FUNCTION AND MECHANISM STUDIES OF TRPV4 IN BREAST CANCER METASTASIS

1.6 Research objectives 20 3.1.1 Phosphoproteome of the breast cancer metastasis model 37 3.1.2 Bioinformatics and the characterization of the differentially expressed phosphoproteins a

FUNCTION AND MECHANISM OF TRPV4 IN BREAST

CANCER METASTASIS

CHOONG LEE YEE

B.SC (HONS) UNIVERSITI TEKNOLOGI MALAYSIA

A THESIS SUBMITTED FOR THE DEGREE OF

MASTERS OF SCIENCES

DEPARTMENT OF BIOCHEMISTRY

NATIONAL UNIVERSITY OF SINGAPORE

2013

DECLARATION

I hereby declare that the thesis is my original work and it has been written by me in its entirety I have duly acknowledged all the sources of information which have been used in the thesis

This thesis has also not been submitted for any degree in any

university previously

_

CHOONG LEE YEE

20 March 2013

First and foremost I offer my sincerest gratitude to my supervisor, Assistant Professor Dr Lim Yoon Pin, Department of Biochemistry NUS for his endless encouragement, support, guidance and helps I would like to thank National University of Singapore for allowing me to pursue this degree with their generous research scholarship

In my daily life I have been blessed with a friendly and cheerful group of fellow colleagues It would have been a lonely laboratory without them My heartfelt thanks to the past and present colleagues especially Dr Sheryl Tan, Mdm Pan Mengfei, Dr Lim Shen Kiat, Dr Law Kai Pong, Dr Shirly Chong, Mdm Qianfeng and Mr Victor Tan for always willing to provide assistance My deepest gratitude to

my dearest friends, Ms Yuki Yip and Mr Edmus Oh for their valuable motivation and encouragement Thanks for being such wonderful friends and I will always treasure our friendships

I would like to express my deepest appreciation to my family, especially my parents, brother and sisters for their love and blessing Finally, I would like to thank

my dearest husband Kian Chuan and my lovely daughter Avelyn who were always there cheering me up and stood by me through the good times and bad I would like to apologize to many individuals whose valuable contributions to this project were unable to be cited due to space restrictions

Choong Lee Yee

20 March 2013

Prof Dr Christian Harteneck

from Universitat Tǘbingen,

Germany

- Provides TRPV4 antibodies and

plasmids, RES019-29 TRPV4 blocker and TRPV4-T Rex HEK293 cells, intellectual contributions

Dr Lim Chwee Teck and Dr

Vedula Sri Ram Krishna from

Nanobiomechanics Lab,

National University of Singapore

- Micropipette aspiration

Dr Low Boon Chuan, Dr.Kenny

Lim Gim Keat and Archna Ravi

RCE mechanobiology lab,

National University of Singapore

- GTPase assays

Dr Marie Chiew-Shia Loh

previously from Cancer Science

Institute of Singapore, National

University of Singapore

- Statistical analyses

Dr Thomas Putti from National

University of Hospital, National

University of Singapore

- Provides clinical samples and

clinicohistopathological data

Dr Wong Chow Yin from

Singapore General Hospital,

Singapore

- Provides clinical samples and

clinicohistopathological data

Dr Brendan Pang and Dr

Benedict Yan from National

University of Hospital, National

University of Singapore

- Histological analyses

1.6 Research objectives 20

3.1.1 Phosphoproteome of the breast cancer metastasis model 37 3.1.2 Bioinformatics and the characterization of the differentially

expressed phosphoproteins across the BCM model

42 3.1.3 Upregulation of TRPV4 protein and mRNA across the BCM

model

45

3.1.4 Upregulation of TRPV4 in invasive human breast cancer cell

lines and tissues

52

3.2.1 Function of TRPV4 in breast cancer cell movement, invasion

3.2.2 Silencing of TRPV4 reduce the nodules’ size and number in

the lungs of the mice

68

processes associated with metastasis 74 3.3.1 TRPV4 maybe necessary for cancer cell plasticity that

3.4.1 Activation of TRPV4 stimulate the AKT and FAK pathways 77 3.4.2 Does AKT activation by TRPV4 mediated downregulation of

E-cadherin and β-catenin proteins?

83

3.5 Function of TRPV4 and its signaling during metastatic processes

degradation in TRPV4-mediated downregukation of E-cadherin

expression

100

occurring mutations

104

other regulators of TRPV4 signaling pathway

Appendix II Permission to reproduce: Table 1.1 131

Transient Receptor Potential Vanilloid subtype 4 (TRPV4), a non-selective calcium-permeable cation channel was discovered by our laboratory to be a novel breast cancer metastasis-associated protein TRPV4 was found to be upregulated in invasive breast cancer cell lines and tumor breast tissues It has been shown that 4α-PDD induced activation of TRPV4 led to a rise in intracellular Ca2+ concentration Our in-vitro studies indicated that silencing

of TRPV4 significantly abolished the invasiveness and the ability of murine mammary breast cancer metastatic cells to transmigrate through endothelial

cells, but not the proliferation of the cells Furthermore, in-vivo studies

demonstrated that knockdown of TRPV4 significantly reduced the number and size of metastatic nodules in the lungs of SCID mice These effects of TRPV4 knockdown were associated with a reduction in the plasticity of the cancer cells and diminution of intracellular Ca2+ concentration Interestingly,

pathways and downregulation of cell adhesion proteins such as E-cadherin and β-catenin, which may account for the decrease in cancer cell plasticity following TRPV4 knockdown Our preliminary data showed that Twist might

be involved in AKT-mediated repression of E-cadherin expression Studies are currently under way in our laboratory to also investigate the potential role

of proteosomal degradation in TRPV4-mediated downregulation of cadherin and β-catenin In conclusion, this study shows that TRPV4 plays a novel role in cellular processes associated with metastasis and provides

E-insights into the mode of action of TRPV4 in metastasis

LIST OF FIGURES

1.3 Typical subunit arrangement of a skeletal muscle voltage-gated

3.1 Pervanadate induced tyrosine phosphorylation in Breast Cancer

Metastasis (BCM) model

38

3.2 Schematic diagram showing the workflow of iTRAQ-based

experiments to identify PV-induced tyrosine phosphorylation substrates

in Breast Cancer Metastasis (BCM) model

39

3.3 The top most canonical pathway associated with the gene list is that of

3.4 Biological interaction network (BIN) of the proteins identified in

3.5 Validation of known and potentially novel tyrosine-phosphorylated

3.6 The MS/MS spectra of the 3 iTRAQ peptides for TRPV4 inset shows

the intensity of the iTRAQ reporter ions derived from TRPV4 across

the cell lines in BCM model

48

3.7A Immunoprecipitation and immunoblotting of TRPV4 in the BCM cell

lines

51

3.8 The expression of TRPV4 in BCM model was examined using

3.9B Immunoblotting of TRPV4 on a panel of human cell lines 54

3.10 Bar chart distribution of IHC scores for TRPV4 on matched normal

(N), ductal carcinoma in situ (DCIS) and invasive ductal carcinomas

(IDC)

57

3.11 The expression patterns of TRPV4 in 85 samples matched metastatic

breast cancers and invasive ductal carcinomas (IDC) from tissue

microarray

58

3.12 Box plot distribution of IHC scores for TRPV4 on normal (N), ductal

carcinoma in situ (DCIS), invasive ductal carcinomas (IDC) and

metastatic breast cancers

58

3.13A Representative IHC images showing upregulation of TRPV4 in

matched clinical samples across the breast cancer progression

60

3.13B Representative IHC images showing TRPV4 expression in tissue

microarray of breast cancer invasion versus matched metastatic breast

cancer tissues

60

3.13C Immunohistochemistry of TRPV4 in the absence or presence of

3.14 Kaplan-Meier analysis of disease-free survival (DFS) based on

TRPV4 protein expression level from the breast cancer patients

dataset

62

3.15A 4T07 cells transfected with TRPV4-specific siRNA sequences (Seq

#1 and Seq #3) or an irrelevant sequence (Luc) were analysed for

their TRPV4 expression

64

3.15B Wound-healing assays showing that TRPV4 siRNA (200nM) inhibits

the migration of 4T07 murine mammary epithelial tumor cells

64

3.15C The percentage of gaps was estimated for 0hr, 8hr, 16hr and 24hr; and

the chart was plotted

64

3.16 Chemotaxis assays showing that TRPV4 siRNA (200nM) inhibits the

migration of 4T07 murine mammary epithelial tumor cells

65

3.17 Cell invasion assays showing that TRPV4 siRNA (200nM) inhibits the

migration of 4T07 murine mammary epithelial tumor cells

65

3.19 Proliferation assays showing that TRPV4 siRNA (200nM) has no

statistically significant effect on the 4T07 cells proliferation 68

3.20 4T1 cells transfected with TRPV4-specific siRNA sequences (Seq #1

and Seq #3) or an irrelevant sequence (Luc) were analysed for their

TRPV4 expression

70

3.21 Histological analyses showing staining of lung tissue sections from

mice injected with 4T1 cells transfected with TRPV4-specific siRNA

sequences (Seq #1 and Seq #3) or an irrelevant sequence (Luc)

70

3.22A Number of nodules with distinct sizes present in lungs harvested from

SCID mice injected with TRPV4 knocked down and control 4T1

3.23A Representative IHC images showing expression of TRPV4 in the

lungs tissue sections from the SCID mice injected with ctrl and

TRPV4-knockdown 4T1 cells

73

3.23B Box plot showing expression of TRPV4 on the lungs tissue sections

from the SCID mice injected with ctrl and TRPV4-knockdown 4T1

3.26 Changes in levels of phospho-proteins and non-phospho proteins upon

3.27 Changes in levels of phospho-proteins and non-phospho proteins

upon 4α-PDD stimulation for 15 mins and 16 hrs in

TRPV4-knockdown 4T07 cells

82

3.28 Immunoblotting of TRPV4 upon 10µM of 4α-PDD stimulation and/

or 10µM Ruthedium Red (RR) on 4T07 cells for 16hrs

83

3.29 Effects on expression levels of phosphorylated S6, phosphorylated

AKT, phosphorylated FAK, E-cadheria and β-catenin in the presence

and absence of 5µM AKT inhibitor IV

85

3.31 Intracellular Ca2+ measurement indicates that TRPV4 siRNA decrease

signaling 4T07 cells were stimulated with 4α-PDD for 15 mins 90

signaling 4T07 cells were stimulated with 4α-PDD for 16 hrs

91

3.34A Overexpression of constitutively active AKT construct rescue the

effect of TRPV4 silencing on the expression of phosphorylated AKT

and E-cadherin

93

3.34B Overexpression of constitutively active AKT construct rescue the

3.35A The mRNA expression of E-cadherin in 4T07 cells upon different

3.35B The protein expression of E-cadherin in 4T07 cells upon different

3.36A 4T07 cells transfected with Twist-specific siRNA sequences (Seq #1

and Seq #2) or an irrelevant sequence (Luc) The transfected lysated

were analysed for the expression of Twist and E-cadherin

96

3.36B The expression of E-cadherin in 4T07 cells silenced with

Twist-specific siRNA

96

4.1 Schematic representation of the proposed signaling mechanism that

promotes metastasis through the activation of TRPV4 in breast cancer

100

LIST OF TABLES

migration and metastasis

7

3.1 Relative quantification of 4G10 anti-phosphotyrosine

antibodies-enriched proteins in PV-stimulated of Breast Cancer Metastasis

(BCM) model

40

3.3 Statistical analyses of the relationships between different factors

using experimental and clinical data from normal and tumor samples

61

3.4 Determination of the mice with distinct number of lung metastases

nodules

71

3.5 Quantification of the percentage of 4T07 cells that formed blebs and

the average of pressure at which bleb developed

74

5.1 The major phosphorylation sites of TRPV4 in response to different

stimulators

108

Supplementary Table 1 Peptide summary

Supplementary Table 2 IPA summary

Supplementary Table 3 Cononical pathways

Supplementary Table 4 IHC scoring and clinicohistopathological data Supplementary Table 5 Statistical analyses of IHC

Supplementary Table 6 Nodules counting and IHC

BCM

LC-MS/MS liquid chromatography-tandem mass spectrometry

MEK mitogen activated extracellular signal regulated kinase

S3 SiRNA sequence 3

SDS-PAGE sodium dodecyl sulphate-polyacrylamide gel electrophoresis

Chapter 1 Introduction

1.1 Importance of Ca 2+ homeostasis and signaling

Ca2+ signaling is used throughout the life history of an organism Life begins with a surge of Ca2+ at fertilization and this versatile system is then used repeatedly to control many processes during development and in adult life (Berridge et al., 2000) One of the fascinating aspects of Ca2+ is that it plays an important role in signal transduction pathways to accomplish a variety of biological functions including differentiation and proliferation (Prevarskaya et al., 2011) Ca2+ also exhibits a cross-talk among a variety of signaling pathways (Feissner et al., 2009; Memon et al., 2011)

Calcium storages are intracellular organelles that constantly accumulate Ca2+ions and release them during certain cellular events Intracellular Ca2+ storages include mitochondria and the endoplasmic reticulum Calcium levels in mammals are tightly regulated, with bone acting as the major mineral storage site Calcium is released from bone into the bloodstream under controlled conditions Calcium is transported through the bloodstream as dissolved ions or bound to proteins such as serum albumin (Jayanthi et al., 2000)

A cellular Ca2+ overload or the perturbation of intracellular Ca2+compartmentalization can cause cytotoxicity and trigger apoptosis or necrosis (Rizzuto et al., 2003) Metastatic calcification is defined as the pathologic process whereby calcium salts accumulate in previously healthy tissues, caused by excessive levels of blood calcium, such as in hyperparathyroidism It has been postulated that microcalcification is a result of abnormal calcium deposition and mineralization of necrotic debris (Valastyan and Weinberg, 2011) Under such circumstances, various

Ca2+-dependent signaling cascades with kinases and phosphatases directly or

indirectly influence cellular signaling, including activation of p53 (Liu et al., 2007; Scotto et al., 1999), MAPKs (Crow et al., 2001; Stringaris et al., 2002), phosphoinositide 3-kinase (PI3K) (Liu et al., 2007; Viard et al., 2004) and Akt signaling pathways (Coticchia et al., 2008; Deb, 2004)

Previous studies have shown that Ca2+ influx is essential for the adhesion and migration behaviors in several types of cancer, including breast cancer (Gruber and Pauli, 1999); (Du et al., 2012); (Davis et al., 2012); (Sergeev, 2012), melanoma (Chantome et al., 2009), leukemia (Li et al., 2009) and glioblastoma (Wondergem and Bartley, 2009); (Becchetti and Arcangeli, 2010); (Potier et al., 2011)

1.2 Tumor metastasis

Tumor metastasis is very common in the late stages of cancer The spread of metastases may occur via the blood or the lymphatics or through both routes The most common places for the metastases to occur are the lungs, liver, brain and the

bones as indicated in Figure 1.1 (Valastyan and Weinberg, 2011) Although surgical

resection and adjuvant therapy can cure well confined primary tumors, metastatic disease is largely incurable because of its systemic nature and the resistance of disseminated tumor cells to existing therapeutic agents This explains why > 90% of mortality from cancer is attributable to metastases, not the primary tumors from which these malignant lesions arise (Palmieri et al., 2006)

Figure 1.1 Metastatic Tropism Carcinomas originating from a particular epithelial

tissue form detectable metastases in only a limited subset of theoretically possible distant organ sites The most common sites of metastasis for six well-studied carcinoma types are shown Primary tumors are depicted in red Thickness of black lines reflects the relative frequencies with which a given primary tumor type metastasizes to the indicated distant organ site (Valastyan and Weinberg, 2011) See Appendix I for permission to reproduce

The metastases spawned by carcinomas are formed following the completion

of a complex succession of cell-biological events - collectively termed the metastasis cascade - whereby epithelial cells in primary tumors: (I) invade locally through surrounding extracellular matrix (ECM) and stromal cell layers, (II)

invasion-intravasate into the lumina of blood vessels, (III) survive the rigors of transport through the vasculature, (IV) arrest at distant organ sites, (V) extravasate into the parenchyma of distant tissues, (VI) initially survive in these foreign microenvironments in order to form micrometastases, and (VII) reinitiate their proliferative programs at metastatic sites, thereby generating macroscopic, clinically detectable neoplastic growths (the step often referred to as ‘‘metastatic colonization’’)

(Figure 1.2)

Figure 1.2 The Invasion-Metastasis Cascade Clinically detectable metastases

represent the end products of a complex series of cell-biological events, which are collectively termed the invasionmetastasis cascade During metastatic progression, tumor cells exit their primary sites of growth (local invasion, intravasation), translocate systemically (survival in the circulation, arrest at a distant organ site, extravasation), and adapt to survive and thrive in the foreign microenvironments of distant tissues (micrometastasis formation, metastatic colonization) Carcinoma cells are depicted in red (Valastyan and Weinberg, 2011) See Appendix I for permission to reproduce

1.2.1 Ca 2+ and metastatic behavior

There is an increasing amount of evidence that correlates the function of Ca2+channels with migration, invasion and metastasis of tumor cells As illustrated in

the Ca2+-permeable members of the transient receptor potential (TRP) channel family and the constituents of store-operated Ca2+ entry, calcium release-activated calcium channel protein 1 (ORAI1) and stromal interaction molecule 1 (STIM1), have been implicated in the development of the metastatic cell phenotype and tumor cell migration The data linking specific TRP channels to cancer cell migration, invasion and metastasis are still largely phenomenological

In general, Ca2+-dependent mechanisms of malignant migration do not seem to

be very different from those that characterize normal physiological migration The major difference seem to arise at a quantitative level owing to the aberrant expression

of Ca2+-handling proteins and/or Ca2+-dependent effectors, leading to the increased turnover of focal adhesions and more effective proteolysis of ECM (extracellular matrix) components (Prevarskaya et al., 2011) Migrating cells exhibit a stable and transient gradient of [Ca2+]i, increasing from the front of the cell to the rear, that is thought to be responsible for rear-end retraction (Hahn et al., 1992) Our knowledge

of Ca2+ signaling pathology is still in its nascent state Deeper investigations are required to understand the role Ca2+ channels in cancer in order to develop further knowledge of Ca2+ channels as valuable diagnostic and prognostic markers, as well as targets for pharmaceutical intervention and targeting

Table 1.1 Plasmalemmal and endolemmal Ca2+-permeable channels in migration and metastasis (Prevarskaya et al., 2011) See Appendix II for permission to reproduce

Abbreviations:

TRP, transient receptor potential; SOC, store-operated calcium; IP3R, IP3 receptor; RYR, ryanodine receptor; ND, not determined

1.3 Ca 2+ channels and TRP channels

In all eukaryotic cells, the cytosolic concentration of Ca2+ ions is tightly regulated by interactions among transporters, pumps, Ca2+ channels and binding proteins Ca2+ channels are found in the plasma membrane and in the membranes of intracellular Ca2+ stores such as the sarcoplasmic/endoplasmic reticulum These channels transport positively charged calcium atoms (calcium ions) into cells Ca2+ channels play key roles in a cell's ability to generate and transmit electrical signals

Ca2+ ions are involved in many different cellular functions, including cell-to-cell communication, the tensing of muscle fibers (muscle contraction) and the regulation

of certain genes (Lee et al., 2006)

Ca2+ channels are made up of several protein components (subunits), each of which is produced from a particular gene The α1 (alpha-1) subunit is the largest and most important component of a Ca2+ channels It forms the pore in which calcium ions can flow Several other subunits interact with the α1 subunit such as β, α2, δ and γ

to help regulate the channel's function as illustrated in Figure 1.3 (Van Petegem et al.,

2004)

Figure 1.3 Typical subunit arrangement of a skeletal muscle voltage-gated calcium

channel Adapted from image obtained from Dr Filip Van Petegem's website: http://research.biochem.ubc.ca/fac_research/faculty/Van%20petegem.html

Multiple types of voltage-gated Ca2+ channels were first distinguished by voltage- and time-dependence of channel gating, single channel conductance and pharmacology (Carbone and Lux, 1984); (Nowycky et al., 1985) One physiologically relevant characteristic which varies considerably among the different Ca2+ channel types is the degree of depolarization required to cause significant opening Based on this criterion, voltage-gated Ca2+ channels are divided into two groups, low voltage-activated (LVA) and high voltage-activated (HVA) Use of all the criteria listed above has led to a more specific classification of native Ca2+channels as T-, L- N-, P/Q- and R-type (Llinas et al., 1992); (Randall and Tsien, 1995) The ‘T’ stands for transient referring to the length of activation Transient receptor potential (TRP) superfamily of cation channels is the T-type Ca2+ channels as described in more detail below

Transient receptor potential (TRP) channels can be divided into six subfamilies: TRPC (Canonical), TRPV (Vanilloid), TRPM (Melastatin), TRPML (Mucolipin), TRPP (Polycystin), and TRPA (Ankyrin transmembrane protein) as

illustrated in Figure 1.4 (Dong et al., 2010) There is another subfamily had been

identified currently which is TRPN (NomPC-like) (Santoni and Farfariello, 2011) TRP channels were originally identified in Drosophila photo-transduction,whereby spontaneously occurring mutants areunable to sustain a response to continuous light, insteadshowing a transient receptor potential (TRP), hence the name TRP was given (Montell and Rubin, 1989) Apart from mediating responses to light, TRP channels are sensitive to mechanical, chemical, thermal and osmotic stimuli (Minke and Cook, 2002)

Figure 1.4 Intracellular location and putative activation mechanisms of TRP channels

TRPs can be divided into six groups (TRPC, TRPV, TRPM, TRPA, TRPML, and TRPP) TRPML1-3, TRPV2, and TRPY1 (yeast TRP yvc1), and TRPM7 (in red) are likely to play active roles in membrane traffic and exocytosis TRPM2, TRPM8, TRPV1, TRPP1, TRPA1, and TRPV4 (in green) have been shown to be active in intracellular membranes and may play roles in intracellular signal transduction TRPC3-6, TRPMV5/6, TRPM1, TRPM7, and TRPML2/3 (in blue) have been shown

to undergo regulated exocytosis Intracellular localization of other TRPs (in black) has not been well documented (Dong et al., 2010) See Appendix III for permission to reproduce

TRP channels with diverse physiological functions including thermosensation and mechanosensation have been identified to profoundly affect a variety of physiological and pathological processes as excellently described by (Clapham, 2003); (Montell, 2005); (Lee et al., 2006); (Nilius, 2007) Among the TRP families, the expression levels and activity of some members of the TRPC, TRPM and TRPV families have been correlated with cancer, leading to the discovery of tumor-related functions such as regulation of proliferation, differentiation, apoptotis, angiogenesis, migration and invasion during cancer progression (Duncan et al., 1998); (Wissenbach

et al., 2001); (Thebault et al., 2006); (Kiselyov et al., 2007); (Amantini et al., 2007); (Caprodossi et al., 2008); (Nabissi et al., 2010)

TRP channels may regulate cancer progression at different levels (Gupta and Massague, 2006): by interacting with specific G protein-coupled receptors (GPCRs)

at the plasma membrane (Zhang and Oppenheim, 2005), by regulating the expression and the activity of cell-surface glycoproteins (Chang et al., 2005); (Cha et al., 2008),

by acting as Ca2+ entry pathways in the plasma membrane (Prevarskaya et al., 2007); (Flourakis and Prevarskaya, 2009) or by regulating the binding, trafficking and functional activity of several growth factors (Bode et al., 2009)

The vanilloid receptor family (TRPV) is a subgroup of the transient receptor potential (TRP) superfamily of ion channels, and six members (TRPV1-6) have so far been identified The six vanilloid receptor members have been divided into four groups on the basis of structure and function: TRPV1/2, TRPV3, TRPV4 and TRPV5/6 In this project, we will focus on TRPV4 as discussed in the following sections

1.4 TRPV4

Transient receptor potential cation channel subfamily V member 4 (TRPV4) formerly known as CMT2C, OTRPC4, TRP12, VRL-2 or VR-OAC is distributed in central and peripheral nervous systems, liver, kidney, adipose tissue, lung, brain, heart and testis The human TRPV4 gene is localized on chromosome 12q23-q24.1 and consists of 12 exons (ENSEMBL: ENSG00000111199)

1.4.1 Structure of TRPV4

As illustrated in Figure 1.5, the putative transmembrane structure of TRPV4

is consisting of 871 amino acids (aa) with intracellular Amino (N-) and Carboxyl (C-) terminus, six transmembrane-spanning domains (TM1–6), and a pore-forming loop between TM5 and TM6 (Liedtke et al., 2000); (Heller and O'Neil, 2007) Even though TRPV4 shows sequence similarity to other members of the TRPV family, particularly

to TRPV1–3, a coexpression study has indicated that TRPV4 preferentially forms homomers (Hellwig et al., 2005), however, there is no evidence for heteromultimeric combinations with other TRPVs

Figure 1.5 Schematic overview of TRPV4’s predicted structural and functional

components Shown are schematic representations of TRPV4’s amino terminus (A), its central region with the membrane-spanning domains and the pore loop (B), and the channel’s carboxyl terminus (C) Specific domains and amino acids are indicated

Regions that are predicted to be extracellularly located are indicated with a black

horizontal bar in B Also shown in B are the proposed pore helix and selectivity filter

displaying the ‘TIGMGD’ region similar to the K+ channel selectivity filter signature sequence Adapted from (Heller and O'Neil, 2007)

N-myristoylation

Protein kinase C phosphorylation

cAMP phosphorylation

Src family tyrosine phosphorylation

Bipartite nuclear targeting sequence

ARD1 ARD2 ARD3

Protein kinase C phosphorylation

ASN glycosylation

Extracellular

Pore helix Potential selectivity filter SETFSTFLLD 472 LFKLTIGMGD 682 50-75% conserved with TRPV1-3 100% conserved with TRPV1-3

Calmodulin-N-myristoylation

Protein kinase C phosphorylation

cAMP phosphorylation

Src family tyrosine phosphorylation

Bipartite nuclear targeting sequence

ARD1 ARD2 ARD3

Protein kinase C phosphorylation

ASN glycosylation

Extracellular

Pore helix Potential selectivity filter SETFSTFLLD 472 LFKLTIGMGD 682 50-75% conserved with TRPV1-3 100% conserved with TRPV1-3

Calmodulin-The amino-terminal part of TRPV4 as shown in Figure 1.5A likely has three

ankyrin repeat domains (ARD1–3) within an ankyrin repeat region from aa235 to aa367, a cluster of four protein kinase C (PKC)–phosphorylation sites and a cAMP-dependent–phosphorylation site upstream of the ankyrin repeat region, and a cluster

of two PKC sites within and downstream of ARD3 It has been hypothesized that activation of PKC with phorbol esters leads to opening of TRPV4 and increase of intracellular Ca2+ concentration (Xu et al., 2003a); (Gao et al., 2003)

Figure 1.5B showing the 242-aa-long central domain of TRPV4 consists of

TM1–6, which between TM5 and TM6, a short hydrophobic stretch that is the putative pore region or pore loop The channel appears to be posttranslationally modified by glycosylation (Arniges et al., 2006), and a bona fide Asn glycosylation site within the extracellular stretch between TM5 and the PL has been shown to be glycosylated in heterologously expressed TRPV4 (Xu et al., 2006) A PKC phosphorylation site downstream of TM2 is potentially involved in the above-mentioned PKC regulation of TRPV4 activation Moreover, phorbol esters can activate TRPV4 via direct interactions with residues inTM3 and TM4 (Gevaert et al., 2007)

The TRPV4’s carboxyl-terminal tail as illustrated in Figure 1.5C appears to

be the docking site for at least two interacting sites including calmodulin (CAM) binding sites and region involved in microfilament-associated protein 7 (MAP7) interaction sites The best characterized CAM domain is located between aa812-aa831 and is involved in Ca2þ-dependent activation of TRPV4 (Strotmann et al., 2003); (Garcia-Elias et al., 2008) Mutations within this region resulted in a loss of Ca2+-dependent calmodulin binding and a loss of Ca2+-dependent potentiation of TRPV4

currents (Liedtke et al., 2000); (Watanabe et al., 2003) Coexpression of TRPV4 with MAP7 in CHO cells apparently increases the amount of TRPV4 protein associated with the plasma membrane, which could be a method employed by cells to control the density of TRPV4 in the plasma membrane (Suzuki et al., 2003)

1.4.2 Activation and regulation of TRPV4

TRPV4 can be activated by a wide variety of stimuli including physical (low

pH, cell swelling, heat and mechanical stimulation) and chemical (endocannabinoids, arachidonic acid and 4α-phorbol esters) Some of the most potent TRPV4 agonists as

revealed in the Figure 1.6

200-400 nM) and its putative binding pocket between TM3-TM4 of TRPV4 (Gevaert

et al., 2007) B 4α- phorbol 12,13-dihexanoate (4α-PDH) is a 5-fold more potent

TRPV4 activator than 4α-PDD (EC50 ~ 70 nM) (Klausen et al., 2009) C Recently

described TRPV4 agonist GSK1016790A (EC50 ~ 1-10 nM) (Thorneloe et al., 2008) See Appendix IV for permission to reproduce (Everaerts et al., 2010)

TRPV4’s activity seems to be regulated by a calmodulin-dependent mechanism with a negative feedback mechanism It promotes cell-cell junction formation in skin keratinocytes and plays an important role in the formation and maintenance of functional intercellular barriers It also acts as a regulator of [Ca2+]i in synoviocytes and confers many distinct cellular functions in various cell types throughout the body (Estevez and Strange, 2005)

Like many other Ca2+-permeable ion channels, the activity of TRPV4 is strongly regulated by Ca2+ The Ca2+ regulates the channels in both directions; it controls both the activation and inactivation of TRPV4 Spontaneous TRPV4 activity

is strongly reduced in the absence of extracellular Ca2+, or by the replacement of extracellular Ca2+ by ion Strontium (Sr2+) or ion Barium (Ba2+) (Strotmann et al., 2003)

1.4.3 TRPV4-associated proteins

TRPV4 is associated with proteins such as TRPV2, Akt, progesterone receptors, integrin, MAP7 and OS-9 TRPV4 had been reported to associate with TRPP2, a member of the polycystin subfamily of TRP channels, and forms a mechano- and thermosensitive molecular sensor in the primary ciliumof vertebral epithelial cells Although TRPP2 itself is not considered to be mechano-sensitive, polycystic kidney disease (PKD) cilia that express mutant TRPP2 channels lack mechanosensitive properties, suggesting a pathogenic role of TRPV4 in PKD (Kottgen et al., 2008)

TRPV4 activation was linked to Akt phosphorylation and β-Raf and Erk1/2 inhibition (Gradilone et al., 2010) Its activation in polycystic kidney (PCK)

cyst growth in 3-dimensional culture (3-fold) Moreover, TRPV4 stimulated phosphatidylinositol 3 kinase–dependent activation and binding of additional β1 integrin receptors, which promoted cytoskeletal remodeling and cell reorientation (Thodeti et al., 2009) Thus, TRPV4 appears to mediate a novel stretchsensitive

‘integrin-to-integrin’ signaling mechanism that is required for capillary endothelial (CE) cell reorientation during angiogenesis

There are some reports regarding the regulation of TRP channels by sex hormones: Estrogen downregulates expression of TRPC4 in aortic endothelial cells (Chang et al., 1997), testosterone up-regulates expression of TRPM8 in prostate epithelial cells (Bidaux et al., 2005), and progesterone increases TRPV6 expression in breast cancer cells (Bolanz et al., 2008) Interestingly, it had been demonstrated that TRPV4 promoter activity was reduced by coexpression with progesterone receptors (PR) and further reduced in the presence of hormone progesterone (PG) (Jung et al., 2009)

Apart from these, the microtubule-associated protein 7 (MAP 7) interacts with the C terminus of TRPV4 It had been reported that MAP7 enhances expression of TRPV4 in the plasma membrane and links the channel to the cytoskeletal microtubules, forming a mechano-sensitive molecular complex (Suzuki et al., 2003) Furthermore, it had been shown that OS-9 binds to N-terminus of monomeric TRPV4

at the endoplasmic reticulum (ER) to regulate its biogenesis and prevents its polyubiquitination and subsequent proteosomal degradation (Wang et al., 2007)

Calcium signaling is an important factor in the metastatic behaviour of cancer cells There are promising developments in the targeting the molecular constituents of

calcium signalling for restraining metastasis The importance of Ca2+-permeable ion channels is not limited to cancer therapies, but it also might be useful for diagnostic purposes

A good example is the highly Ca2+- selective TRPV6 Its expression and function was shown to correlate with prostate cancer grade (Lehen'kyi et al., 2007); (Valero et al., 2011) Importantly, the TRPV6 channel is consistently overexpressed not only in prostate cancer but also in breast, thyroid, colon, and ovarian carcinomas (Zhuang et al., 2002) Decreased expression of TRPM1 has been shown to correlate with melanoma cell transition from a low to a high metastatic phenotype (Miller et al., 2004) TRPC6 had been identified as a novel therapeutic target for esophageal carcinoma, whereas high levels of TRPC3 expression correlate with a favorable prognosis in patients with lung adenocarcinoma (Ouadid-Ahidouch et al., 2012)

Interestingly the role for store-operated Ca2+ entry in tumor metastasis had been reported recently SiRNA-mediated reduction of Orai1 or STIM1 expression in highly metastatic human breast cancer cells or the treatment with a pharmacological inhibitor of store-operated calcium channels was shown to decrease tumor metastasis

in animal models (Yang et al., 2009) In addition, transcriptional profiling of primary breast cancer specimens using DNA microarrays has identified that alteration in the ratio of STIM1 to STIM2 is associated with poor breast cancer prognosis (McAndrew

et al., 2011)

1.5.1 TRPV4 in human diseases

Recently, several studies have demonstrated that mutations in the TRPV4 gene can results in genetic disorders such as Brachyolmia, Charcot-Marie-Tooth disease type 2C (CMT2C), Spinal Muscular Atrophy (SMA), Hereditary Motor and Sensory

Neuropathy type 2 (HMSN2C), Spondylometaphyseal dysplasias (SMDK) and metatropic dyplasia Most of these missense and nonsense point mutations are linked

to the development of genetic disorders in human and a detailed list of naturally

occurring TRPV4 mutations and related disease is documented in Table 1.2

All these studies had highlighted an important role for TRPV4 in the human pathogenesis Thus, TRPV4 seems to be an important pharmacological target in the treatment of various diseases such as arthritis, interstitial cystitis, hypotonic hyperalgesia, allodynia, asthma, bronchial hyperresponsiveness, neuropathic pain, impairment of osmoregulation, hypertension and defective environmental themosensation

As TRPV4 is involved in the control of proliferation and growth in normal cells (Nilius et al., 2007), dysfunctions may lead to growth disturbances, altered organogenesis or cancer TRPV4 has never been implicated in human cancers although the transcript of TRPV4 was inadvertently observed in a DNA microarray study to be more in colon cancer compared to normal tissue TRPV4 was detected to

be over-expressed in colon cancer at the mRNA level (https://www.oncomine.org/resource/login.html) The human gastrointestinal tract is innervated by primary visceral afferents that express at least three of these channels including TRPV1, TRPA1 and TRPV4 TRPV4 has recently been shown to be expressed in colon afferents, where it appears to have a significant role in nociception and the development of hypersensitivity (Christianson et al., 2009)

Table 1.2 Naturally occurring TRPV4 mutations Table adapted from (Verma et al.,

Effects on ion conductivity

Genetic disorder

(exon 2)

(uncharged) to nonpolar

More conductivity

1.6 Research objectives

Investigation of target genes that are associated with metastasis progression is critical for improving the outcomes of our patients In recent years, metastasis research has entered into a stage of remarkable progress In an attempt to map the molecular changes associated with metastasis, our lab conducted phosphoproteomics analysis on a murine breast cancer metastasis model comprising a series of isogenic breast cancer cell lines with increasing metastatic potential

TRPV4 was subsequently discovered to be a novel phosphoprotein that is associated with breast cancer metastasis Although TRPV4 is one of the most studied channels of the entire TRP superfamily in term of its structure, activators, localization, tracfficking and biophysical properties, its roles and modes of actions in breast cancer metastasis remain obscure We hypothesize that TRPV4 is a positive regulator in breast cancer metastasis

In this project, we focus on understanding the function and mechanism of TRPV4 in breast cancer metastasis through the use of a selective activator 4α-PDD,

in-vitro based assays, signal transduction tools and mouse models

We believe that further efforts to unravel the modus operandi of the TRPV4 channel will lead a better understanding about the molecular etiology of breast cancer metastasis This has implications on the development of improved molecularly targeted approaches for diagnosis and treatment of cancer

Chapter 2 Materials and Methods

2.1 Chemicals and reagents

The IGEPAL, NaCl, Triton-X, sodium fluoride, sodium orthovanadate and DMSO were purchased from Sigma Chemical (St Louis, MO) The protease inhibitors were from Roche (Nutley, CA) The Tris-base and EDTA were from First Base Laboratories Sdn Bhd (Selangor Darul Ehsan, Malaysia) The transfection reagent JetPRIME™ was supplied by Polyplus-transfection Inc (New York, USA) MTS assay was obtained from Promega (San Luis, CA) Ruthenium Red from Tocris Bioscience (Bristol, UK) 4 alpha-Phorbol 12,13-Didecanoate, BAPTA-AM and AKT inhibitor IV were from Merck KGaA (Darmstadt, Germany), whole MG132, EGTA and FAK inhibitor were from Sigma-Aldrich (St Louis, MO) TRPV4-specific siRNA oligos were purchased from Invitrogen (Carlsbad, CA) and the siRNA sequences are as following:

Luciferase GL2: 5’-CGUACG CGGAAUACUUCGA-3’;

TRPV4 siRNA1: 5’-AGAAGCAGCAGGUCGUACAUCUUGG-3’;

TRPV4 siRNA2: 5’-UAAUGGGCUCUACAGCCAGCAUCUC-3’;

TRPV4 siRNA3: 5’-AAACUUGGUGUUCUCUCGGGUGUUG-3’;

Twist siRNA1: 5’- GGCAGAGAUCCGUAGUACUUGCGUU -3’

Twist siRNA2: 5’- GCCCAGAGAUCUGUAUUACGGGUUU -3’

Twist siRNA3: 5’- AAUAGAUCCGGUGUCUAAAUGCAUU -3’

Anti-TRPV4 polyclonal antibodies were kindly provided by Prof Dr Christian Harteneck; Institut fUr Experimentelle & Klinische Pharrnakologie & Toxikologie Eberhard-Karls-Universitat Tǘbingen, Germany E-cadherin polyclonal antibodies, phospho-AKT (S473) polyclonal antibodies, AKT polyclonal antibodies,