Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells

MOLECULAR ANALYSIS OF THE GENE LAS17 MEDIATING T-DNA TRAFFICKING IN YEAST CELLS HARIPRIYA BATHULA DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2010... MOLECULAR

MOLECULAR ANALYSIS OF THE GENE LAS17 MEDIATING

T-DNA TRAFFICKING IN YEAST CELLS

HARIPRIYA BATHULA

DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE

2010

MOLECULAR ANALYSIS OF THE GENE LAS17 MEDIATING

T-DNA TRAFFICKING IN YEAST CELLS

HARIPRIYA BATHULA (B.pharm, M.Tech)

A THESIS SUBMITTED

FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE

2010

ACKNOWLEDGEMENTS

I would like to thank my mentor Associate Professor Pan Shen Quan for his invaluable guidance and patience, without which this study would not be have been possible Special thanks to my labmate Tu Haitao for the help extended during the initial stages and also along the way All my labmates have played a vital role in my journey as

a graduate student So my special appreciation goes out to all the past and current members of the Bacterial Genetics and Biotechnology laboratory for their support and advice I would also like to thank all the support personnel in the Department of Biological Sciences for their help throughout the course of my research programme at the National University of Singapore

TABLE OF CONTENT Pages

Acknowledgements i

Table of contents ii

Summary v

List of Tables vi

List of Figures vii

List of Abbreviations viii

CHAPTER 1 1.1 Aim of the project 1

1.2 Background of Agrobacterium tumefaciens 2

1.3 The Agrobacterium-mediated transformation (AMT) process in plants 4

1.4 Agrobacterium-mediated transformation of Saccharomyces cerevisiae 8

1.5 Background of Las17 gene 13

CHAPTER 2 Materials and Methods 2.1 General Materials and Methods

2.1.1 Yeast and Bacterial Strains 15

2.1.2 Culture media, antibiotics and Stock Solutions 15

2.1.3 Plasmids 16

2.1.4 Primers 16

2.2 DNA Manipulations

2.2.1Plasmid DNA preparation from E.coli 22

2.2.2 Plasmid DNA preparation from A tumefaciens 22

2.2.3 Polymerase chain reaction (PCR) 22

2.2.4 DNA gel electrophoresis and purification 23

2.3 Agrobacterium-mediated Transformation of S.cerevisiae

2.3.1 Cell culture 24

2.3.2 Induction of A tumefaciens 24

2.3.3 Co-cultivation of A tumefaciens and S cerevisiae 25

2.3.4 Recovery and selection of transformants 25

2.4 Lithium Acetate Transformation of S.cerevisiae 27

2.5 PCR Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae

2.5.1 Co-cultivation and collection of Agrobacterium-transformed

S.cerevisiae 28

2.5.2 T-DNA extraction from Agrobacterium-transformed S.cerevisiae 29

2.5.3 PCR and gel electrophoresis analysis of T-DNA extracts 29

2.6 Fluorescent In- Situ Hybridization (FISH) Detection of T-DNA inside Agrobacterium-transformed S.cerevisiae

2.6.1 Cell preparation and Fixation 31

2.6.2 Probes Preparation and Quantification 32

2.6.3 In Situ hybridization 33

2.6.4 Antibody detection 33

2.7 Cell Imaging 25

2.7.1 Fluorescent microscopy 34

2.7.2 Confocal microscopy 34

CHAPTER 3 Results and Discussion 3.1 The role of Las17 gene in Agrobacterium-yeast gene transfer 36

3.2 The effect of Las17 knock-out mutation on Agrobacterium-mediated

transformation 37

3.3 The effect of ∆las17 on VirD2 nuclear targeting 43

3.4 The effect of Las17 knock-out mutation on T-DNA accumulation inside yeast cells 45

3.4.1 The time course analysis of T-DNA accumulation inside the wild type and Δlas17 yeast cells 46 3.5 Detection of individual T-DNA molecules inside the yeast cells 50 3.5.1 Percentage of yeast cells with T-DNA molecule at different

co-cultivation time points 51 3.5.2 Average copies of T-DNA per yeast cells 53

Chapter 4

General Conclusion and Future Work 56

Bibiliography 58

SUMMARY

Agrobacterium tumefaciens is known for its applications in plant genetic

engineering for its unique ability to transfer a segment of its DNA (T-DNA) from its

tumor-inducing (Ti) plasmid into plant cells, fungi and mammalian cells

Agrobacterium-mediated transformation is the only known case of trans-kingdom DNA transfer that

occurs in nature The ability of Agrobacterium tumefaciens to mediate trans-kingdom

transfer of genetic material has established an exciting paradigm in the field of genetic manipulation

It has been established that under laboratory conditions, Agrobacterium can also

transfer T-DNA into a wide range of other eukaryotic species, including yeast cells To

date, scientists have obtained a comprehensive understanding of Agrobacterium proteins

that mediate the transfer process, though the involvement of host proteins remains unclear

The current study aims to use yeast Saccharomyces cerevisiae as a eukaryotic model to identify and characterize host factors involved in Agrobacterium-mediated

transformation (AMT) So far, the genetic screening of yeast mutants has revealed that the knock-out of Las17 results in a significant increase in AMT efficiency In the current study, a series of genetic and bio-imaging approaches have been adopted to study the role

of Las17 gene in the DNA trafficking inside the yeast cells The results show that DNA is trafficked more efficiently in Las17 mutant cells implying that the

T-Agrobacterium mediated transformation process employs an endocytosis-independent

pathway

LIST OF TABLES

Page Table 2.1 Bacterial and yeast strains used in this study 17

Table 2.2 Media used in this study 18

Table 2.3 Antibiotics and Solutions used in the study 19

Table 2.4 Plasmids used in this study 19

Table 2.5 Primers used in this study 20

Table 3.1 Agrobacterium-mediated transformation efficiencies 39

Table 3.2 Percentage of yeast cells with T-DNA molecules at different co-cultivation period 52

Table 0.3 Average Copies of T-DNA per Cell 54

LIST OF FIGURES

Page

Figure 1.1.Plasmid Map of Ti Plasmid 6

Figure 1.2 A tumefaciens T-DNA transfer system into plant cell 11

Figure 1.3 Schematic representation of the A tumefaciens T-DNA

transfer system in yeast 12 Figure 2.1 The plasmid map of pHT101 21

Figure 2.2 Schematic representation of the Agrobacterium-mediated

Transformation of S.cerevisiae experiment 26

Figure 2.3 Schematic representation of PCR Detection of T-DNA inside

Agrobacterium-transformed S.cerevisiae experiment 30

Figure 2.4 Fluorescent In-Situ Hybridization (FISH) Detection of T-DNA

inside Agrobacterium-transformed S.cerevisiae 35

Figure 3.1 Agrobacterium-mediated Transformation Efficiency 41

Figure 3.2 Fold difference in the AMT efficiency between wild type yeast 42 and Δlas17

LIST OF ABBREVIATIONS

AMT Agrobacterium-mediated transformation

dsDNA double-stranded DNA

EDTA ethylene diamine tetra acetic acid

GFP Green Fluorescent Protein

HRP Horse Radish Peroxidase

hrs hour(s)

PCR Polymerase Chain Reaction

FISH Fluorescent In-Situ Hybridization

mg milligram(s)

mM millimole

RNA ribonucleic acid

RNase ribonuclease

rpm revolutions per minute

SDS sodium dodecyl sulphate

ssDNA single-stranded DNA

CHAPTER 1

1.1 Aim of the project

The aim of the project is to employ S cerevisiae as a eukaryotic model to identify and characterize host cellular factors involved in the Agrobacterium-mediated

transformation (AMT) process The role of the bacterial factors were extensively studied and well understood In contrast, the roles of the host proteins are relatively unknown Recent studies have shown the importance of the host factors in this process (Tzfira and

Citovsky 2002, Roberts et al 2003, Anand et al 2007) Such studies provide broader

insights into the mechanisms underlying inter-kingdom DNA transfer and also the utility

of A.tumefaciens in genetic engineering

In order to investigate the role of host factors in the AMT process, a throughput screening of the entire S cerevisiae knock-out library, emanable to AMT process was conducted (Tu, result not published) Genes with significant effect on AMT efficiency were identified and then examined further to determine their role in the AMT process During the screening, Las17 mutant was shown to increase the AMT efficiency

high-by 8 folds This is a significant change and hence Las17 gene was selected to study and elucidate its role in the AMT process

Las 17 is an Actin assembly factor, found to activate the Arp2/3 protein complex that nucleates branched actin filaments and localize with the Arp2/3 complex to actin

patches during endocytosis It is a homolog of the human Wiskott-Aldrich syndrome protein (WASP) The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton

1.2 Background of Agrobacterium tumefaciens

Agrobacterium tumefaciens is a soil-borne bacterium and the causative agent of

crown gall disease in over 140 species of dicot plants (Smith and Townsend, 1907) So,

the natural host of Agrobacterium is a plant cell It is a rod shaped Gram-negative soil bacterium (Smith et al., 1907) Symptoms are caused by the insertion of a small segment

of DNA (known as the T-DNA, for 'transfer DNA') into the plant cell (Chilton MD et al.,

1977) which is incorporated at a semi-random location into the plant genome

Agrobacterium tumefaciens (or A tumefaciens) is an alphaproteobacterium of the

family Rhizobiaceae, which includes the nitrogen fixing legume symbionts Unlike the

nitrogen fixing symbionts, the tumor producing Agrobacterium are pathogenic and do not benefit the plant The wide variety of plants affected by Agrobacterium makes it of great concern to the agriculture industry (Moore LW et al., 1997).The host range has extended

to non-plant eukaryotic organisms such as yeast, filamentous fungi and also the

mammalian cells (Bundock et al., 1995; de Groot et al., 1998; Kunik, et al., 2001;Smith

and Townsend, 1907)

In order to be virulent, the bacterium must contain a tumor-inducing plasmid (Ti plasmid or pTi), of 200 kb, which contains the T-DNA and all the genes necessary to transfer it to the plant cell This Ti plasmid also consists of a virulence region, which contains a large number of vir genes These genes are required for inducing tumorous

growth (Michielse et al., 2005) The T-region of the Ti plasmid is located within a 24-bp border repeat that has cis acting signal for DNA transfer into the plant cells (Hoekema et

al., 1993) The T-DNA borders are necessary for processing the T-DNA complex in

A.tumefaciens during Agrobacterium-mediated transformation (AMT) process (Piers et

al 1996)

Many strains of A tumefaciens do not contain a pTi This bacterium recognizes

the wounded sites of plants and delivers a part of its virulence DNA (T-DNA) into plant cells Since the Ti plasmid is essential to cause disease, pre-penetration events in the rhizosphere occur to promote bacterial conjugation and exchange of plasmids amongst

the bacteria In the presence of opines, A tumefaciens produces a diffusible conjugation signal called 30C8HSL or the Agrobacterium autoinducer This activates the transcription

factor TraR, positively regulating the transcription of genes required for conjugation Once it is transferred into the plant cell, the T-DNA encodes enzymes for the synthesis of plant hormones such as auxin and cytokinin Accumulation of these plant hormones causes uncontrolled cell proliferation, leading to the tumor formations called crown galls (Gelvin 2003)

The capacity for gene transfer led to the development of A tumefaciens as a gene

vector Virtually any DNA cloned into the T-DNA can be transferred into plant cells

(McCullen and Binns, 2006) Such findings have made Agrobacterium the preferred vector for genetic engineering of many cash crops including tobacco (Lamppa et al, 1995), maize (Chilton, 1993), rice (Hiei et al, 1994), soybean (Chee et al, 1995) and wheat (Cheng et al, 1997)

1.3 The Agrobacterium-mediated transformation (AMT) process in plants

The natural host of A tumefaciens is the plant cell The formation, transfer and

Integration of the T-DNA into the plant cell requires three genetic components of

Agrobacterium The DNA, vir genes and the chv genes As described earlier the

T-DNA is a discrete segment of T-DNA located on the Ti plasmid of Agrobacterium and is delineated by two 25 bp repeats known as the T-DNA left and right borders (De Vos et

The third component is a set of chromosomal virulence (chv) genes, some of which are involved in bacterial chemotaxis and attachment to a wounded plant cell (Sheng and Citovsky, 1996) These genes play important roles in the T-DNA processing

and movement from A tumefaciens into plant cell nucleus

The bacterium attaches to the plant cell in response to the sugars and the plant phenolic compounds released during the wounding process as a defense mechanism The aattachment is a two step process Following an initial weak and reversible attachment, the bacteria synthesize cellulose fibrils that anchor them to the wounded plant cell Four

main genes are involved in this process: chvA, chvB, pscA and att It appears that the

products of the first three genes are involved in the actual synthesis of the cellulose fibrils These fibrils also anchor the bacteria to each other, helping to form a microcolony After the production of cellulose fibrils a Ca2+ dependent outer membrane protein called rhicadhesin is produced, which also aids in sticking the bacteria to the cell wall followed by the formation of the T-pilus

The vir operons are induced by plant phenolic compounds, such as acetosyringone (AS) to inturn activate the production of the T-DNA.At least 25 vir genes on Ti plasmid are necessary for tumor induction The AMT process begins with the recognition of host

cells by agrobacterium by chemotaxis by sugars and acetosyringone VirA

(transmembrane protein) and VirG are first the first two proteins that are activated upon recognition of the Acetosyringone Sugars are also recognized by the chvE protein, a chromosomal gene-encoded protein located in the periplasmic space (Gelvin 2003)

Figure 1.1.Plasmid Map of Ti Plasmid

The T-DNA region is delineated by the left border and right border In nature, this region consists of the opine biosynthesis genes Any DNA fragment can be cloned into T-DNA region and subsequently transferred into plant genome The 35kb virulence region consists of eight major loci (virA, virB, virC, virD, virE, virG, virJ and virH) which encode virulence proteins that assist in the AMT process (Adapted from commons.wikimedia.org/wiki/Image:Ti_Plasmid.jpg)

The VirA protein has a kinase activity, it phosphorylates it self on a histidine residue Then the VirA protein phosphorylates the VirG protein on its aspartate residue

(Cangelosi et al., 1990; Veluthambi et al., 1988) This also results in an increase in the levels of vir gene induction under the presence of specific monosaccharides (Cangelosi et

al., 1990) The VirG protein is a cytoplasmic protein transduced from the virG Ti plasmid

gene, it's a transcription factor It induces the transcription of the vir operons It also increases VirA protein sensibility to phenolic compounds (Gelvin 2003)

Consequently, a single stranded copy of T-DNA is generated and transferred through the assistance VirC and VirD proteins After being expressed, the VirD1-VirD2 endonuclease heterodimer then nicks the bottom strand of the T-DNA at the borders (Lessl and Lanka, 1994) while VirC1 binds to a 25-bp “overdrive” sequence located near the right border repeat to stimulate single stranded T-DNA production The VirD2

remains covalently attached to the T-strand at the 5’ end (Toro et al., 1988; van Haaren et

al., 1987; Veluthambi et al., 1988) VirD2 together with VirE2, which coats the length of

the single stranded DNA, forms the T-complex The T-complex is transferred from the bacterial cell to the host cytoplasm through the type IV secretion mechanism ((T4SS)

It is then targeted to the host genome by a nuclear localising signal on the C-terminal of

VirD2 (Michielse et al., 2005) Hence, VirD2 functions as a pilot protein that steers the

T-complex towards the plant cell nucleus TheVirB1-11 and VirD4 proteins aid in this procedure VirB proteins form a transport pore with a surface structure called T-pilus, which is made of the processed form of VirB2 (also known as T-pilin) (Kado, 2000) On

the other hand, VirD4 mediates the interaction between VirB complex and T-DNA (Christie, 1997)

In the cytoplasm of the recipient cell, the T-DNA complex becomes coated with VirE2 proteins, which are exported through the T4SS independently from the T-DNA complex VirE2 is important as a single-stranded DNA-binding protein that coats and protects T-strand in host from nucleases and maintains the unfolded state of T-strand to

assist T-DNA transport through the nuclear pore (Citovsky et al., 1989) Nuclear

localization signals, or NLS, located on the VirE2 and VirD2 are recognized by the importin alpha protein, which then associates with importin beta and the nuclear pore complex to transfer the T-DNA into the nucleus VIP1 also appears to be an important protein in the process, possibly acting as an adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T-DNA to areas of chromatin that are being actively transcribed, so that the T-DNA can integrate into the host genome (Citovsky, 2007)

1.4 Agrobacterium-mediated transformation of Saccharomyces cerevisiae

The natural ability of Agrobacterium in transferring its DNA into plants has made

it an invaluable tool in plant biotechnology Recently, it has been discovered that the range of suitable hosts extends beyond plants to other eukaryotic cells such as fungi The budding yeast Saccharomyces cerevisiae, being the simplest eukaryotic organism was

discovered to be susceptible to AMT in 1995 (Bundock et al, 1995)

As a result, massive efforts were made to identify host species outside the plant kingdom To date, scientists have been able to extend the host range of A tumefaciens to

other eukaryotes such as yeast (Bundock et al 1995; Piers et al 1996), fungi (De Groot

et al 1998) and even mammalian cells (Relic et al 1998; Kunik et al 2001) These were

made possible by Agrobacterium genome sequencing and discoveries of host factors

affecting the transformation process (Gelvin 2003) Such discoveries have established a

new and exciting paradigm in A.tumefaciens-based genetic manipulations (Michielse et

al., 2005; Lacroix et al., 2006)

The transfer of T-DNA into yeast cells is also dependent upon sufficient induction and expression of virulence genes similar to the plants To accomplish the T-DNA transfer into yeast cells, Acetosyringone, responsible for vir genes expression, is required The major difference between AMT of plant and yeast cells lies in the T-DNA transfer and integration process inside the host cells In yeast, T-DNA can be integrated into the yeast genome via homologous recombination mechanisms if the T-DNA contained

certain sequence homology to the yeast genome (Bundock et al 1995) In addition, if a

yeast replication origin sequence such as the 2µ replication origin was inserted within the T-DNA, the T-DNA molecule can re-circularize and stably replicate after being delivered

into the yeast nucleus (Bundock et al 1995; Piers et al 1996) This mechanism is in

contrast with integration process by illegitimate recombination in plants

S cerevisiae has been used by numerous researchers as a model for eukaryotic

cells It is easy to maintain and manipulate, grows rapidly and requires simple growth

medium The growth characteristics and other information regarding the budding yeast are also easily available Yeast has a small genome compared to other eukaryotic cells The commercially available knock-out yeast library from Open Biosystems made the systematic screening of knock-out yeast genes possible Hence it is possible to obtain a better understanding of the mechanisms involved in the T-DNA transfer

A number of parameters may affect the Agrobacterium-yeast transformation efficiency which includes temperature, pH, co-cultivation time period, temperature (Michielse et al.,

Figure 1.2 A tumefaciens T-DNA transfer system into plant cell

Adapted from Citovsky et al., 2007 The transformation process comprises 10 major steps and begins with recognition and attachment of the Agrobacterium to the host cells (1) and the sensing of specific plant signals by the Agrobacterium VirA/VirG two- component signal-transduction system (2) Following activation of the vir gene region

(3), a mobile copy of the T-DNA is generated by the VirD1/D2 protein complex (4) and delivered as a VirD2–DNA complex (immature T-complex), together with several other Vir proteins, into the host-cell cytoplasm (5) Following the association of VirE2 with the T-strand, the mature T-complex forms, travels through the host-cell cytoplasm (6) and is actively imported into the host-cell nucleus (7) Once inside the nucleus, the T-DNA is recruited to the point of integration (8), stripped of its escorting proteins (9) and integrated into the host genome (10)

Figure 1.3 Schematic representation of the A tumefaciens T-DNA transfer system in

yeast (Michielse et al, 2005)

1.5 Background of Las17 gene

Las17 is an activator of the Arp2/3 protein complex that nucleates branched actin filaments It is the only S cerevisiae homolog of the human Wiskott-Aldrich syndrome

protein (WASP) (Lechler T et al 2000 and Li R 1997) and is a member of the larger

WASP/SCAR/WAVE protein family Las17 was identified biochemically as an essential nucleation factor in the reconstitution of cortical actin patches in vitro, and independently

as a verprolin (Vrp1p/End5p)-interacting protein (Lechler T and Li R 1997) Las17 localizes with the Arp2/3 complex to actin patches, and disruption of LAS17 leads to the loss of actin patches and a block in endocytosis (Li R 1997, Lechler T and Li R 1997 and

Madania A et al 1999)

Las17 physically interacts with the Arp2/3 complex This interaction requires the carboxy-terminal WA (WH2 [WASp homology 2] and A[acidic]) domain of Las17 and is

dependent upon two subunits of the Arp2/3 complex, Arc15p and Arc19p (Winter D et

al 1999) The WA domain is sufficient for Arp2/3 complex binding and activation in

vitro (Winter D et al 1999) The WA domain shares sequence similarity and genetic

redundancy with an acidic domain in myosin I (Myo3p and Myo5p in S cerevisiae),

which also interacts with the Arp2/3 complex (Evangelista M et al 2000).These proteins

appear to function redundantly in the activation of the Arp2/3 complex, as combined deletions of the WA domain of Las17 and the type I myosins abolish actin nucleation at

cortical actin patches (Lechler T et al 2000)

Genetic and biochemical studies have identified numerous proteins that physically interact with Las17 The WH1 domain of Las17 binds strongly to verprolin (Vrp1p/End5p), the yeast homolog of human WIP (WASP-interacting protein), which is

involved in Las17 localization (Lechler T et al 2001 and Vaduva G et al 1997) The

proline-rich region of Las17 binds to SH3 domain-containing proteins, including Sla1p (an actin patch protein with a role in endocytosis), Bbc1p/Mti1p, Bzz1p/Lsb7p, Myo3p,

Myo5p, Lsb1p, Lsb2p, Ysc84p, Sho1p, and Rvs167p (Rodal AA et al 2003, Drees BL et

al 2001 and Tong AH et al 2002) Although the significance of many of these

interactions is not known, they may regulate the activity of Las17, and thus, the activity

of the Arp2/3 complex Unlike other WASP family members, Las17 does not contain a conserved Cdc42p-binding domain and does not appear to be regulated by auto-inhibition

(Rodal AA et al 2003)

CHAPTER 2

Materials and Methods

2.1 General Materials and Methods

2.1.1 Yeast and Bacterial Strains

The bacterial strains and yeast strains used in this study are listed in Table 2.1 E

coli cells were grown at 37ºC in Luria broth (LB) (Sambrook et al., 1989) A tumefaciens

strains were grown in 28ºC in mannitol glutamate luria salts (MG/L) (Cangelosi et al.,

1991) and also induction broth (IBPO4) (Piers et al., 1995) Media were supplemented with antibiotics to maintain plasmids when required S cerevisiae cultures were

maintained on yeast peptone dextrose (YPD) or synthetic dextrose (SD) containing the appropriate drop-out formulation

Media, stock solutions and antibiotics

2.1.2 Culture media, antibiotics and Stock Solutions

The culture media used to are listed in Table 2.2 The preparation and concentration of antibiotics and other solutions used are listed in table 2.3

Strains Relevant characteristics Source/

Table 2.1 Bacterial and yeast strains used in this study

Media / solutions Preparation a, b Source/ reference

pH 7.0 NH4Cl, 20 g; MgSO4 7H2O, 6 g; KCl, 3 g; CaCl2, 0.2 g; Fe SO4 7H2O, 50 mg K2HPO4, 60 g; NaH2PO4, 23 g; pH7.0

20  AB salts, 50 ml; 20  AB buffer, 1 ml; 62.5 mM KH2PO4 (pH 5.5), 8 ml;

30% glucose, 18g; autoclave separately

IBPO4; histidine,20 g/ml; leucine 60

g/ml; methionine 20 g/ml; uracil 20

g/ml

Clontech user manual

Clontech user manual

Antibiotics/solutions Preparation Reference

Kanamycin (Kan) 100 µg/ml in dH2O; filter sterilised Sambrook et al.,

1989 Cefotaxine (Cef) 150 µg/ml in dH2O; filter sterilised Sambrook et al.,

1989 Doxycycline 100 µg/ml in dH2O; filter sterilised Sambrook et al.,

1989 1000

Acetosyringone

14.6 mg/ml AS in demethyl sulfoxide (DMSO), filter sterilised

Sambrook et al.,

1989

Table 2.3 Antibiotics and Solutions used in the study

pHT101 Derivative of the binary vector

plasmid pCB301 containing a GFP gene fused onto the HindIII site of the

MCS; KmR

This study

pYES2-GFP Expression vector containing a GFP

fusion gene encoding GFP under the GAL1 inducible promoter; AmpR

This study

pYES2-GFP-VirD2 Expression vector containing a

GFP::virD2 fusion gene encoding

GFP-VirD2 under the GAL1 inducible promoter; AmpR

This study

Table 2.4 Plasmids used in this study

Primers Sequence GFP Forward Primer 5´ GATAAGGCAGATTGAGTGGA 3´

GFP Reverse Primer 5´ AAAGATGACGGTAACTACAA 3´

Table 2.5 Primers used in this study

Fig 2.1 The plasmid map of pHT101

Bundock et al (1995) have reported that the transformation of yeast cells using

replicative vectors occurs more efficiently than integrative vectors So in the current experiment, the replicative vector pHT101 (Tu, result not published) was utilized in the

Agrobacterium-yeast gene transfer assay

In our experiment, AMT was accomplished by the transfer of the T-region of the pHT101 plasmid into the Leu2- BY4741 yeast strain As the 2µ replication of origin is located within the T-region, it allows the transferred DNA to replicate extra-chromosomally Thus, each yeast cell that receives the DNA becomes a Leu2+ prototroph but this will not require a recombination event to occur Consequently, T-DNA transfer, and not recombination or integration, is the limiting step in this system

2.2 DNA Manipulations

2.2.1 Plasmid DNA preparation from E.coli

E.coli cells carrying the plasmid of interest was cultured overnight using LB broth

at 37˚C The cells were collected and plasmid extraction was conducted using HiYield Plasmid Mini Kit (Real Genomics)

2.2.2 Plasmid DNA preparation from A tumefaciens

Plasmid DNA was isolated from A tumefaciens cultures using the QIAprep Spin

Miniprep Kit (QIAGEN) following the user-developed protocol (Weber 1998)

2.2.3 Polymerase chain reaction (PCR)

DNA was amplified by PCR using a thermocycler (Applied Biosystem; GeneAmp® PCT system 9700) The reaction mixture consisting of the following components mixed together on ice in a thin-walled 200µL PCR tube to a final volume of

50µL PCRs were conducted using Yeastern Biotech Taq DNA polymerase

PCR mixture

10x PCR buffer with MgCL2 5 µL

dNTPs (10mM each) 1 µL

Primer 1 (10pmol/µl) 2 µL

Primer 2 (10pmol/µl) 2 µL

Sample 1 µL

Taq DNA polymerase (5u/µl) 0.2 µL

Sterile water added to make final volume to 50 µL

PCR programme

Initial denaturation step 94C for 2 min

Denaturation step 94C for 30 sec

Primer annealing step 51˚Cfor 30 sec

Extending step 72C for 30 sec

Final extending step 72C for 1 min

Number of cycles 35

2.2.4 DNA gel electrophoresis and purification

Gel electrophoresis was carried out in 1  TAE (0.04 M Tris-acetate, 1 mM EDTA, pH 8.0) on a 1% or 2% agarose gel with 0.5µg/ml ethidium bromide The gel was run at 112V for 10 min

To purify the amplified DNA samples, QIAprep Spin® Miniprep Kit was used following the user-developed protocol (Weber 1998)

2.3 Agrobacterium-mediated Transformation of S.cerevisiae

Agrobacterium-mediated Transformation (AMT) of S cerevisiae was carried out

based on the method described previously (Piers et al., 1995) with some modifications

2.3.1 Cell culture

A.tumefaciens cells were inoculated into 2mL of MG/L 100Km broth and allowed

to grow overnight at 28˚C with shaking The culture was refreshed, the next morning by sub-culturing 5 x 106 A.tumefaciens cells into 2mL of MG/L 100Km broth The culture

was then incubated at 28˚C for 3 -4 hours for the cells to reach log phase or OD600 = 1.0

S cerevisiae cells were inoculated into 2 ml of YPD broth and incubated overnight at

28ºC with shaking The culture was refreshed, the next morning by sub culturing 5  106

cells/ml S cerevisiae cells into 2ml of YPD broth and cultured for another 3 to 4 hours

until the OD600 reaches 0.35

2.3.2 Induction of A tumefaciens

To induce A tumefaciens, log phase agrobacteria cells were collected from MG/L

100Km broth by centrifugation at 10000rpm and washed twice with IBPO4 These cells were resuspended to a final concentration of 3  108 cells/ml in IBPO4 100Km 150As The cells were induced at 28ºC for 18-20 hours After induction, the cell culture should reach a final concentration of OD600 = 0.6

2.3.3 Co-cultivation of A tumefaciens and S cerevisiae

Co-cultivation of S cerevisiae and A tumefaciens was carried out by mixing 2 

108 A tumefaciens cells with 2  106 S cerevisiae cells (donor: recipient ratio = 100: 1)

The cell mixture was washed twice with IBPO4, set to a final volume of 100 l and dropped onto a CM plate The droplet was allowed to air dry in the laminar flow hood for

30minutes and co-cultivation was carried out at 20ºC for 20 hours

2.3.4 Recovery and selection of transformants

After the solid co-cultivation, cells were washed from the CM plate with 1.5mL

of 0.9% NaCl 10µL of the above cell mixture was diluted 10,000 times and plated on SD plates to estimate the number of survival cells (recovery) The remaining cells were plated on SD media without leucine to select for successful transformants 200 µg/ml cefotaxime was included on both recovery and selection plates to prevent the growth of

A tumefaciens The plates were incubated at 28ºC for 3 days Transformation efficiency

was calculated by dividing the number of yeast transformants on the selection plate by the total number of yeast cells recovered on the supplemented SD plate

Figure 2.2 Schematic representation of the Agrobacterium-mediated Transformation of

S.cerevisiae experiment