Structural and functional genomics study of singapore grouper iridovirus 2

In this project, we knocked down SGIV ORF18R, ORF140R and ORF135L and analyzed the effects on SGIV and host protein expression profiles using iTRAQ method.. 4.3 Results and Discussions:

Chapter 4 Morpholino antisense oligonucleotide knock-down

and functional characterization of SGIV proteins

Manuscript in preparation

Functional characterization of Singapore grouper iridovirus proteins using Morpholino antisense oligonucleotide knock-down.

4.1 Introduction

Morpholino antisense oligonucleotides (oligos or morpholinos) or MO in short is a gene knock-down agent MOs used for SGIV gene knock-down were synthesized by GeneTools based on the full sequence of SGIV genome and ORFs

We have carried out MO knock-downs for SGIV ORFs whose expression stages are different, ORF18R and ORF140R are late stage genes, ORF135L is an early gene On the other hands, antibodies of these 3 proteins are available In this project, we knocked down SGIV ORF18R, ORF140R and ORF135L and analyzed the effects on SGIV and host protein expression profiles using iTRAQ method

In all SGIV gene knock-downs, only MO knock-down of ORF018R (MO18) showed a phenotype This ORF18 was demonstrated to be involved in serine/threonine phosphorylation

and virion assembly (Wang et al., 2008) Hence, we have included MO18 in this project as a positive control and further examine its function using other approaches

4.2 Material and methods

4.2.1 MO knock-down

MOs were delivered using Nucleofactor kit T (Amaxa), program T27 Briefly, the fresh cells

nucleotransfector solution (with supplement) and 2 μL of MOs to get a final concentration of

20 μM MO, transferred into a cuvette for electrophoresis The mixture was transferred immediately into the cell culture flask with fresh medium The negative control MO (MOctrl) is the standard control oligo from GeneTools All MOs used in this projects are listed in Table 11

The virus was added into the tranfected cells at 40 hours post transfection (hpt) All the samples were harvested at 48 hpi for iTRAQ analysis or at different time courses for transmission electron microscopy experiment and Tissue Culture Infectious Dose50 (TCID50

test)

4.2.2 iTRAQ sample preparation

This has been described in Chapter 3 (3.2.2)

4.2.3 LC-MALDI MS

This has been described in Chapter 3 (3.2.3)

4.2.4 Transmission Electron Microscrope (TEM)

The cells were fixed in 2.5 % glutaraldehyde, 2 % paraformaldehyde in 1X PBS (pH 7.4) overnight and post-fixed with 1 % Osmium tetroxide for 3 hours, followed by dehydration in

an ethanol series of 50 %, 75 % and 100 % The samples were embeded using the Spurr kit (Sigma), sliced into ultra thin sections (70-90 μm) and stained with 2 % uranyl acetate, 1 % lead citrate The ultra thin sections were viewed under JOEL JEM 2010F electron microscopy

4.2.5 TCID50 test

GE cells were transfected with MOs and infected with SGIV at 40 hpt at m.o.i (multiplicity of infection) of 3 and 0.5 for high and low m.o.i respectively Unabsorbed virions were removed

at 2 hpi and the cells were washed twice with PBS The cell culture supernatant and cell pellet from 3 different time intervals (48 hpi, 72 hpi and 96 hpi) were diluted from 10-2 to 10-7 and used to infect GE cells with six repetitions per dilution to perform the TCID50 assay The viral

titres were calculated using the Spearman-Karber method (Hamilton et al., 1977).

4.2.6 Western Blot analysis

This was described earlier in chapter 2 (2.2.11)

Table 11 The sequences of Morpholinos for knock-down experiments.

Table 12 The specific primers for real-time PCR

ORF007L TGACCATGTGACGATAACTATAAGCCCGG AGGGTATATCTATCGGTTCGGC

ORF136R TGACCATGGGATGAATCAAGAAATGCAGAC GAAAAGGGATGCAGCAACA

4.3 Results and Discussions:

4.3.1 MO knock-down of ORF018R, ORF140R and ORF135L

To examine the specificity and efficiency of MO knock-down, we analyzed the expression of knocked-down proteins using Western Blot, in which GE cells were transfected using MO and infected by SGIV The Western Blot results showed no detectable amount of proteins 018R, 140L and 135R with the specific knock-down (Figure 18) We also included other SGIV proteins such as ORF026R and ORF093L which were expressed normally in all knock-downs

It was concluded that ORF018R,ORF140R and ORF135L were specifically and efficiently knocked down by MO18, MO140 and MO135 respectively

4.3.2 Effect of MO 135 knock-down on SGIV and host proteins expressions

To study the effect of knock-downs on the viral and host proteins expressions, we analyzed the protein profile of knock-down GE cells using iTRAQ method The fresh GE cells were transfected by MOs, infected by SGIV (m.o.i of 5, infected at 40 hpt), harvested at 48 hpi, and prepared for iTRAQ samples In this project, we used 4-plex iTRAQ to analyse 4 protein samples of MOctrl, MO140, MO135 and MO18 knock-down cells

ORF135L is an early gene with unknown function (Chen et al., 2006) It encodes a small structure protein of 13 kDa (Song et al., 2004) The knock-down of ORF135L using MO135 has

non-caused several changes in protein expression of SGIV and host proteins (Table 13) SGIV ORF101R protein was significantly increased after the knock-down ORF101R is also an early

gene (Chen et al., 2006) which encodes a 35 kDa structure protein (Song et al., 2006) We

were not able to validate the change of ORF101R protein expression by Western blot due to the unavailability of the anti-ORF101R protein antibody On the other hands, we examine the mRNA expression level of ORF101R using real-time PCR method The real-time PCR result showed the increase of ORF101R mRNA by 1.5 fold (Figure 19) after MO135 knock-down It is likely that protein 101R was negatively regulated by 135L protein

In addition, MO135 knock-down has led to the decrease of several host proteins including the elongation factor 1-alpha (eEF1A) and Retinoblastoma A associcated protein eEF1A is an isoform of the alpha subunit of the elongation factor-1 complex, which is resposible for the enzymatic delivery of aminoacyl tRNAs to the ribosome, thereby regulating the fidelity and rate of polypeptide elongation during translation (Condeelis, 1995) Association of eEF1A with

specific virus molecules may play a role in the replication of virus genome (Johnson et al,

2001; Cimarelli & Luban, 1997; Blackwell & Brinton, 1997) Retinoblastoma associated

protein may have diverse function in regulation in cell proliferation (Pacifico et al, 2007; Giordano et al., 2007) and transcription regulator (Hofman et al, 2003; Yan et al., 2000) By

reduction of both eEF1A and retinoblastoma associated protein, MO135 knowk-down may have significant influences on transcription regulation and replication of virus genome

4.3.3 Effect of MO 18 knock-downs on SGIV and host proteins expressions

ORF018R is a late gene (Chen et al., 2006) which encodes a 32 kDa structure protein (Song et

al., 2004) It was reported that ORF018R is involved in serine/threonine phosphorylation and

virion assembly (Wang et al., 2008) In this study, MO18 knock-down appeared to regulate the protein expression of ORF007L, 012L, 046L, 125R and 140R (Table 14) ORF007L, 012L,

046L and 140R are late stage viral genes (Chen et al., 2006) that would further confirms ORF018R has an effect on late stage genes (Wang et al., 2008) Furthermore, the reduction of

protein 140R in MO18 knock-down (Wang et al., 2008) were confirmed by iTRAQ analysis It

is possible that ORF140R is one down-stream gene regulated by ORF018R

In addition to the effect on SGIV proteins, MO18 knock-down caused significant changes in the expression of several host proteins (Table 14) including the splicing factor arginine/serine rich 2 protein (SFRS2 or SR) which was up regulated in MO140 and MO135 knock-down SFRS2 is required for early spliceosome assembly for protein-protein interaction and can

function as activators of pre-mRNA splicing (Lopato et al., 1996; Graveley & Manaitis, 1998)

Both depletion and over expression of SFR2 could cause serious impact to the transcription and splicing machineries during gene expression (Wang and Manley, 1995; Fededa and

Kornblihtt, 2008; Lin et al., 2008; Xiao et al., 2007) It has been reported that the

over-expression of SR proteins caused a large reduction of genomic RNA, down-regulate the late

steps of HIV-1 replication (Jacquenet et al., 2005).

Besides, MO18 also reduced protein expression of RhoA (Ras homolog gene family, member A) which is a small GTPase protein known to regulate the actin cytoskeleton in the formation

of stress fibers (Ridley, 2001) RhoA GTPase was known with roles in facilititating virus entry, adherent target cell and infection by involving remodel of actin cytoskeleton for phagocytosis-

like uptake (Clement et al., 2006; Veettil et al, 2006; Coyne et al, 2007; Jimenez-Baranda et

al., 2007) RhoA-GTPase is also essential for entry stages of infection involved in the

modulation of microtubular dynamics, movement of virus in the cytoplasm, and nuclear

delivery of viral DNA (Raghu et al, 2007) In addition, RhoA signaling is associated with filamentous virus morphology, cell-to-cell fusion, syncytium formation (Gower et al., 2005)

Interestingly, it was reported that MO18 knock-down resulted in a reduction of virus infectivity

and distortion of viral particle assembly (Wang et al., 2008) Hence, in MO18 transfected cells, the decrease of cellular RhoA, which is an crucial protein for virus entry, infection and delivery

of viral DNA, might contribute to these knock-down’s effects

4.3.4 Effect of MO 140 knock-downs on SGIV and host proteins expressions

ORF140R encodes a late, non-structural protein of 32 kDa (Song et al., 2004; Chen et al.,

2006) MO140 knock-down resulted in several changes of SGIV and host protein expression (Table 15) ORF046L, a late and structure protein, was decreased after MO140 knock-down ORF046L was also shown to be down-regulated in MO18 transfected cells However, MO140knock-down had no impact on ORF007L, 012L, 125R which were declined in MO18 knock-down Except for ORF125R that is an intermediate early gene, ORF018R, 007L, 012L and

046L are all late stage genes (Chen et al., 2006) It was confirmed that ORF140R protein was

reduced in MO18 transfected cell, however in this study, ORF018L protein expression was not affected by MO140 We might hypothesize that ORF007L and 012L are in the middle of the pathway, in which ORF140R is a down stream gene regulated by ORF018R; and ORF046L is further down stream, under regulation of both ORF018R and ORF140R

Furthermore, MO140 knock-down up-regulated cellular splicing factor arginine/serine rich 2 protein (SFRS2 or SR) This host protein was also increased in MO135 knock-down cells but declined after MO18 knock-down Our previous analysis implied that either significant decrease

or increase of cellular SFRS2 might seriously effect the host transcription, splicing processes and the viral genomic replication

Besides, all these three MO knock-downs shared one common phenomenon which is the regulation of the host 40S ribosomal protein S6 (RPS6) RPS6 is located in the mRNA binding site of the 40S subunit of cytosolic ribosomes RPS6 can be directly cross-linked to mRNA, tRNA and initiation factor It was found that RPS6 becomes highly phosphorylated on multiple

up-serine residues in response to several oncogenic viruses (Sturgill et al., 1988; Decker, 1981; Blenis & Erikson, 1984; Maller et al., 1985) Several lines of evidence link elevated S6

phosphorylation to the initiation of protein synthesis, suggesting that this may be one of several events involved in the control of cell proliferation (Blenis & Erikson, 1985) The cellular RPS6 was unchanged upon SGIV infection (iTRAQ data, chapter 3) Hence, it seems that the high expression level of RPS6 could be the consequence of MO knock-down

4.3.5 Analyze the gene expression of SGIV proteins regulated by knock-downs using real time PCR

To study the mRNA expression level of SGIV ORFs which were regulated by these MO knock-downs, we carried out the real-time PCR experiment with the specific primers listed in table 12 The consistency between transcription and translation was shown by ORF101R with the increase of both ORF101R mRNA and protein in MO135 transfected cells In contrast,

ORF007L, 012L, 125R protein expressions were reduced in MO18 knock-down; ORF136R protein was increased in MO135 knock-down but their mRNA levels were unchanged In addition, mRNA levels of ORF046L in MO18 and MO135 transfected cells were increased around 3 and 2.5 fold respectively even the protein was shown to be decreased The phenomenon of inconsistency has been often encountered in the comprehensive analysis of data from transcriptome and proteome sources This is always a major challenge In order to explain this inconsistency, we need to know the properties of genes, transcripts and proteins

(Irmler et al., 2008; Lu et al., 2008) It has been reported that proteins, which are shown to

change in the proteome but not in the transcriptome, fall into classes of post-transcriptional modification, protein synthesis and protein folding On the other hands, genes, which are changed only at the transcriptional level, usually affect cell growth/death pathways, cell-cell

related function (Lu et al., 2008; Seth et al., 2007)

The knock-downs with these significant changes in both host and viral proteins could have certain impact on the virus infectivity

4.3.6 Effect of MO knock-downs on virus infectivity

To investigate the knock-down’s effects on the infectivity of newly assembled virions, we carried out the TCID50 test using high dose (m.o.i of 3) and low dose (m.o.i of 0.5) of SGIV (Figure 20) Both cell culture supernatants and cell pellets contained virions were used in the virus titration experiment The reduction of virus infectivity were at different level MO18knock-down caused the most significant decrease of virus infectivity and the virus infectivity after MO140 knock-down was lower than that after MO135 knockdown The effect of MO140 on

virus infectivity is milder than that of MO18, which is quite consistent with the hypothesis that ORF140R is a down stream viral gene regulated by ORF018R.

The TCID50 results could provide some links of specific knock-down’s effects to host/viral proteins to the reduction of virus infectivity and might imply the importance of ORF018R, ORF140R and ORF135L on virus infection, replication and even virus morphology

4.3.7 Effect of MO knock-down on virus phenotype

We used TEM to examine the effect of MO knock-down on the phenotype of newly synthesized virions (Figure 21) Although the TCID50 test showed the reduction of virus infectivity in the infected MO140 and MO135 transfected cells, the phenotypes of virions after these knock-downs were quite normal, only MO18 caused clear morphological defect on virus

particles (Wang et al., 2008) We encountered some defected virion particles in MO140

transfected cells whick appeared to be similar to the defect caused by MO18 Taken together with the TCID50 test, the defect virion particles could partly explain the reduction of virus infectivity after the knock-downs MO18 transfected cells with the distortion of viral particle seriously reduced the virus infectivity MO140 which knock-downs ORF140R, a possible down-stream gene of ORF018R, caused fewer defected virion particles than MO18 Hence MO140knock-down had less severe effect on virus infectivity Furthermore, MO135 had least effect on virus infectivity compared with MO18 and MO140 Most of virion particles in MO135 transfected cells were quite normal except several empty virions There are some empty virions which were circled and pointed by arrow heads (Figure 21) These virions were observed more in

MO18 knock-down cells, fewer in MO140 and MO135 transfected cells However, we need further investigation to quantitate the empty virions

Figure 18 Western blot analysis ORF140R, ORF135L, ORF18R proteins by MOctrl, MO140,

MO135 and MO18 knock-down respectively These gene knock-downs are specific and suffient The proteins of knock-down genes were not detected using western blot

Table 13: Host and SGIV proteins which were significantly regulated by MO135 knock-down

Host/virus

protein ORFs/ Protein name Accession number MW (Da) Protein

iTRAQ ratio (MO 135 /

MO ctrl )

Gene expression Stage *

S/NS**

SGIV

protein

Retinoblastoma A associated protein

PREDICTED: similar to MGC53657 protein [Strongylocentrotus purpuratus] gi|72012161 18115.37 0.652344elongation factor 1-alpha [Cypridopsis vidua] gi|4530096 44543.76 0.643597elongation factor 1-alpha [Rhincalanus

phosphoglucose isomerase [Mugil cephalus] gi|20067649 67731.1 1.499392

Host protein

unnamed protein product [Tetraodon

1.409418

Table 14: Host and SGIV proteins which were significantly regulated by MO18 knock-down

Host/virus

protein ORFs/ Protein name Accession number Protein MW (Da)

iTRAQ ratio (MO 18 /

MO ctrl )

Gene expression Stage *

Zgc:55876 protein [Danio rerio] gi|41946787 26663.96 0.596155

splicing factor arginine/serine rich 2

unnamed protein product [Tetraodon nigroviridis]

gi|47228056 64087.05 0.649397

Ornithine aminotransferase precursor CG8782-PA [Drosophila melanogaster]

gi|21357415 51969.66 1.465898 Host protein

Table 15: Host and SGIV proteins which were significantly regulated by MO140 knock-down

Host/virus

protein ORFs/ Protein name Accession number Protein MW (Da)

iTRAQ ratio(MO140/

MOctrl)

Gene expressionStage *

Zgc:55876 protein [Danio rerio] gi|41946787 26663.96 1.407937

splicing factor arginine/serine rich 2 [Oryzias

Host protein

L: Late; IE: Intermediate Early (Chen et al., 2006) ** S: structure; NS Non-structure (Song et al., 2004)

iTRAQ protein profile

0 0.5 1 1.5 2

Figure 19: The real time PCR data shows mRNA expresssion trend is inconsistent with

the iTRAQ protein profile

Figure 20 The effect of MO knock-down to virus infectivity of newly assembled virion particles Infectivity of virion particles in A: cell culture of low moi virus infection after

MO transfection; B: cell pellet of low moi virus infection after MO transfection; C: cell culture of high moi virus infection after MO tranfection and D: cell pellet of high moi

virus infection after MO transfection Knock-down of ORF18R caused the greatest effect on virus infectivity Knock-downs of ORF140R and 135L were quite similar

Figure 21 Effects of MO knock-down on SGIV assembly

GE cells transfected with (A) MOctrl, (B) MO140, (C) MO135 and (D) MO18 were infected with SGIV moi = 5 at 40 hpt The cells were harvestd at 48 hpi and fixed, prepared for TEM The pictures shown here are representative for many virus-infected cells The arrows show defective viruses The similar phenonena were observed if tranfected cells were infected by low moi (0.5) of SGIV Arrows point to defective viruses, arrow heads point to empty viruses in circles Knock-down ORF18R caused