricted existence of the vas-related genes to metazoans appear

to suggest an ancestor of the vas-related genes was derived from an ancient PL-10 related

gene and thereafter acquired the specificity in germline cells (Mochizuki et al., 2001)

The distribution of vasa RNA and Vasa protein has been determined at different developmental stages in many animals (Raz, 2000) Vasa RNA is expressed exclusively

in the germ cells In Drosophila, vasa RNA is uniformly distributed in early embryos, but

the protein is localized to its posterior pole, where it is associated with the polar granules

The Vasa protein can bind target mRNAs such as oskar and nanos, and control their translation (Hay et al., 1990; Lasko and Ashburner, 1990) The Vasa homologs of Canenorhabditis elegans, glh-1, glh-2 and glh-4, have been shown to play a role in germ- cell proliferation and gametogenesis (Gruidl et al., 2000) In the mouse, where germ cells

are induced through cellular interactions rather than inheritance of maternal cytoplasm

determinants, the expression of vasa is in the PGCs as they arrive at the gonad, and

expression is induced by interaction between the germ cells and somatic cells of the

developing gonad (Toyooka et al., 2000) Further studies in animals lacking vasa gene

provided evidence for the role in the development of germ cells and gametogenesis in

these organisms In Drosophila, vasa null mutants fail to develop mature oocytes, indicating that in mature gonads the vasa gene is involved in oocyte maturation (Styhlet

et al., 1998) and there could be interplay between oogenesis and the activity of the Vasa protein (Ghabrial and Schupbach, 1999) In Canenorhabditis elegans, injection of

antisense RNA disrupted oogenesis and spermatogenesis, leading to arrest at the

pachytene stage (Kuznicki et al., 2000) In Xenopus, microinjection of antibodies against

the Vasa homolog protein (XVLG) into blastomeres of 32-cell stage caused a reduction

in the number of PGCs at the tadpole stage (Ikenishi and Tanaka, 1997) In the mouse,

loss of vasa function affects differentiation of male germ cells, resulting in male sterility (Tanaka et al., 2000)

1.1.4 Daz family genes

The founder member of the family is DAZ that was identified as the essential locus deleted in azoospermia in human Azoospermia affects approximately 2% of men worldwide (Shinka and Nakahori, 1996) The DAZ locus on human Y chromosome, the azoospermic factor (AZF), is vital for proper differentiation of male germ cells DAZ is

present as a multicopy gene cluster (Saxena et al., 1996), and deletion of the DAZ

clusters has been correlated with azoospermia and oligospermia, which makes DAZ a strong candidate for the AZF DAZL (DAZ-like), a human autosomal DAZ gene was

found to map to human chromosome 3 (Shan et al., 1996) and to mouse chromosome 17 (Cooke et al., 1996; Reijo et al., 1996) Subsequently, BOULE was mapped to human

chromosome 2 and was proposed to be a meiotic regulator which is highly conserved

throughout metazoans (Xu et al., 2001) It has been proposed that BOULE is the

ancestral gene that is conserved from flies to humans, whereas DAZL arose in the early vertebrate lineage and DAZ arrived on Y-chromosome during primate evolution, possibly from the transposition and repeat amplification of the ancestral autosomal gene DAZL

(Chai et al., 1997a) DAZ and DAZL differ in copy number and overall protein structure;

DAZ protein has several DAZ isoforms with a polymorphic DAZ repeat region of 8-24 amino acid residues, compared to DAZL protein which contains only one DAZ repeat

(Reijio et al., 1995; Yen et al., 1997)

DAZ family proteins carry two conserved domains, namely the ribonucleoprotein (RNP)-type RNA recognition motif (RRM) and the DAZ motif, and exist in both

vertebrates and invertebrates (Cookie et al., 1996; Eberhart et al., 1996; Reijo et al.,

1995) These genes are thought to be involved in cell cycle switch from mitotic to meiotic

cell division (Gromoll et al., 1999); this cell cycle switch is controlled by RNA-binding proteins in the yeast (Watanabe et al., 1997) DAZ, DAZL and BOULE share the RRM that is not shared with other RNA binding protein and they are highly conserved from fruitfly to humans (Burd and Dreyfuss, 1994) The expression of Daz genes appears to

transcribed specifically in the male germ line (Eberhart et al., 1996; Reijo et al., 1995; Saxena et al., 1996), while human DAZLA/DAZH and its homologs in mouse, zebrafish, and Xenopus are expressed in the germline of both sexes (Houston et al., 1998; Maegawa

et al., 1999; Ruggiu et al., 1997; Seligman and Page, 1998) Interestingly, expression product differs in Xenopus and zebrafish In Xenopus, xdazl RNA is localized to the germ

plasm in eggs and embryos Zebrafish germ cells are found to originate at the periphery

of the developing blastoderm (Olsen et al., 1997; Yoon et al., 1997; Knaut et al., 2000).

Despite variation in the localization patterns, conservation of sequences among DAZ

homologs may translate into conservation in functional homology; Drosophila mutants for boule, in which germ cells arrest during meiotic progression (Eberhart et al., 1996), can be rescued by the product of Xenopus Dazl (Houston et al., 1998) The ability of a human DAZ transgene to rescue partially the spermatogenic defects of Dazl1 knock-out mice (Slee et al., 1999) supports functional conservation between DAZ and DAZL

Daz and Dazl are expressed exclusively in germ cells, suggesting a pivotal role in the formation of PGCs and also differentiation of germ cells in the mouse (Cooke et al., 1996; Ruggiu et al., 1997; Gromoll et al., 1999) Further studies in the phenotypic

analyses of animals lacking dazl gene provided direct evidences for the role of dazl in the development of germ cells and gametogenesis in these organisms In Xenopus, Xdazl controls the formation of the PGCs during embryogenesis and inhibition of Xdazl leads to loss of the PGCs (Houston et al., 1998; Houston and King, 2000b) In Dazla-defective

mouse, female germ cells are arrested at the prophase of meiosis I, whereas development

of male germ cells is terminated after the spermatogonial stage (Ruggui et al., 1997; Reijio et al., 1996) Highly variable testicular defects are associated with the absence of

Daz gene in human, ranging from complete absence of germ cells to spermatogenic arrest

with occasional production of condensed spermatids in infertile male (Reijo et al., 1995)

In the developing male/female genital ridges, PGCs change morphologically and become gonocytes Gonocytes proliferate and give rise to spermatogonia/oogonia, which are male/female germ stem cells (GSCs) Upon sexual maturation, GSCs differentiate and undergo meiosis to form gametes Gametogenesis represents a second fundamental process in animal reproduction

1.2 Sexual development – genetic sex determination

Organisms displaying sexual dimorphism have evolved different sex determining mechanisms; in many species with genetic sex determination, sex depends on a single pair of sex chromosomes The mechanisms of genotypic sex determination vary greatly

in different species In mammals, sex is determined genetically by the presence or absence of Y chromosome (Swain and Lovell-Badge, 1999; Capel, 2000) In birds, the

male is homogametic (ZZ), whereas the female is heterogametic(ZW) In worms and

Drosophila, sex is determined by the ratio of X chromosome to autosomes (Parkhurst and

Meneely, 1994; Cline and Meyer, 1996) Fishes display a variety of sex determining mechanisms, ranging from genetic to behaviour-dependent sex determination Synchronous hermaphroditism and sequential hermaphroditism are well documented In the synchronous hermaphrodites, organisms possess both active male and active female reproductive organs at the same time; in sequential hermaphrodites, both male and female reproductive organs may be present, but only one is active and viable at any given time Sequential hermaphrodites are further categorized into two main categories: protogynousand protandrous Protogynous hermaphrodites are those that develop into females first, then possibly to males Protandrous hermaphrodites are the exact opposite, with juveniles first developing male reproductive organs that may possibly change into female

reproductive organs as in the case of the seabass Lates calcarifer

1.2.1 Genes involving in sex determination and differentiation

Many genes have been shown to play significant roles during sex differentiation and determination For example, Anti-Mullerian hormone (AMH), also known as Mullerian inhibiting substance (MIS), is a member of the transforming growth factor beta (TGFbeta) superfamily and plays a crucial role during male sexual differentiation (Visser, 2003) AMH causes the regression of the Mullerian Duct in males and marks the start of the

hormonal cascade required for male sexual differentiation (Jamin et al., 2003) Dmrt1

(DM-related transcription factor 1) encodes a protein with a DM domain

(Doublesex/Mab-3 DNA-binding motif) (Zhu et al., 2000), is conserved in a wide range

of animals with diverse sex-determining mechanisms DMRT in medaka has been best

studied ie DMRT1Y is the only functional gene in the Y-chromsome and maps exactly

to the male sex-determining locus (Nanda et al., 2002) In the rainbow trout, Dmrt1 is

expressed during testicular differentiation, but not during ovarian differentiation,

indicating its association with fish gonadal differentiation (Marchand et al., 2000) In

contrast, the mutually exclusive expression of two types of DM domain genes in the testis and ovary of tilapia suggests that both genes play roles in gonadal development and

function (Guan et al., 2000) In the protandrous black porgy, differential expression of

Dmrt1 transcripts in the gonads suggests a possible relationship of Dmrt1 to sex reversal (He et al., 2003) In mammals, Dmrt1 is responsible for the maintenance of seminiferous tubules after birth (Raymond et al., 1998, 1999, 2000) The Wilms' tumor 1 (WT1) is

important in the early establishment of gonads and possible regulator of Sry expression (Rackley, 1993; Kriedberg et al., 1993) WT1 has been shown to form a complex with SRY to regulate transcription and that this WT1-SRY interaction is important in testis

development (Matsuzawa-Watanabe Y et al., 2003)

1.2.2 Sry and Sox genes

The identification of Sry, the testis determining gene on the mammalian Y chromosome, has enhanced our understanding in the mechanism of sex determination In mice, Sry is expressed in the gonad from 10.5 days post coitum (dpc) to approximately 12.0 dpc, coincident with formation of the onset of gonadogenesis and testis development

(Koopman et al., 1990; Hacker et al., 1995; Bullejos and Koopman, 2001) When a 14-kb region containing this gene was introduced into XX, testis development and male

secondary sexual differentiation occurred (Koopman et al., 1991) Testis formation includes cell proliferation, commitment of coelomic epithelial cells to the Sertoli lineage,

mesonephric cell migration and vascularization All these events depend upon the expression of Sry in the genital ridge Sry was thought to be a relatively recent addition to the sex determination as it does not exist in other vertebrates besides mammals

Sry is the founder member of Sox (SRY-type HMG box) gene family of transcriptional factors Additional sox genes have also been shown to play a role in sex determination and gonadal development The ovine Sox2 expression in developing

gonads suggests a role in germ cell line (Payen et al., 1997) In the mouse, Sox4 expression can be regulated under ovarian control in the uterus, suggesting a putative role for Sox4 in the female reproductive system (Hunt and Clarke, 1999) Sox9 is believed to

be a male specific sex determinant with deletion or disruption of human SOX9 often

results in male-to-female sex reversal (Foster el al., 1994; Wagner et al., 1994); and over

expression of Sox9 induced female to male sex reversal in mice (Vidal et al., 2001) The

presence of Sox17 in ovary, ovotestis and testis in the protogynous rice eel indicates a

possible role in gonadal differentiation and a conserved role in spermatogenesis (Wang et al., 2003) Apart from their roles in sexual reproduction, sox genes are also involved in

the regulation of diverse developmental processes such as germ layer formation, organ development and cell type specification (Wegner, 1999)

The Sry and Sox proteins share a single high mobility group (HMG) domain

consisting of 80 amino acids (Sinclair et al., 1990) The HMG domain is a DNA binding motif that is shared by abundant non-histone components of chromatin and specific regulators of transcription and cell differentiation HMG domain is responsible for

mediating DNA binding and has a signature sequence RPMNAFMVW (Bowles et al.,

2000) There are about 30 members of the Sox family, found in insects, amphibians, birds

and mammals Sox genes are divided into six groups (A-F) based on the similarity within and outside the HMG box (Pevny and Lovell-Badge, 1997) Despite these variations, chimeric Sry proteins between Sox 3 and 9 HMG domains can bind to and regulate SRY target genes without hampering the development of testis cord and male secondary sexual characteristics, suggesting that the HMG domains of Sry and Sox proteins are

functionally exchangeable (Bergstrom et al., 2000)

In sequence, Sry most closely resembles Sox3 which is an intron-less gene on the

X chromosome It has been proposed that Sry evolved from Sox3 by gene duplication followed by truncation and modification outside the HMG box and that Sox3 might antagonizeSry action to influence sex determination (Foster and Graves, 1994) Sox3 is expressed in the brain and gonads Human patients with X-chromosome deletions

spanning SOX3 are mentally retarded, which is consistent with the predominant expression observed in the CNS (Rousseau et al., 1991) Sox3 is detected at the earliest stages of embryonic development(6.5 to 8 dpc) and continues to be expressedthroughout the formation of the brain and central nervous system Interestingly, Sox3 is expressed in somatic cells of urogenital ridge (Wood and Episkopou, 1999) and the developing

gonadal ridge in mouse at the same time as Sry and Sox9 expression (Collignon et al., 1996), suggesting a function for Sox3 in mammalian gonadal development

It has been suggested that Sox3 is also involved in testis determination, perhaps

by its interaction with the related Sox9 (Graves, 1998) Sox3 is necessary fornormal oocyte development and male testis differentiation andgametogenesis in mouse (Weiss et al., 2003) Recently, phenotypes of Sox3 mutant mice exhibit abnormalities throughout

the hypothamalus-pituitary-gonadal axis, indicating that Sox3 seems to affect gonadal

function indirectly through its role in brain development and hypothalamic induction of

anterior pituitary development (Camper, 2004; Rizzoti et al., 2004) The sox3 gene has been well characterized in several vertebrates including Xenopus (Koyano et al., 1997;

Penzel et al., 1997), chicken (Kamachi et al., 1998), mouse (Collignon et al., 1996) and

human (Stevanovic et al., 1993) Also, a putative sox3 has been isolated in the medaka

(Koester et al., unpublished)

1.3 Spermatogenesis and testicular cell culture

Spermatogenesis proceeds throughout adult life It is a complicated process where spermatogonia undergo self-renewal to maintain the stem cell pool and differentiation into sperm Spermatogenesis consists of three distinct phases: (1) spermatocytogenesis is the differentiation and proliferation of spermatogonial stem cells and subsequent generations of spermtogonia ultimately resulting in primary spermtocytes; (2) meiosis includes the reduction divisions first from primary (4N) spermatocytes to secondary (2N) spermtocytes, and secondly from spermtocytes to round, haploid (1N) spermatids; and (3) spermiogenesis is the differentiation of the round spermatid into

a sperm Spermatogenesis requires complex endocrine and auto/paracrine regulation

(Zirkin, 1998; McLachlan et al., 2002) Beyond endocrine control, spermtogensis is

regulated by a multitude of complex cell-to-cell interaction (peritubular cell-Sertoli cell, germ cell-germ cell, germ cell-Sertoli cell) involving many cytokines, growth factors, enzymes, transport proteins, adhesion molecules and other regulatory factors (Russell and Griswold, 1993) Sertoli cells interact directly with germ cells which are critical to spermatogenesis, including compartmentalization of the seminiferous tubules, physical and metabolic support of germ cells, and secretion of numerous factors that promote

germ cell viability and differentiation These effects are enhanced by direct contact with

germ cells in vitro (Fujioka et al., 2001)

The adult testis consists of male germ cells at different stages of development, specifically spermatogonia that share common features with PGCs and female germ cells

in terms of specific expression of genes like vasa and dazl Testicular cell culture would provide an in-vitro system for analyzing germ-specific gene expression A critical

requirement for a successful in-vitro system is to maintain germ cell viability (Staub, 2001) Improved culture conditions, which promote germ cell survival, differentiation

and proliferation, are essential for in-vitro spermatogenesis (Parks et al., 2003) In higher

animals, germ cell survival and progression to and through meiosis requires coculture with somatic cells, generally Sertoli cells or seminiferous tubule fragments On the

contrary, in lower vertebrates such as amphibians (Abe, 1997) and fish (Sakai et al.,

1997), primary spermatocytes can differentiate into flagellated spermatids or functionalsperm without any supporting cells In recent years, culture conditions that allow the

meiosis of male germ cells to proceed in vitro fully are available in teleost species In the

eel, all stages of spermatogenesis were established in organ culture of immature testes

(Miura et al., 1991) In the zebrafish, dissociated testicular cells during 15 days of

coculture on a feeder layer of Sertoli-like cells gave rise to fertile sperm (Sakai, 2002) Previously, a feeder layer-free culture system was developed allowing for the derivation and maintenance of embryonic stem (ES) cell lines in the medaka (Hong and Schartl,

1996) These cell lines retain the capability of differentiation in vitro (Hong et al., 1996) and of chimera formation (Hong et al., 1998) This culture system has also allowed for ES-like cell derivation from several species including the seabream (Bejar et al., 2002)

Recently, under similar culture conditions, long-term cultures of testicular cells from the adult medaka have been obtained This unqiue culture system has produced a normal

spermtogonial cell line without immortalization (Hong et al., 2004) After 140 passages

during the 2 years of culture, this cell line retains stable and growth factor-dependent proliferation, a diploid karyotype, and the phenotype and gene expression pattern of spermtagonial stem cells Furthermore, it has been shown that this cell line can undergo meiosis and spermiogenesis to generate motile sperm

1.4 The seabass- a protandrous fish model

The seabass is a protandrous hermaphroditic marine fish capable of sex reversal from male to female (Moore, 1979; Davis, 1982) It would be interesting to use this marine fish

as a model for investigating sex differentiation/reversal phenomenon

1.5 Objectives

Isolation and expression analysis of three genes vasa, dazl and sox3 in the seabass were

the major objectives of this study In addition, seabass testicular culture was attempted and primarily characterized

Chapter 2 Materials and Methods

2.1 Experimental animals

Seabass were from a local fish farmer Fertile male and female were selected for the extraction of testis, ovary and other essential organs for the isolation of RNA Seabass embryos were collected during the spawning period and were maintained in aerated seawater at room temperature Spawned eggs are pelagic, contain a single oil globule, and develop rapidly at ambient salinity and temperature; larvae hatch within 24 h Embryos were collected at an interval of 2 h for various representative stages ranging from the balstula to late somitogenesis stage for RT-PCT analysis

to allow the dissociation of nucleoprotein complexes 0.2 ml of chloroform was added per

1 ml of Reagent The tubes were capped and shaked vigorously for 15 sec and further incubated at 15 to 30°C for 3 min The samples were centrifuged at no less than 12,000 x

g for 15 min at 2 to 8°C and the mixture got separated into a phenol interphase and an

aqueous phase The aqueous phase was transferred to a new tube, and 0.5 ml of isopropyl alcohol was added per 1 ml of Trizol Reagent to precipitate the RNA The samples were

incubated at 15 to 30°C for 10 min and then centrifuged at no less than 12,000 x g for 10

min at 2 to 8°C After centrifugation, the supernatant was removed and the pellet was washed once with 75% ethanol, adding at least 1 ml of 75% ethanol with 1 ml of Trizol Reagent used for the initial homogenization The mixture was vortexed and centrifuged at

no more than 7,500 x g for 5 min at 2 to 8°C The ethanol was removed, and the RNA

pellet was air-dry for 15 min The RNA was dissolved in RNase-free water by passing the solution a few times through a pipette tip and was incubated at 60°C for 10 min The RNA samples were stored at -70°C

2.2.2 Smart cDNA synthesis

Total RNA from the testis was used to synthesize first strand cDNA required for the 3’ and 5’ RACE reactions using the SMARTTM RACE cDNA Amplification Kit (Clontech) Clontech SMART technology provides a mechanism for generating full length cDNAs in reverse transcription reaction This is made possible by the joint reaction of the SMART

II ATM oligonucleotide and Powerscript TM Reverse Transciptase The following reaction mixture was set up:

For preparation of For preparation of

5’-RACE-Ready cDNA 3’-RACE-Ready cDNA

3 µl RNA sample (> 200 ng) 3 µl RNA sample (> 200 ng)

1 µl 5’-CDS primer 1 µl 3’-CDS primer

1 µl BD SMART II A oligo

Both reaction tubes were mixed and centrifuged briefly The tubes were incubated at 70°C for 2 min followed by cooling on ice for another 2 min The tubes were spun briefly

to collect the contents at the bottom The following reaction mixture was added to each reaction tube (already containing 5 µl):

in -20 °C freezer for subsequent 3’ and 5’ RACE PCR reactions Simliarly, first strand cDNA (from the other tissues/embryos/ cell cultures) were synthesized with the same method (minus the 5’RACE cDNA sythesis) for RT-PCR analysis

First strand solution:

2.2.3 Degenerate PCR

The isolation of genes in my experiment was based on the principle of degenerate primers PCR primers for the various genes were designed on the basis of homologous amino acid sequences rather than directly on the nucleotide sequences This strategy is used if a given amino acid sequence is known to be highly conserved, but the underlying nucleotide sequences vary between species or are unknown Most amino acids are encoded by multiple codons, so a given amino acid sequence can result from divergent gene sequences Overall, we seek to minimize degeneracy, because during oligonucleotide synthesis all the alternate sequences are synthesized simultaneously Therefore, a high degeneracy means the one perfect sequence will be present at low concentration, mixed with many imperfectly matching sequences Primer concentration, magnesium concentration, template concentration, number of cycles of amplification, and the temperatures and times of each step in the amplification cycle are varied to optimize reaction conditions The PCR cycling condition for degenerate primers was 6 cycles touchdown of 94°C for 10 s, 60°C for 30 s and 72°C for 40 s, followed by another 35 cycles of 94°C for 10 s, 54°C for 30 s and 72°C for 40 s Degenerate primers used to amplify a partial sequence for the gene of interest is listed as follows:

2.2.4 5’ and 3’RACE PCR reactions

The generation of partial sequences from dazl, vasa and sox3 genes allowed us to design gene specific primers (GSPs) for RACE PCR reactions based on the protocol of SMARTTM RACE cDNA Amplification Kit (Clontech) All PCR reactions in the SMART RACE protocol were optimized for use with the Adavantage 2 Polymerase Mix (Clontech) The Adavantage 2 Polymerase Mix contains TITANIUMTM Taq DNA Polymerase – a nuclease deficient N-terminal deletion of Taq DNA Polymerase plus

TaqStartTM Antibody to provide hot-start PCR and a minor amount of proofreading polymerase Advantage 2 technology enables the amplification of longer templates than were possible in traditional RACE procedures 3’ or 5’ RACE reactions were performed

0.3 µl 50x Advantage 2 Polymerase Mix

The reaction mixture was vortexed and spun down in a microcentrifuge The PCR cycling condition was 94°C for 10 s, 65°C for 30 s and 72°C for 1 min

50x Advantage 2 Poymerase Mix:

2.2.5 Recovery of PCR products by gel extraction

PCR products were run in TAE buffered agarose gel (1%) via electrophoresis using ReadyAgaroseTM Precast Gel System (Bio-Rad) 4 µl of 1 kb DNA ladder (Promega) was added for estimating the molecular size of PCR products Desired gel band was extracted, placed in 1.5 ml Eppendorf tube and the weight was determined Gel purification was performed using UltracleanTM 15 DNA purification kit (Mobio) 3 volumes of ULTRA SALT was added into the gel and incubated at 55°C for 5 min The tube was mixed and shaked thoroughly to ensure complete melting ULTRABIND was resuspended by vortexing at highest speed for 1 min to ensure thorough mixing since ULTRABIND is a mixture of 50:50 pure silica and buffer 4 µl of ULTRABIND was added Following incubation for 5 min with constant inversion to allow DNA binding to silica, the mixture was centrifuged for 5 sec The pellet was resuspended with 1 ml of ULTRA WASH by vortexing for 5-10 sec The mixture was centrifuged and the supernatant was discarded

The mixture was centrifuged again and all traces of ULTRA WASH were removed by aspirating with a narrow pipet tip The pellet was resuspended in water with 10 µl of water and mixed thoroughly by pipetting The mixture was incubated for 5 min at room temperature, followed by centrifugation for 1 min The supernatant was removed immediately and transferred to a new tube, ready to be used and stored at 4°C

2.2.6 Ligation of PCR products into PGEM-vector

After recovery of PCR products by gel extraction, the PCR products were ligated into pGEM-T Easy Vector (Promega) for cloning and sequencing The pGEM-T Easy Vector multiple cloning sites region is flanked by recognition sites for the restriction enzyme

EcoR1 which allows single enzyme digestion for the release of insert The pGEM-T Easy

Vector was centrifuged briefly to collect the contents at the bottom of the tube The ligation reaction mixture was set up as follows:

Ligation reaction mixture:

5 µl 2x Rapid Ligation Buffer

1 µl pGEM-T Easy Vector (50 ng)

3 µl PCR product

1 µl T4 DNA Ligase (3 Weiss units/µl)

The reaction was mixed by pipetting and incubated overnight at 4°C Generally, incubation overnight at 4°C will produce the maximum number of transformants

2.2.7 E.coli transformation

Transformation was performed to screen for inserts The tubes containing the ligation reaction were centrifuged to collect contents at the bottom of the tube 2 µl of ligation reaction was transferred to a 1.5-ml microcentrifuge tube on ice JM109 competent cells from -80°C storage were thawed in an ice bath for about 5 min and the content of the tubes were mixed gently by flicking 50 µl of competent cells were added to the

respective ligation reaction and the mixture were flicked gently and placed on ice for 30 min The cells were then heat shocked for 1 min in a water bath at 42°C, and the tubes were immediately returned to the ice for 2 min 800 µl of Luria-Bertani (LB) medium was added to the tubes containing the cells transformed with ligation reactions and incubated for 1.5 h at 37°C with shaking at approximately 200rpm During the incubation period, 30 µl of Xgal and 10 µl of IPTG were added to LB ampicillin agar plate for blue-white selection After 1.5 h, the cells were pelleted at 5,000 rpm for 1 min, resuspended

in 100 µl of LB medium and the mixture was plated The plates were incubated overnight

at 37°C

After 37°C overnight incubation, the LB plates were stored at 4°C for 30 min to facilitate blue-white screening White colonies generally contained inserts and they were picked and incubated for 14-16 h in 3 ml of LB medium The composition of reaction mixture for screening insert is:

0.3 µl Taq DNA polymerase (recombinant, MBI Fermentas)

The PCR cycling condition was: 94°C for 10 s, 56°C for 20 s and 72°C for 1 min 30 s Detection of the PCR product was performed by agarose gel electrophoresis and ethidium bromide staining For preparative gels, low-melting-point (LMP) agarose and 1x TAE buffer were used

Ethidium bromide (EB) Stock solution:

10 mg/ml in water, store in dark

2.2.8 Plasmid DNA isolation and test digestion

After the determination of positive clones by PCR screening, mini-preps were performed using QIAprep Spin Miniprep Kit (QIAGEN) for the purification of plasmid DNA Positively-screened bacterial cells were pelleted at 5000 rpm for 1 min and the pelleted cells were resuspended in 250 µl Buffer P1 (RNase was added to Buffer P1 prior use)

250 µl of Buffer P2 was added and the tubes were gently inverted for 4-6 times to mix

350 µl of Buffer P3 was immediately added and the tubes were again inverted 4-6 times The tubes were then centrifuged for 10 min at 14,000 rpm in a table-top microcentrifuge

The supernatant was transferred to the QIAprep spin columns and centrifuged for 1 min

at 14,000 rpm The flow-through was discarded, and the QIAprep spin columns were washed by adding 0.5 ml Buffer PB and centrifuged for 1 min at 14,000 rpm The flow through was again discarded, and the QIAprep spin columns were washed by adding 0.5

ml Buffer PE and centrifuged for 1 min at 14,000 rpm The flow-through was discarded, and centrifuged for an additional 1 min to remove residual wash buffer This step is important as residual ethanol from Buffer PE might inhibit enzymatic reactions The QIAprep columns were then placed in clean 1.5 ml centrifuge tubes 20 µl of Buffer EB was added to the centre of each QIAprep Spin column, and centrifuged for 1 min to elute the DNA Test-digestion was performed at 37°C for 2-4 h as follows:

2.2.9 DNA sequencing and analyses

Upon confirmation of positive inserts by test digestion, DNA sequencing was performed using Big Dye Terminators v3.1 Cycle Sequencing Kit (ABI PRISM) The total sequencing reaction (5 µl) was: 2 µl DNA template (> 10ng), 1 µl M13 primer (3.2 pmol),

2 µl Big Dye (v3.1) The PCR cycling condition was: 94°C for 10 s, 50°C for 5 s and 60°C for 2 min The plasmid DNAs were purified with 20 µl ethanol/sodium acetate

solution from a stock solution consisting of 3 µl of 3M sodium acetate (pH 4.6), 62.5 µl

of non-denatured 95% ethanol and 14.5 µl of deionized water The tubes were vortexed briefly and left at room temperature for 15 min to precipitate the extension products The tubes were centrifuged at maximum speed for 20 min and the supernatants were removed immediately as dissolved unincorporated dye terminators would affect sequencing reactions 500 µl of 70% alcohol was added to the tubes and mixed briefly The tubes were placed in the microcentrifuge in the same orientation and spun for 5 min at maximum speed This step was repeated once to ensure complete purification After the second wash, the supernatant was aspirated carefully and the samples were dried in a vacuum centrifuge for 10 min 12 µl of High Dye (ABI PRISM) was added and reaction mixture was vortexed briefly The samples were transferred to a 96 well plate for sequencing reaction using ABI 3100 automated DNA sequencers

Nucleotide sequences obtained were blasted and checked with the software provided at URL: http://www.ncbi.nlm.nih.gov/BLAST Upon confirmation of nucleotide sequences, the amino acid sequences were translated with the software provided at URL:

http://tw.expasy.org Homologs which have been identified in other organisms were obtained from the GenBank database and used for amino acid comparisons and phylogenetic analyses The amino acid sequences were aligned using Vector NTI Suite 7,

calculates the homology matrix and establishes related distances between all pairs of sequences One thousand bootstrap trials were run by means of neighbour-joining algorithm for each node of the trees 4 sub-families of Sox proteins were used as out groups to root the tree, namely Sox2 in group B1, Sox 9 in group E, Sox 21 in group B2

and Sry in group A (Schepers et al., 2002) For Vasa analysis, the lcVasa protein and its homologs were used for phylogenetic comparison and their sub-families PL10, p68 and GLH were used to root the tree For Dazl analysis, the lcDazl protein and its homologs were used for analysis and their ancestral homologs boule were used to root the tree.

2.2.10 RT-PCR

RT-PCR was used for mRNA analysis in this study as it is a sensitive technique for mRNA detection and quantification In RT-PCR, an RNA template is copied into a complementary DNA transcript (a cDNA) using a retroviral reverse transcriptase The cDNA sequence of interest is then amplified exponentially using PCR by two gene specific primers (GSP) The composition reaction mixture for RT-PCR is as follows:

Taq DNA polymerase (recombinant, MBI Fermentas)

PCR was run for 35 cycles at 95°C for 20 sec, 60°C for 20 secand 72°C for 60 sec The primers used for RT-PCR analysis (including cytoplasmic beta-actin transcript for calibration) are listed as follows:

SOX-RT2 5’-CGCCGGGAGGCAGGTACATGCTTATCAT-3’

MA1 5’-CTGGGATGACATGGAGAAGATCTG-3’

MA2 5’-TGGAGCCTCCAATCCAGACAGAGTATT-3’

2.3 In-situ Hybridization (ISH)

2.3.1 Preparation of RNA probes

A series of primers were designed for RNA probes based on the daz, vasa and sox3 cDNA sequences The PCR products obtained were cloned into PGEM T-easy vector (Promega) PGEM T-easy vector is ideal for ligation because it contains promoters for T7 and SP6 RNA polymerases essential for probe labelling The vectors were digested with

the following enzymes: daz and vasa PCR fragments were digested with Sph1 for sense probes and Pst1 for sense probes, whereas sox3 PCR fragment was digested with Sph1 for anti-sense probe and Not1 for sense probe After digestion, the anti-sense and

anti-sense probes were synthesized by DIG RNA Labeling Kit (Roche) DIG RNA Labeling

Kit generates DIG labeled, single stranded RNA probes of defined length by in vitro

transcription of template DNA in the presence of DIG-UTP, using T7 or SP6 polymerase The anti-sense RNA probe synthesis reaction mix was set up as follows:

Reaction mixture:

2 0µl 5x Transcription Buffer

1 0µl NTP labeling mixture 10x concentration

0.5 µl RNase inhibitor (20 units/ µl)

1 0µl SP6 RNA Polymerase (20 units/ µl)

4 0µl Sph1 single digested plasmids of vasa, daz and sox3

1.5 µl DEPC treated water

Similarly, for sense RNA probe synthesis, Pst1 and Not1 single digested plasmids (pGEM T-easy Vector) of vasa, daz and sox3 with T7 RNA Polymerase were used

2.3.2 Cryosection, ISH and HE staining

Ovary and testis of the seabass were dissected and fixed in 4% PFA (paraformaldehyde)

in 0.1 M phosphate buffered saline (PBS) (pH 7.4) at 4°C overnight, followed by incubation in 0.5 M sucrose in PBS at 4°C for another night The tissues were embedded

in Optimal Cutting Temperature (OCT) embedding compound at - 80°C The slides were coated with (0.1% (w/v) polylysine Cryostat cross-sections were prepared: ovary at 12

µm, testis at 10 µm The cross sections were hybridized with either sense or antisense probes (approximately 1 ng/µl) in hybridization buffer at 68°C for 16-24 hours The

slides were washed 3 times in wash solution for 30 min at 65°C, and then washed twice

in MABT solution for 30 min at room temperature (RT) The slides were blocked with MABT containing 2% blocking reagent and 10% heat-inactivated sheep serum for 1 h at

RT After blocking, the slides were incubated 1 h at RT with 1/1000-diluted digoxygenin antibody coupled with alkaline phosphatase (Boehringer Mannheim) in blocking solution Subsequently, slides were washed 3 times in MABT for 5 min, followed with 2 times in NTMT solution for 15 min The slides were then incubated with NBT/ BCIP staining solution in the dark according to the manufacturer’s instructions (Roche, Germany) After the colour had developed to the desired intensity, the slides were washed in distilled water for 30 min, followed by dehydration in ascending ethanol concentrations (30%, 60%, 80%, 95%, and 100% for 1 min each) and cleared in xylene before mounting under coverslips Gonadal tissues were stained in haematoxylin–eosin (HE) for structural analysis

2.4.1 Primary testicular cell culture

Fish were placed on ice and sterilized with 70% ethanol Testes were dissected, washed several times with PBS in a 6-cm dish, and minced with a fine scissors The testicular fragments were transferred into 1 ml of cold trypsin-EDTA, incubated for 4 h on ice followed by 20 min at 28°C The fragments sank down to the bottom during incubation

The supernatant was aspirated without disturbing the fragments Germ cell culture medium (GCM) was added to the tube and cells were released by vigorously pipetting GCM was composed of DMEM containing 4.5 g/L glucose supplemented with 20 mM Hepes, antibiotics (penicillin, 50 U/ml; streptomycin, 50 µg/ml), glutamine (2 mM), sodium pyruvate (1 mM), sodium selenite (2 nM), non-essential amino acids (1 mM), 2-mercaptoethanol (50 µM), recombinant human basic fibroblast growth factor (bFGF, 10 ng/ml; PeproTech, Rock Hill), fetal bovine serum (15%), fish embryo extract from the seabass (1 embryo/ml; see below), and seabass serum (1%, see below) The cell suspension was allowed to stand at room temperature for 10 min so that fragments and large cell clusters sank to the bottom Single and clustered cells were seeded into 1 ml of GCM in gelatin-coated 12-well plates Cells were cultured at 28°C in air Sperm and spermatids were present in primary cultures from mature testes and removed by PBS wash and medium change daily during the first week

2.4.2 Preparation of embryo extract and fish serum from the seabass

To prepare embryo extract, 22h-old seabass embryos were rinsed in PBS and homogenized in an ice-water bath The homogenate was subjected to three freeze-thawing cycles and centrifuged for 30 min at 15000 rpm at 4°C The upper lipid layer was discarded and the clear supernatant was filtrated through a 0.2-µm filter Whole blood was collected from the caudal vein of the seabass and serum was prepared as described (Hong & Schartl, 1996)

2.4.3 Plasmid construction and cell transfection

Plasmids pCVpf and pCVpr express the puromycin acetyltransferase (pac) are fused to the enhanced green fluorescent protein (EGFP) or red fluorescent protein (RFP) (Zhao &

Hong, unpublished) in a backbone of pEGFP-N1 and pDsRed-N1 (Clontech) Plasmids

pRtVEGFP and pVEGFP express the EGFP from the rainbow trout (Yoshizaki et al., 2000) and medaka vasa regulatory sequence (Tanaka et al., 2001) respectively The

plasmid maps are provided in the appendix for reference

Plasmid DNA was prepared using the Qiagen Plasmid Maxi Kit (Qiagen GmbH, Hilden) Testicular cells at day 3 of culture were grown at 80% confluence in 12-well plates and transfected by using the GeneJuice transfection reagent according to the supplier’s instruction (Novagen) Briefly, complexes formed between 1 µg of plasmid DNA and 4 µl of GeneJuice reagent were applied to cells in pure medium (DMEM with

20 mM Hepes, pH7.7) After incubation for 4 h at 28°C, the pure medium was replaced with the complete GCM At days 2-4 of post transfection, gene expression was monitored

by fluorescent microscopy For cotransfection, pCVpr was combined with pCVpf (or pVEGFP and pRtVEGFP) at a ratio of 1: 4, where pCVpr served an internal control for microscopic examination of transfection efficiency

Chapter 3: Results

3.1 Seabass vasa : Lcvasa

3.1.1 Isolation of seabass vasa cDNA

A fragment approximately 734 bp was obtained using degenerate primers DVASA-F (ATGTAYAACATGATGGARAC) and DVASA-R (TCYGGGTGYTCCTTCATGTG) based on the conserved amino acids (aa) sequence of Vasa homologs 3’ RACE performed with primer Vasa3F (GTCAGCAAGTCTGGTTACGTGAA) generated a TAG stop codon and a 3’ untranslated region (UTR) of 302 bp Blast search against public data banks using the putative vasa cDNA and its deduced protein sequence generated a best hit to known Vasa members from other vertebrate species A sequence comparison shows that lcVasa is 82%, 82%, 79%, 77%, 78%, 64%, 68% and 69% to that

of tilapia, medaka, trout, zebrafish, carp, chicken, mouse and human Mutiple alignment show that they all contain the DEAD box and other conserved elements characteristic of RNA helicase-related proteins (Schmid and Linder, 1992) The eight consensus sequences characteristics of the DEAD-box protein family are highlighted in grey boxes (Fig 2) Phylogenetic analysis with Vasa homologs and their sub-families PL10, GLH and p68 shows that the tree bifurcates into several branches and lcVasa belongs to the same clade as the other Vasa proteins, showing consistency between evolutionary relationships (Fig 3)

s t o p c o d o n i s d e n o t e d b y a n a s t e r i s k

C.elegans CeGLH1, P34689 C.elegans CeGLH2, NP_491876

100

Zebrafish PL10, NP571016Mouse PL10, AAA39942 100

Seabass vasa, Tilapia vasa, AB03246787

Medaka vasa, BAB61047 99

Trout vasa, BAA88059Zebrafish vasa, CAA72735Carp vasa, AAL87139100

97100

Mouse Vasa, BAA0384Human vasa, AAF86585100

Chicken vasa, BAB1233794

100

Hydra vasa, BAB13307Oyster vasa, AY42338086

80

68

Human p68, P17844Mouse p68, CAA46581 100

Xenopus p68, AAF73861

100

Human p82, NP_006377100

0.05

this study

Fig.1C Phylogenetic tree of Vasa proteins The amino acid sequences were aligned using

DNAMAN (Version 4.15) Number at each node represents the percentage value given by

number The Vasa sub-families PL10, GLH and p68 were used as out groups to root the tree lcVasa is grouped with other teleost in the Vasa clade, reflecting a strong conservation of amino acid sequences within the teleost family

3.1.2 Expression by RT-PCR

The expression of lcvasa was examined by RT-PCR in several organs (Fig 2A) and embryos at

different stages (Fig 2B) with primer pair VASA-RT1

(TGTGAAAATGGGTTTAGAGGAGGAAGCC) and VASA-RT2

(GAGATGATCGGGGATGCCATGCTTCT) Lcvasa was expressed in ovary and testis and absent

in all somatic tissues Expression of lcvasa was strong in the early stages of embryonic development,

and the signals became weaker from somitogenesis onwards, suggesting that lcvasa is maternally

supplied Total RNA was used for reverse transcription The PCR product of the lcvasa is 430 bp

and the cytoplasmic beta-actin (BA) transcript for calibration is 800 bp

3.1.3 Expression by ISH

HE staining revealed the maturity stages the seabass gonads; late large oocyte growth was observed

in the mature female with numerous vitellogenic oocytes and a few pre-vitellogenic oocytes ie

Chromatin-nucleolar and perinucleolar oocytes Ooplasm is occupied by large populations of yolk

and lipid globules (Fig 3A) In the mature male, the arrangement of germ cells in the seminiferous

tubules of the testis is cystic Spermatogenesis was observed with the predominance of

spermatocytes and spermatids but spermtogonia were not well defined The onset of spermiogenesis

could be seen in certain lobules filled with spermatids and spermatozoa (Fig 3D) In order to

understand the role of vasa gene in germcell determination in the protandrous seabass, we analyzed

the expression patterns in the ovary and testis by ISH Lcvasa was expressed in the perinuclear

cytoplasm of pre-vitellogenic oocytes, mainly the chromatin-nucleolar oocytes and perinucleolar

oocytes (Fig 3B) As vitellogenesis proceeds, the mRNA became restricted to the cortex in a smaller

region in the mature vitellogenic oocytes (Fig 3C) In the testis, patches of signals were observed

mainly in the spermatocytes but not in spermatids or spermtazoa (Fig 3F), as compared the sense

probe (Fig 3E)