dna barcoding gene cytochrome c oxidase subunit i of channa species in the mekong delta

This genus shows a variety of variation in morphology, resulting in 7 different local names while only 4 speices, including Channa striata, Channa micropeltes, Channa lucius, and Channa

CAN THO UNIVERSITY COLLEGE OF AQUACULTURE AND FISHERIES

DNA BARCODING GENE CYTOCHROME C OXIDASE SUBUNIT I

OF CHANNA SPECIES IN THE MEKONG DELTA

By NGUYEN THI NGOC TRAN

A thesis submitted in partial fulfillment of the requirements for

the degree of Bachelor of Aquaculture Science

Can Tho, December 2014

CAN THO UNIVERSITY COLLEGE OF AQUACULTURE AND FISHERIES

DNA BARCODING GENE CYTOCHROME C OXIDASE SUBUNIT I

OF CHANNA SPECIES IN THE MEKONG DELTA

By NGUYEN THI NGOC TRAN

A thesis submitted in partial fulfillment of the requirements for

the degree of Bachelor of Aquaculture Science

Supervisor

Dr DUONG THUY YEN

Can Tho, December 2014

DNA BARCODING GENE CYTOCHROME C OXIDASE SUBUNIT I

OF CHANNA SPECIES IN THE MEKONG DELTA

Nguyen Thi Ngoc Tran 1 and Duong Thuy Yen 2

1 Advanced Aquaculture Course 36 2

Department of Freshwater Aquaculture College of Aquaculture and Fisheries, Can Tho University

Email: tran108566@student.ctu.edu.vn

ABSTRACT

Channa species are indigenous freshwater fish that are important for aquaculture in Vietnam This genus shows a variety of variation in morphology, resulting in 7 different local names while only 4 speices, including Channa striata, Channa micropeltes, Channa lucius, and Channa gachua were scientifically classified The taxonomic systems of Channa species, especially three newly-observed phenotypes including Projected lip Channa, Triangle head Channa and Square head Channa are still controversial This study aimed to investigate the taxonomic classification of different phenotypes of Channa species and understand phylogeny relationship of Channa species based on morphological characteristics and DNA barcoding (Cytochrome C oxidase subunit I, COI) Thirty individuals of each phenotype were measured morphological characteristics, and five of these were sequenced COI gene Morphological results showed that Triangle head Channa and Square head Channa had similar ranges of countable parameters, but were different in the shape of their head The phylogeny tree based on 684 base-pair region of COI gene showed that 6 Channa species formed 2 large branches with C striata (and 2 Channa phenotypes) – C gachua and C micropeltes – C lucius COI gene sequences of 2 undefined species (Triangle head Channa and Square head Channa) were 99% identity with C striata Based on countable traits and COI gene, it can be concluded that Triangle head Channa and Square head Channa are the same species with C striata

Keywords: Channidae, species classification, DNA barcoding, species diversity, morphology

1 INTRODUCTION

Channa species are among the most popular species in Viet Nam There are four

species of Channa found in the Mekong Delta of Viet Nam, including Channa striata, Channa micropeltes, Channa lucius, Channa gachua (Truong Thu Khoa and

Tran Thi Thu Huong, 1993) Beside these common species there are some new phenotypes that have not been taxonomically classified They are “triangle head

(TH) Channa”, “projected lip (PL) Channa”, “square head (SH) Channa”, which

have been cultured popularly in the Mekong Delta and are favorite food for local consumers Thanks to their high flesh quality and price, culturing them has brought a lot of benefits and improved income for fish farmers in many provinces in Viet Nam

such as An Giang, Dong Thap, Ca Mau and Can Tho (Nguyen Bach Loan et al.,

2003)

In previous studies, Channa species were classified by morphological methods Channa species had similarities in elongated body and cylinder shape (Truong Thu Khoa and Tran Thi Thu Huong, 1993) Head was broad and flattened with large

mouth, strong teeth and projecting lower jaw (Tran Dac Dinh et al., 2013) The

dorsal fin was longer than anal fin and beginning the pectoral fin (Rainboth, 1996)

C micropletes was distinguished by the completed lateral line and many black spots

in body C gachua was recognized by orange edge in the dorsal, anal and caudal fin

The lateral line that broke suddenly in one point and fell into 2 slides of scales

belonged to the group of C lucius and C striata However, C lucius was different from C striata in the dorsal profile of head concaved (Tran Dac Dinh et al., 2013) Moreover, the appearance of camie tooth of C lucius helped recognize it from C striata (Truong Thu Khoa and Tran Thi Thu Huong, 1993)

Besides four morphologically distinct species, TH Channa, SH Channa and PL Channa were still on research A previous study comparing morphological characteristics between PL Channa and C striata showed that 18 of 20 measurable parameters were significantly different (p<0.05) (Nguyen Van Trong et al., 2005)

Another study by Nguyen Van Hoa (2008) reported that TH Channa, SH Channa,

and PL Channa were the same species evidenced by similarities in the number of

dorsal fin, pectoral and anal fin rays, lateral line scales and measurable ratio

However, 84.21% of countable parameters of C striata were different from those of

PL Channa An example of differences between these two Channa groups was the

ratio between the upper jaws and lower jaws Therefore, it was hyphothesized that

PL Channa could be a new phenotype of C striata There is still a controlversial question whether the new phenotypes of Channa including TH Channa, SH Channa and PL Channa are the same species Morphological comparision in previous studies

has not provided convincible and complete answers

Nowadays, the molecular technology has developed Molecular markers are used to classify fish species to supply more clearly information for tradditional morphological methods Several genes have been used for species classification Among which, COI gene (cytochrome c oxidase subunite I) can serve as DNA

barcoding for identification of species including fish (Hebert et al.,2003) For

example, it was used to characterize and identify domestic and imported fishes in

Australia (Ward et al., 2005) DNA barcoding was also used to find divergences among marine fishes in South Africa (Zemlak et al., 2009) Analyzing of COI gene

represented an important step in species identification for half of the ornamental fish

species imported to North America (Steinke et al., 2009) Moreover, morphological

characteristics of fish changed quickly and significantly during its development from eggs to larvae, so DNA barcoding has become a useful tool to check the accuracy of

tradditional larval fish identification (Ko et al., 2013)

This study firstly investigated the taxonomic classification of different phenotypes of Channa species by comparing morphological characteristics of different phenotypes

of Channa spp (“TH Channa” and “SH Channa) and two morphologically similar species (C striata and C lucius) Secondly, the study compared COI gene sequences

of Channa species to understand phylogeny relationship of Channa species based on morphology characteristics and DNA barcoding (COI)

2 MATERIALS AND METHODS

2.1 Fish sampling

Samples of Channa species including C striata, C micropeltes, C gachua, C lucius, and two unidentified phenotypes called TH Channa, SH Channa were collected from

farmers and local markets in Can Tho, Hau Giang, and Vinh Long provinces Each species was sampled 25 to 35 individuals for morphological classification and measurements Among those samples of each species, 12 samples were collected

caudal fins which were stored in eppendorff tubes containing ethanol 96% for DNA analysis

2.2 Morphology classification methods

Fish was kept alive or stored in ice and transferred to the fish genetic laboratory Then, fish was observed the external characteristics including color, shape of body, head, tail, and lateral line The samples were classified and measured morphological parameters based on previous literature of Truong Thu Khoa and Tran Thi Thu

Huong (1993) and Tran Dac Dinh et al (2013) There were totally 21 measurable

parameters and 6 countable parameters Among those measurable parameters, 6 parameters were calculated ratios to standard length (SL), 8 parameters were compared ratios to head length (HL) and 2 parameters were ratio to lower jaw length (LJ)

2.3 DNA analysis methods

2.3.1 DNA extraction: DNA was extracted from fish fins by using the

Phenol-chloroform method (Taggart et al., 1992)

2.3.2 PCR amplification: The gene COI of DNA mitochondria was amplified using

a pair of primers

Fish F2-t1:

TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC

and Fish R2-t1:

5‟CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA‟3 The final concentrations of PCR ingredients in 31 µL PCR product were 22.11L distilled water, 3.1 L buffer, 0.62 L dNTP 10 mM, 0.62 L MgCl2 15 mM, 0.62

L primer Fish F2-t1, 0.62 L primer Fish R2-t1 10 pmol, 0.31 L taq 5U, and 3 L DNA

The temperature cycles of PCR reaction included 1circle at 95oC in 2 minutes, 35 circles of amplification including 30 seconds at 94oC, 30 seconds at 52oC and 1minute at 72oC, and 1 circle of final extension at 72oC for 10 minutes (Ward et al,

2005)

2.3.3 Electrophoresis and sequencing: The quality of extracted DNA and PCR

products was checked by agarose electrophoresis (1%) Five of good PCR products from each fish species were chosen for sequencing which was analyzed by Nam Khoa Company (Ho Chi Minh city)

2.4 Data analyses

2.4.1 Morphological data

Morphological data were calculated mean, standard deviation, mode, frequency of mode values by using Microsoft Excel and SPSS 16.0 One way ANOVA with Duncan test was used to compare the morphological ratios among Channa species

2.4.2 DNA Sequence analysis

DNA was analyzed by the programs Finch TV 1.4.0 (http://www.geospiza.com/), Mega6 (http://www.megasoftware.net/), and BLAST (Basis Local Alignment Search Tool) (http://blast.ncbi.nlm.nih.gov/Blast.cgi) Finch TV and Mega6 were used to view and check quality of DNA sequences between 2- direction sequences The nucleotide with higher quality value was selected, if forward and reserve sequences were mismatched in a nucleotide Edited sequences within and among species were

aligned and then compared levels of sequence similarity with database in GENBANK using BLAST program Mega6 compared or aligned DNA sequence of forward and reverse sequences of each sample; among species; and of DNA sequences database available at GENBANK From those results, the detail phylogeny analysis information such as nucleotide composition of analyzed species, genetic distance within and between species, phylogeny trees were shown BOLD system also identified the species and compared the genetic relationship among the analyzed species and similar species in other areas through phylogeny trees

3 RESULTS

3.1 Morphological comparison of Channa species

3.1.1 External appearance

From the external characteristics, C lucius and C striata, TH Channa, SH Channa

have similarities in the lateral line that breaks suddenly in one point and fall into 2

slides of scales These species have no barbels C lucius‟s morphology is different from the group of C striata, TH Channa and SH Channa in some characteristics C lucius has dark spots in the outside of body In addition, the dorsal profile of C lucius „s head is concaved There are several black vertical lines in the ventral part of

its body

Figure 1 Channa lucius Figure 2 Channa striata

Meanwhile, TH Channa and SH Channa look alike C striata in the body shape

Dark brown color and whitish in ventral part of these 2 species are similar to the

external color of C striata It is much difficult to differentiate 3 of these species by

naked eyes

Figure 3 Square head Channa Figure 4 Triangle head Channa

3.1.2 Countable parameters

Totally 115 samples of Channa species with similar sizes were collected for

morphological analysis The range of total length of C lucius is from 17 – 30 cm, C striata is from 23 – 30 cm, TH Channa is 21 – 35 cm and SH Channa is 23 – 34cm The countable parameters of C striata and C lucius are consistent with the previous

research by Truong Thu Khoa and Tran Thi Thu Huong (1993) (Table 1)

SH Channa and TH Channa have similar ranges of the number of lateral line scales

and dorsal fin, pectoral fin, and anal fin rays In addition, those values are nearly the

same with C striata

Table 1 Range, mode and frequency of countable parameters of Channa species

(N=27)

C striata

(N=30)

TH

Channa

(N=34)

SH

Channa

(N=24)

Scales of

lateral line

Mode (Frequency, %) 61 (37.04) 54 (36.67) 54 (23.53) 56 (37.5) Scales upper

of lateral

line

Scales lower

of lateral

line

Dorsal fin

rays

Mode (Frequency, %) 40 (51.72) 42 (53.33) 42 (52.94) 42 (41.67) Pectoral fin

rays

Mode (Frequency, %) 16 (41.38) 16 (60.00) 17 (52.94) 15 (50.00)

Mode (Frequency, %) 28 (58.62) 27 (56.67) 26 (73.53) 25 (50.00)

3.1.3 Ratios of measurable parameters

All of the ratios of measurable parameters to standard length, head length, large head width and lower jaw length were significantly different showing the differences in

morphology among C lucius, C striata, SH Channa and TH Channa (Table 2) Comparing to the group of C striata, C lucius has long head, high body depth, high

caudal fin depth and long dorsal fin In contrast, the distance from mouth to dorsal

fin, anal fin and pectoral fin are short Focusing on the shape of the head, C lucius

has medium head length The ratio between the standard length and small head

width and large head width indicates that C lucius has pointed head but not very

pointed in comparison to the TH Channa

Although the external characteristics of 3 groups of Channa (C striata, TH Channa, and SH Channa) are difficult to distinguish, they are different in the shape of their

head The head width, jaws length, and eyes distance of 3 groups are significantly different (p<0.05) As a result, the ratios of head length to standard length; small head width, large head width and eyes distance to head length describe different

images of fish head (Figure 5) C striata‟s head is the slimmest among 3 groups The head of SH Channa is larger and shorter; therefore it looks like a square shape Meanwhile, TH Channa has the shortest ratio of head length/ standard length, and

head width at the biggest position of the head is larger than head width before eyes, creating the shape of a triangle These images can explain common names of two

Channa phenotypes called by farmers Moreover, the ratio of upper jaw and lower

jaw length also helps differentiate 3 groups with the most projected lip from SH

Channa

Table 2 Mean of ratios of measurable parameters of Channa species

Measurable

parameters

Channa lucius

(N=27)

Channa striata

(N=30)

TH Channa

(N=34)

SH Channa

(N=24)

Ratio to standard length

Head length (HL) 33.92 ± 1.04 d 33.14 ± 1.07 c 28.15 ± 1.47a 31.60 ± 0.78 b Body depth (BD) 17.78 ± 0.93 c 14.29 ± 0.46 b 15.55 ± 0.55 c 13.41 ± 0.75 a Height of caudal fin

d

8.52 ± 0.30 b 8.83 ± 0.50 c 7.94 ± 0.54 a

Dorsal fin length

c

59.06 ± 1.69 b 60.99 ± 2.69 c 56.83 ± 1.56 a

Ratio to head length

Head depth (HD) 47.52 ± 3.09 b 42.53 ± 2.05 a 51.44 ± 2.42 c 43.33 ± 2.13 a Small head width

a

33.01 ± 1.70 b 35.19 ± 2.18 c 35.53 ± 1.84 c Large head width

a

52.45 ± 2.07 b 59.62 ± 2.61 d 54.45 ± 2.08 c Distance of two eye

a

27.16 ± 1.32 a 30.50 ± 1.71 c 28.41 ± 1.45 b Eyes diameter (ED) 11.52 ± 0.88 a 11.63 ± 0.73 a 14.11 ± 0.89 b 11.72 ± 1.03 a Upper jaw length

a

38.27 ± 1.49 c 36.50 ± 1.91 b 39.05 ± 1.90 c Lower jaw length

a

41.57 ± 1.86 c 40.36 ± 1.86 b 44.10 ± 1.55 d Mouth width (MW) 34.61 ± 1.66 a 42.68 ± 1.89 bc 42.05 ± 1.97 b 43.49 ± 1.64 c

Ratio to large head width

Small head width

a

62.97 ± 2.85 b 59.07 ± 3.4 a 65.28 ± 3.26 c

Ratio to lower jaw length

Upper jaw length

b

92.09 ± 3.84 b 90.51 ± 4.17 ab 88.56 ± 3.40 a Mouth width (MW) 102.00 ± 1.89 b 102.68 ± 1.64 bc 104.33 ± 5.19 c 98.68 ± 3.27 a

The values in the same row with different characters showed the significant difference with p<0.05

Figure 5 Image of the head of Channa striata, TH Channa and SH Channa

Note: the head length was based on the ratio of head length to standard length Other length were based on the ratio to head length

3.1.3 Relative gut length (RGL)

The ratio between gut length and standard length (or relative gut length, RGL) of C lucius, TH Channa, and SH Channa is similar (p>0.05), which is significantly higher than that of C striata The gut lengths depend on the type of eaten feed Snakehead

species are known as carnivores which feed mainly on smaller fish, crab or shrimp Their RGL was smaller than 1, consistent with the feeding type of carnivores

(Nikolsky, 1963) In C striata collected in West Bengal, India, the gut consisted of only animal matter , and RGL was 0.57 (Dasgupta, 2000), smaller than RGL of C striata (0.78  0.15) in our study

TH Channa and SH Channa tend to increase the gut length compared to C striata In

recent years, they have been fed by combining commercial feed and trash feed Changes in feed used and the large amount of feed fed in culture conditions may result in the increase of their gut length

Figure 6 The relative gut length of Channa species

3.2 Phylogeny relationship of Channa species based on COI sequences

The length of COI sequence was chosen with 684 base-pairs Nucleotide composition of Channa species is divided into 3 groups (Table 3) The first group is only C micropeltes, the second group includes C gachua and C lucius; and the last group is the 2 new undefined species and C striata The nucleotide composition of

C micropeltes is different from the other species in Channa genus It has the highest percentage of Cytosin (31%), then Thymine, Adenin and Guanine In contrast, Thymine makes up the highest percentage (~30%) in the nucleotide composition of the other species Transitional substitiutions between groups of base are higher than transverstional substitutuions within groups (Table 4)

Table 3 Percentage of nucleotide composition of Channa species

Channa micropeltes 26.6 31.0 23.8 18.6

Comparing to the database in Genbank, COI sequences of four species C micropeltes, C striata, C gachua and C lucius has high levels (99-100%) of

similarity of the same reported species (Table 5) Besides, two new phenotypes SH

Channa and TH Channa are also highly similar (99%) to C striata

Table 4 Substitution matrix of Channa species

Note: Rates of different transitional substitutions are shown in bold and those of transversionsal substitutions are shown in regular

Table 5 Alignment of species‟ COI sequences with Genbank

No Species Aligned species Identity Accession

1 Channa micropeltes Channa micropeltes 100% JN024962.1

Table 6 Genetic distance within groups of Channa species

There is no genetic variation within groups of Channa species: C micropeltes, C gachua, C lucius and TH Channa On the other hand, C striata has higher

conspecific genetic distance (0.0047  0.0019) than SH Channa (0.0029  0.0021) Besides, the genetic distance within these 2 groups is higher than the other Channa species, indicating that they are more diverse than the other species (Table 6) Genetic distance between groups of Channa species is much higher than genetic distance within groups (Table 7) Therefore, genetic distance can be used to classify species of Channa

Table 7 Genetic distance between groups of Channa species

C.micropeltes C striata C gachua C lucius SH

Channa

TH Channa

Note: the value upper the diagonal are the standard error, the value lower the diagonal are the genetic distance between grop