Structural and functional genomics study of singapore grouper iridovirus 1

Table 1: Current classification of the Iridoviridae family Williams et al., 2006Genus Distiguishing features Host species Members of genus Iridovirus DNA is not methylated Insects Invert

Chapter 1

Literature Review

1.1 Introduction to virus

In 1898, Friedrich Loeffler and Paul Frosch found evidence that the cause of foot-and-mouth disease in livestock was an infectious particle smaller than any bacteria This was the first clue to the nature of viruses, genetic entities that lie somewhere in the grey area between living and non-living organisms

A virus (from the Latin virus meaning toxin or poison) is a sub-microscopic infectious agent that

is unable to grow or reproduce outside a host cell Each viral particle, or virion, consists of genetic material, DNA or RNA, within a protective protein coat called a capsid Some viruses have more complex structures with tail or envelop (Emiliani, 1993)

Viruses depend on the host cells that they infect to reproduce A virus can insert its genetic material into its host, literally taking over the host’s DNA replication and protein expression machinery Some viruses may remain dormant inside host cells for a long period of time, causing

no obvious change in their host cells (lysogenic phase) But when a dormant virus is stimulated,

it enters the lytic phase: new viruses are formed, self-assemble, eventually rupturing and killing the host cell before infecting other cells (Emiliani, 1993)

Viruses can infect all organisms from bacteria to plants and animals and cause a number of severe diseases in eukaryotes Antibiotics have no effect on viruses, but antiviral drugs have been developed to treat life-threatening infections

1.2 Overview of the Iridoviridae family

1.2.1 Characteristics of the Iridoviridae family

Iridoviruses have been found to infect invertebrates (insects) and poikilothermic vertebrates, including amphibians, reptiles and fishes This virus family has three distinct features including the virus morphology, the cytoplasmic location of virion particles and the genomic organization

Iridoviruses are a family of large viruses (120- 300 nanometers in size) that contain linear, double-stranded DNA as their genetic material and have an icosahedral (20-sided) capsid (Figure 1) An iridovirus virion is composed of three concentric domains; an outer proteinaceous capsid,

an intermediate lipid membrane with associated polypeptides, and a central core containing DNA-protein complexes Some, but not all, viruses possess an outer envelop acquired by budding through the host membrane Fibrillar structures have also been observed protruding from capsid subunits of Lymphocystis disease virus 1, Megalosystisivirus and Chloriridovirusbut not from Frog virus 3 A common feature of all iridoviruses is the presence of a major capsid

protein of around 50 kDa that accounts for up to 45% of total virion protein (Williams et al.,

2006)

Figure 1: Diagram of icosahedral capsid of Sericesthis Iridescent Iridovirus.

Trisymmetron are shown in white subunits, disymmetrons in black and pentasymmetrons in

grey The geometrical edges of the icosahedral are picked out in broken lines (Wrigley, 1969).

Iridovirus infections result in the appearance of large, morphologically distinct viral assemblysites within the cytoplasm These sites serve as a concentration point for viral proteins and DNA

and are the site of virion assembly (Williams et al., 2006) The viral particles accumulate within

the cytoplasm in large crystalline arrays Light reflected from the surface of this special

arrangement interferes with newly arriving light, causing Bragg reflection (Klug et al., 1959) resulting in “rainbow-like” iridescence The name Iridoviridae was originally derived from Iris,

who was the Greek goddess of the rainbow However, the iridescent phenomenon takes place only in invertebrate iridoviruses, not in vertebrate iridoviruses

In addition to their distinctive size and cytoplasmic location, iridoviruses are distinguished from other virus families by their genomic organization The iridovirus genome is circularly permutated and terminally redundant This structure is a result of the resolution of genome

concatamers during DNA replication (Williams et al., 1996).The large concatameric DNA is

moved to the assembly site and packaged into the viral capsid through a “headful” mechanism until the head of the virus is full (Goorha and Murti, 1982)

During replication, multiple copies of a hypothetical viral genome form a long concatamer The resolution of this concatamer results in packages of DNA that contain a complete genome and duplicated copies of some genes as well (terminal redundancy) The ends of each of these packaged DNA fragments differ from one virus particle to the next (cyclic permutation) This

genomic structure has been found in all iridoviruses so far studied (Williams et al., 2006)

1.2.2 Classification of the Family Iridoviridae

To date, more than 100 species of iridoviruses have been discovered in a wide variety of invertebrates and vertebrates It is necessary to classify them into different genera based on their common characteristics including the sources of host organisms, genetic properties, and morphological evidences (Table 1)

The family Iridoviridae is currently subdivided into five genera: Iridovirus, Chloriridovirus,

Lymphocystivirus, Megalocytivirus and Ranavirus (Williams 2006) The first two genera can

infect a large range of insects such as flies, silkworms (for Iridovirus) and mosquitoes (for

Chloriridovirus) The last 3 genera contain veterbrate viruses that infect poikilothermic

vertebrates including fishes, amphibians and reptiles Ranavirus is a large genus, in which frog virus 3 contains at least 15 isolates including Box turtle virus 3, Bufo bufo United Kingdom virus, Bufo marinus Venezuelan iridovirus 1, Lucke triturus virus 1, Rana temporaria United Kingdom virus, Redwook Park virus, Stickleback virus, Tadpole virus 2, Tiger frog virus,

Tortoise virus 5, Largmouth bass virus, Doctor fish virus and Guppy virus 6 (Williams et al.,

2006)

Table 1: Current classification of the Iridoviridae family (Williams et al., 2006)

Genus Distiguishing features Host species Members of genus

Iridovirus DNA is not methylated Insects Invertebrate iridescent virus 1

~ 212 kbp Crustaceans Invertebrate iridescent virus 6Virion diameter possibly mollusks

~ 120-130 nm

Chloriridovirus

DNA is not methylated Mosquitoes Invertebrate iridescent virus 3

~ 135 kbp DipteraVirion diameter

~ 180 nm

Ranavirus

DNA is methylated* bony fish, Frog virus 3

~ 105 kbp reptiles, Frog virus 1, 2, 5-24Virion diameter amphibians Frog virus L2, L4, L5

Lucke triturus virus LT1-LT4Newt virus T6-T20

Xenopus virus T21 Ambystoma tigrinum

Tiger frog virusGrouper iridovirus Singapore grouper iridovirus

Lymphocystivirus

DNA is methylated Marine and fresh Lymphocystis disease virus 1

~ 103-186 kbp water fishes Lymphocystis disease virus 2Virion diameter world wide Lymphocystis disease virus

Megalocystivirus

DNA is methylated Marine fishes Infectious spleen and kidney

~ 105- 118 kbp in SE Asia necrosis virusVirion diameter

Orange spotted grouper

IridovirusSea bass iridorivirusRed sea bream iridovirus

* Singapore grouper iridovirus and Grouper iridovirus appears to lack a DNA methyltransferase

2001) The SGD outbreaks in 1992 resulted in losses of 50% of Singapore brown- spotted

grouper stock ( Chua et al., 1994) This virus threatens the aquaculture economic in Singapore

and South East Asia as well

SGIV genome was fully sequenced with many of the open reading frames (ORFs) are novel

with unknown functions (Song et al., 2004) However, with the availablity of a grouper cell line (Chew-Lim et al., 1994), the functional and structural genomics studies could provide a new

insight into molecular biology of the virus and be meaningful for drug design

1.3.2 Reseach progress on SGIV

1.3.2.1 Isolation and propagation of SGIV

Study of grouper diseases can be traced back to an investigation on a mass mortality in marine

cage-cultured sea perch, Lates calcarifer, and grouper, E tauvina in the Johore Straits about

twenty year ago (Nash et al., 1987) and in Singapore in 1992(Chua et al., 1994) A large number

of infected fish suffered from severe hemorrhagic ulcerative dermatitis The spleens of the infected fish were two to three times larger than those of the normal ones due to the intrusion of

viruses (Chua et al., 1994) The supernatants of infected tissue homogenates were then

inoculated onto confluent monolayers of grouper cell line, with good resultant titers This novel

iridovirus has been successfully isolated from infected grouper- Epinephelus tauvina and designated as Singapore grouper iridovirus (SGIV) (Qin et al., 2003) The grouper embryonic egg (Epinephelus tauvina) cell line, developed by the Agri-Food and Veterinary Authority of Singapore (Chew-Lim et al., 1994), was used as a souce to propagate SGIV

1.3.2.2 Structure of SGIV

Sucrose gradient ultracentrifugation has been developed for the purification of SGIV from

infected grouper cell line (Qin et al., 2003) Using this approach, most of the virus was

suspended at the boundary layer between 40% and 50% sucrose (an equilibrium density banding) The virus was aspirated and examined under electron microscopy after negative staining The viral particle revealed a three-layer membrane structure with an inner electron-dense core The outline of the SGIV was also determined by negative staining and observed by electron microscopy under which the average size was estimated as 200±13nm The SGIV formed a well-defined hexagonal contour, suggesting that the three-dimensional structure of the

SGIV is an icosahedral particle (Qin et al., 2001).

1.3.2.3 Classification of SGIV

In Iridoviridae family, major capsid protein (MCP) is one of the highly conserved genes but sufficiently diversed to distinguish closely related iridorivus isolate (Tidona et al., 1998) Owing

to the special characteristic, a partial DNA sequence of the SGIV MCP has been successfully

amplified by a PCR technology (Qin et al., 2001) Compared with other MCP sequences, SGIV was easily classified into the genus Ranavirus, under the family Iridoviridae.

1.3.2.4 Physical properties of SGIV

One important aspect of the SGIV is its physicochemical properties which has been fairly well

established (Qin et al., 2001) The SGIV isolate, whose infectivity maintained at a high titer of

106.0 TCID50 mL-1, propagated continuously in a grouper embryonic cell line Nevertheless, the infectivity dropped dramatically when treated by high temperature at 56 ºC for 30 min Under an acidic environment with 0.1 M citrate buffer (pH 3.0), the SGIV almost lost all its infectivity in culture media The titer was also reduced dramatically from 107.0 to 103.0 TCID50 mL-1 with ether The SGIV was affected with treatment of low concentration of 5-iodo-2-deoxyuridine (IUdR, 10 µM), suggesting that the virus possessed a DNA genome Elucidation of physicochemical properties of the SGIV has facilitated us to monitor the fish disease Besides, all the above characteristics provide the evidence for the classification of SGIV within the virus kingdom However, the conclusive evidence for classifying it as a member of the family

Iridoviridae is the genetic structure of the virus.

1.3.2.5 Genome sequence and proteomics analysis of SGIV

The complete genome of SGIV was sequenced using random shotgun and restriction endonuclease genomic approaches The genome sequence was deposited at NCBI data base, and the accession number is AY521625 The entire SGIV genome consists of 140,131 nucleotide

base pairs with 162 ORFs (Song et al., 2004) Using peptide mass finger prints generated from

MALDI-TOF MS, 77 of the ORFs exhibited homologies to known viruses, 23 of which matched functional iridovirus proteins In addition, 26 proteins of this virus were identified for the first time , twenty of these represented novel or previously unidentified genes, which were further confirmed by reverse transcription-PCR, followed by DNA sequencing of the respective RT-

PCR products (Song et al., 2006)

Another proteomics investigation using 1-DE-MALDI and LC-MALDI workflows resulted in a more comprehensive identification of the SGIV proteome with another newly 25 SGIV proteins

identified (Song et al., 2006) Although a total of 51 SGIV proteins have been identified, the translational products of the remaining 111 ORFs are unknown (Song et al., 2006)

1.3.2.6 Temporal and differential stage gene expression of SGIV

A DNA microarray was generated for the SGIV genome to analyze the expression of its predicted ORFs The noninfected and infected cells at different time course of SGIV infection were collected and treated with cycloheximide and aphidicoline to study the temporal gene expression and to classify them into different-stage viral genes such as Immediate Early, Early

and Late genes The DNA microarray data was verified and consistent with real-time RT-PCR

studies (Chen et al., 2006) These results should provide important insights into the replication

and pathogenesis of iridoriviruses

1.4 Introduction to Ubiquitin and Ubiquitin-like protein

1.4.1 Ubiquitin

Ubiquitin (Ub) is a small and highly conserved protein with 76 amino acids (Schlesinger et al.,

1975) Its main role is to label proteins, including misfolded, damaged or malfunctioned proteins that are tageted for proteolytic degradation However, ubiquitin also has nonproteolytic function

by reacting with other proteins to modify the protein structures With or without protein degradation, the ubiquitin system is involved in the regulation of a number of cell signaling

pathway (Herrmann et al., 2007)

Ub is known to function in Ubiquitin proteosome sytem (UPS) (Figure 2), which plays a key role

in protein degradation of a variety of basic cellular processes such as cell cycle, cell division, transcription regulation (Schwartz 1999) and apoptosis (Jentsch and Pyrowolakis, 2000) In this pathway, Ub is activated by activating enzyme E1, transferred to conjugating enzyme E2, followed by ligase enzyme E3 Ub is then conjugated to specific substrate or next ubiqiuitin moiety to generate the polyubiquitin chain This polyubiquitin chain serves as a signal for protein degradation by 26S proteasome (Ciechanover, 1998)

In addition, Ub is able to modify proteins by monoubiquitination independent of proteolysis Monoubiquitination modifies histone proteins to control gene expression (Robzyk and Osley,

2000; Pham and Sauer, 2000), regulates the membrane transport endocystosis (Nakatsu et al,

2000; Shih et al, 2000) and is involved in the budding of retrovirus from the plasma membrane

(Hicke, 2001)

Figure 2: Schematic representation of the UPS pathway (Belz et al., 2002)

1.4.2 Ubiquitin-like proteins

In the past few years, a suprising number of ubiquitin-like proteins (UBL) or molecules have been identified, which can be divided into two separate classes: ubiquitin-like modifiers (ULM) and ubiquitin-domain proteins (UDP)

ULMs have very little homologous sequences but surprisingly a common 3D structure, the ubiquitin fold and C-terminal di-glycine residues They conjugate to proteins and function in a

‘ubiquitin-like’ manner (Kerscher et al., 2006) At least 10 different ULMs exits in mammals Of

these, SUMO (small-ubiquitin-related modifier) and RUB1 (related-to-ubiquitin 1) pathways have received the most intense scrutiny On the other hands, UDPs bear a sequence domain that

is similar to ubiquitin, but are not conjugated to proteins Instead, they serve as adaptor function, binding noncovalently to ubiquitin or ULMs via an “ubiquitin-interaction motif” or ubiquitin-associated (UBA) domain The first UDP identified was the Rpn10 subunit of the 19S proteasome, which allows the direct recognition of polyubiquitinated proteins by the 26S proteasome Other UDPs function as cofactors or adaptors involved in escorting a subset of

polyubiquitinated proteins to the 26S proteasome (Herrmann et al., 2007).

1.5 Introduction to NMR spectroscopy

In 1946, two research groups, Purcell (Massachusetts Institute of Technology) and Bloch(Stanford University) reported for the first time the nuclear magnetic resonance (NMR) phenomenon In 1953, Overhauser defined the concept of nuclear overhauser effect (NOEs), which formed the basis for the structural determination by NMR After three decades, the first protein structure was solved using NMR spectroscopy by Ernst and Wuthrich Since then, NMR

spectroscopy has become an alternative method to X-ray crystallography for the structural determination of small to medium sized proteins (less than 25 kDa) in aqueous or micellar solutions Notably, in 2006, Yang and his group ( National University of Singapore) has

developed a new strategy for structure determination of large proteins up to 60 kDa (Xu et al.,

2006) Recent progress in computational and experimental NMR techniques has improved the efficiency of biological research (Bax, 2003)

A simple one-dimensional (1D) proton experiment is the most basic spectrum in NMR spectroscopy that contains a vast amount of information It is able to show the folding status of the proteins, whether a protein is folded or unfolded This is very important for any further functional or structural studies on the protein because only folded proteins retain their functional

activities and the three dimensional structures (Rehm et al., 2002) Unfortunately, 1D spectra of

protein molecules that contain overlapping signals from many hydrogen atoms due to the differences in chemical shifts are often smaller than the resolving power of the experiments(Freeman and Anderson, 1962)

Two-dimensional (2D) experiments has been greatly improved in resolution The simplest and most powerful 2D experiment is the heteronuclear single-quantum coherence (HSQC), in which

15N-labeled protein samples are used The HSQC shows one peak for every proton bound directly to a nitrogen atom and thus exactly one signal per residue in the protein However, this

is not correct for Proline, Asparagine and Glutamine HSQC is devoid of Proline backbone amide but displays additional peak for side chain signals of Asparagine and Glutamine In

addtion, 2D NMR data is not sufficient to determine structure of proteins with large M.W due to

signal overlapping and faster signal relaxation (Kalic et al., 2000).

To solve the complex problems of 2D NMR, three-dimensional (3D) NMR spectroscopy is a logical approach to tremendously increase the effective resolution (Fesik and Zuiderweg, 1990) The heteronuclear 3D experiments involve in at least two types of nuclei The experiment can correlate various nuclei either through scalar coupling (COSY, TOCSY, HMQC and HSQC) or through space (NOESY) The 3D NMR experiments consist of two 2D experiments after another such as NOESY-HSQC, TOCSY-HSQC (Clore and Gronenborn, 1991)

The final result of the sequence-specific assignment of NMR signals is a list of distance constraints from a specific hydrogen atom in one residue to hydrogen atoms in the same or different residue This list immediately identifies the secondary structure elements of the protein molecule because both α helices and β sheets are very distinct sets of interactions of less than 5

Ao between hydrogen atoms in their amino acid residues It is therefore possible to calculate models of three dimensional structure of protein Eventually, a set of possible structures (usually more than 10) rather then a unique structure will be determined (Branden and Tooze, 1999)

1.6 Introduction to Isobaric Tags for Relative and Absolute Quantification

1.6.1 Proteomics and Mass spectrometry

Proteome of an organism is the set of proteins produced during its life Proteomics is the large scale study of proteins The goal of proteomics is a comprehensive, quantitative description of

protein expression and its changes under the influence of biological perturbations such as disease

or drug treatment (Anderson & Anderson, 1998) Proteomics can be seen as a mass-screening approach to molecular biology, which aims to document the overall distribution of proteins in cells, identify and characterize individual proteins changes, and ultimately elucidate the functional relationships (Twyman, 2004) There are many different proteomics branches, for example protein separation ( 1D gel, 2D gel, liquid chromatography-LC), protein modification, protein quantification ( ICATs, iTRAQ), and protein identification (mass spectrometry), etc

Mass spectrometry (MS) is an analytical tool used for measuring the molecular mass of a sample

A mass spectrometer consists of three fundamental parts: the ionisation source, the analyzer and the detector The sample is introduced into the ionization source to become ionized that is easier

to be manipulated than neutral molecules These ions are extracted into the analyzer, separated according to their mass m-to-charge ratios and detected by the detector The signal is sent to a data system and presented in the format of a spectrum There are several methods of ionization, the two most common methods are Electrospray Ionization (ESI) and Matrix Assisted Laser Desorption Ionization (MALDI) (http://www.astbury.leeds.ac.uk/facil/MStut/mstutorial.htm)

The MS applications are diverse in both routine work and research In the proteomics field, MS

is used to accurately measure the molecular mass of proteins and oligonucleotides to determine the sample’s purity, identify amino acid sequence, characterize oligonucleotides, detect post-translational modification; to monitor reactions of enzymes, chemical modifications, protein digestion; and to study protein folding, protein-ligand complex formation and macromolecular structure determination (http://www.astbury.leeds.ac.uk/facil/MStut/mstutorial.htm)

Tandem mass spectrometry or MS/MS is used to study the structural and sequence information from MS MS/MS also enables specific compounds to be detected in complex mixtures A tamdem mass spectrometer is a mass spectrometer that has more than one analyser, usually two (http://www.astbury.leeds.ac.uk/facil/MStut/mstutorial.htm)

1.6.2 Isobaric Tags for Relative and Absolute Quantification (iTRAQ)

iTRAQ is a stable isotope method for relative and absolute protein quantitation using mass spectrometry The core of this methodology is a multiplex set of isobaric reagents which are amine-specific and allow for the identification and quantitification of up to four different

samples simultaneously (Ross et al., 2004) In the 4-plex iTRAQ, the reagents designed as

isobaric tags consist of a charged reporter, a peptide reactive group and a neutral balance portion

to maintain an overall mass of 145 Da (Figure 3) The charge reporters, from 114 to 117 Da, are unique to each of the four reagents

These unique reagents, upon MS/MS fragmentation give rise to four unique reporter ions (m/z= 114-117) that are used to quantify their respective samples.The peptide reactive group was designed to react with all primary amines to label all peptides of different samples thus enhancing peptide coverage for any given protein

Each individual sample is reduced, alkylated and digested with trypsin The resulting peptide pools are respectively labeled with one member of multiplex set, then combined and subsequently analysed by LC-MS/MS (Liquid Chromatography/ Mass Spectrometry/ Mass Spectrometry) (Figure 4) Quantitation is achieved by comparison of the peak areas and the

resultant peak ratios for the four MS/MS reporter ions, which range from 114 to 117 Da (Zieske, 2006).

The advantages of this method are the increased confidence and higher quality data because all trypic peptides are labeled, there is no loss of information from samples involving post-translational modifications The new class of isobaric reagents enhance MS/MS fragmentation thus giving more confident identification than previously encounted (Zieske, 2006) Finally, the multiplex capacity of these reagents allows information for replication within certain LC-MS/MS experimental regimes, providing additional statistical validation within any given experiment Compare to other methods such as ICAT (Isotope Coded Affinity Tags) and DIGE (Different Gel Electrophoresis), iTRAQ is more sensitive for quantitation but more susceptible to errors in

precursor ion isolation (Gan et al., 2006) Furthermore, this multiplex protein quantitation requires more mass spect time because of the increased number of peptides (Pierce et al., 2007)

Recently, the novel 8 channel iTRAQ are available with eight specific reagents (Figure 5)

(Pierce et al., 2007) This new generation of iTRAQ reagents greatly enhances the reproducible

information, thus higher confidence identification data

Figure 3 Diagram of the iTRAQ reagent for 4-plex iTRAQ.

Each reagent consists of a charged reporter, a peptide reactive group and a neutral balance portion to maintain an overall mass of 145 Da The charge reporters, from 114 to 117 Da, are unique to each of the four reagents (Zieske, 2006)

Figure 4: The general iTRAQ workflow for four different samples

Each sample is reduced, alkylated, digested with trypsin, then combined and subsequently analysed by LC-MS/MS (Zieske, 2006)

Figure 5 : Diagram of iTRAQ reagents for 8-plex iTRAQ system

Each reagent consists of a charged reporter, a peptide reactive group and a neutral balance portion to maintain an overall mass of 305 Da The charge reporters, from 113 to 121 Da, are

unique to each of the eight reagents (Pierce et al., 2007).

1.7 Introduction to Morpholino oligonucleotides technology

1.7.2 Gene knock-down by Morpholino

1.7.2.1 What is Morpholino?

The word "morpholino" can occur in other chemical names, referring to chemicals containing a six-member morpholine ring This work discusses only the Morpholino antisense oligonucleotides

Morpholinos or morpholino antisense oligonucleotides or oligos are called MO in short MO is a gene knock-down agent which consists of short chains of about 25 morpholino subunits Each morpholino subunit contain a nucleotide base, a morpholine ring and a non-ionic phosphorodiamidate inter-subunit linkage (Table 2) (Summerton, 2007)

1.7.2.2 Mechanism of MO gene knock-down

Morpholinos act via a steric blockage mechanism (RNAse H-indepedent) and with their high mRNA binding affinity and exquisite specificity they yield reliable and predictable results They either can block translation initiation in the cytosol (by targeting the 5' UTR through the first 25 bases of coding sequence), modify pre-mRNA splicing in the nucleus (by targeting splice junctions) or block miRNA activity (Summerton, 2007)

1.7.2.3 Multiple Advantages of MO

Morpholinos appear to be completely stable in biological systems Oligomers, possessing the Morpholino phosphorodiamidate backbone, were evaluated for resistance to a variety of enzymes and biological fluids A 25-mer was incubated with nucleases, proteases, esterases, and serum, and the reaction mixtures were directly analyzed by MALDI-TOF mass spectrometry The 25-mer was completely resistant to 13 different hydrolases serum and plasma The excellent resistance of Morpholino phosphorodiamidates to enzymatic attack indicates their suitability for

in vivo use (Hudziak et al., 1996).

Relative to S-DNAs, Morpholinos have a much higher affinity for their complementary RNA sequences, and in fact Morpholinos bind RNA with a higher affinity than DNA binds to RNA

and much higher affinity than S-DNA for RNA (Summerton et al., 1999) Morpholinos have a

minimum inhibitory length (MIL) of about 14 to 15 bases This means that a Morpholino of thislength, or a longer Morpholino having at least a 14 to 15 contiguous base match to a

complementary RNA sequence, is effective to inhibit the expression of its targeted RNA, either via blockage of splicing of the initial RNA transcript in the nucleus or via blockage of translation

of the mature mRNA in the cytosol (Summerton, 2004)

Morpholinos show excellent solubility in aqueous solution (typically in excess of 100 mg/ml)due to their exceptional base stacking properties, in sharp contrast to other non-ionic structural types which are generally plagued by poor aqueous solubility (typically several hundred fold lower than for Morpholinos) (Summerton and Weller, 1997)

Morpholinos are free of the widespread off-target effect (non-antisense effects) and do not induce innate immune responses Probably because of their highly unnatural backbone structure and the lack of charge on the backbone, Morpholinos appear not to interact to any significant extent with proteins In addition, MOs exhibit no significant binding to macromolecular components of blood and serum The fact that Morpholinos are not degraded in biologicalsystems may also contribute to their lack of off-target effects This is because they have no opportunity to generate degradation products which might be toxic to cells (Summerton, 2007)

It can be said that, because of their freedom from off-target effects, exquisite sequence specificity, complete stability in biological system and highly predictable targeting, MO is an excellent approach for gene knock-down studies (Summerton, 2007)

Table 2: The structures of three major gene knock-down types: S-DNA, siRNA and Morpholino

(Summerton, 2007)

1.8 Objectives and significance of this project

The SGIV has been isolated from infected E tauvina, propagated and purified by a grouper

embryonic cell line (GEC) Physicochemical properties of the SGIV have also been determined Although much fundamental work at the molecular level has been carried out such as genome sequencing, proteomics studies and DNA mircoarray analysis of SGIV gene expression, verylittle work is done for the functional investigation of the unknown viral genes Therefore, it is difficult to elucidate the infection and replication mechanism of SGIV

The first objective of this project is to analyse the comparative sequence of viral ubiquitin-like proteins and to determine the structure of SGIV UBL Ubiquitin and Ubiquitin proteasome pathway have been known from early 1970s, and appeared as an unique and powerful system of eukaryotes Interestingly, UBL proteins have been found in some bacterium and viruses It is worthy to study the viral UBLs with the representative from SGIV The study could contribute to the understanding of function of viral UBL especially during virus infection and replication

The second objective is to investigate the GEC infected by SGIV using iTRAQ approach The iTRAQ experiment followed by LC/Tandem MS could provide valuable high confident data for the host and SGIV proteins upon virus infection, which should help to investigate host-virus interactions

The third objective is to characterize the functions of SGIV ORF18R, ORF140R and ORF135L

To study these novel genes, we have used the gene knock-down approach using Morpholino

2.1 Introduction

It was thought that Ub is an unique eukaryotic peptide until Guarino (1990) found a viral gene

encoding an ubiquitin-like protein (UBL) in Baculovirus Autographa californica

Nucleopolyhedrovirus (AcMNPV) Durner and Boger (1995) discovered ubiquitin in the

eubacterium Anabaena variablis Up to date, there are nine viruses, mostly double stranded DNA

genome, in different families that contain UBL The biological function of viral UBL proteins is still unknown

The recent review of Ub function and UPS by Ciechanover (2006) focuses on the regulation of cellular processes and the connections of aberration of UPS to human diseases and disorders However, the biological function of viral UBL protein is still unknown The extensive

investigation on viral UBL has been done by Guarino on Baculovirus Autographa californica

The investigators found that the viral ubiquitin is attached to the inner face of the virion envelope

by phospholipid anchor (Guarino et al., 1995) However, this UBL is not an essential

requirement for viral replication (Reilly and Guarino, 1996)

The entire SGIV genome was available, in which ORF102 encodes a putative viral UBL (Song et

al., 2004) and is an early gene (Chen et al., 2006) In this chapter, we have carried out a

comparative sequence analysis of viral UBLs and other proteins in the family of Iridoviridae

using bioinformatic tools In addition, , molecular cloning, protein expression, and preliminary characterization of SGIV UBL will be described The folding of SGIV UBL foldings and its structural determination by NMR will be discussed in detail

2.2 Methods

2.2.1 Protein-protein BLAST (Blastp)

The Basic Local Alignment Search Tool (BLAST) is a program for nucleotide or protein sequence similarity search developed at the National Center for Biotechnology Information(NCBI)

Protein- Protein BLAST (Blastp) takes protein sequences and compares them against the NCBI protein databases and calculates the statistical significance of matches Blastp finds the similar sequences in other organisms Therefore, it can be used to infer functional and evolutionary relationships between sequences as well as to help identify members of gene families Blastp can also provide the identity and function of query sequence or help to direct the experimental design to validate function of the protein sequence

http://www.ncbi.nlm.nih.gov/blast/Blast

2.2.2 Grouper cell lines and SGIV infection

Grouper cells should reach a 80% confluence of a monolayer in fresh culture medium before infection 1 mL of virus stock was inoculated onto the cell and the culture medium containing virus was harvested when the cytopatic effect was sufficient Appropriate medium containing SGIV was collected as seeds for further need and stored at -80 oC

2.2.3 Reverse Transcription PCR

The Reverse Transcription PCR was conducted as described in One-Step Reverse TranscriptionPCR kit (QIAGEN) protocol In reverse transcription step, cDNA was synthesized from total

RNA at 50○C for 30 min The reverse transcriptase was inactivated by heating step at 95○C for

15 min The amplification reactions were carried out for 30 cycles under conditions of 95○C for 30s, 62○C for 30s and 72○C for 1min per cycle The Reverse Transcription PCR products werethen analyzed with 1.2% agarose gel

2.2.4 Purification of SGIV

The grouper cells containing SGIV and growth medium was centrifuged at 12, 000 × g for 30 min at 4°C The resulting pellet was resuspended with the culture medium and ultrasonicated The suspension containing the lysate, viral particles and cellular debris was then centrifuged at 4,000 × g for 20 min at 4°C The supernatant was layered onto a cushion of 35% sucrose andcentrifuged at 210,000 × g for 1 h at 4°C The pellet was resuspended with the TN buffer (see appendix) and overlaid with 30%, 40%, 50% and 60% (m/v) sucrose gradients and centrifuged at 210,000 × g for another 1 h at 4°C Viral bands, present in 50% sucrose, were aspirated, sonicated briefly, and reloaded onto sucrose gradients The lowest band (50%) was individually aspirated and spun down at 100,000 × g The virus particles were collected for genomic extraction experiment

2.2.5 E coli strains and competent cells preparation

E coli strains

E coli strains used in this study were DH5α (Invitrogen) for cloning and BL-21 Star (DE3)

(Invitrogen) for protein expression

Preparation of competent cells DH5α and BL-21

Frozen glycerol stock of E.coli cells was streaked out and grown up on an LB agar plate ( see

Appendix) in a 37 oC incubator for overnight One single colony was picked up with an inoculation loop and cultured in 3 mL of LB medium (see Appendix) in a 37 oC shaker for overnight 1 mL from this overnight culture was transferred into 100 mL LB medium and cultured until O.D550 ~ 0.48 The cell was put on ice for 15 min and pelleted by centrifugation at

5000 rpm for 5 min The cell pellet was resupended in 40 mL of cold TfbI buffer (see Appendix) and iced for 15 min, spun down again, resuspended in 4 mL of cold TfbII buffer (see Appendix) and kept on ice for another 15 min The competent cells were used immediately or frozen by liquid nitrogen and stored at -80 oC The cells should be thawed on ice just before use in a transformation experiment

2.2.6 Plasmid

Plasmid

Expression plasmid used in this study is vector pGEX-6P-1 (Amersham) (see appendix)

Plasmid applification and purification

Plasmids were transformed into E.coli competent cell DH5α (see 3.2.4.4) and amplification by inoculating a single colony in 3 mL of LB 100 μg/mL Amp medium at 37 oC for overnight The plasmid purification was carried out using QIAprep Mini kit

2.2.7 Construction of expression vector

Amplification of SGIV ORR102L

The full length DNA coding sequence (residue 1- 77) of SGIV UBL was amplified using Platium TagDNA polymerase High Fidelity (Invitrogen) from the DNA template was SGIV genomic DNA

Gene specific primers were 5’CGCGGATCCATGCAGATCTTTGTGAAAACTCTT 3’ and 3’CCGGAATTCTTACACTCCTCCTCTCAATCGC 5’ which are adapted with BamHI and EcoRI enzyme restriction site The PCR reaction was performed by thermal cycler under manufacturer’s instruction The PCR products were purified using QIAquick PCR purification kit

Enzyme digestion, dephosphorylation and purification

The purified PCR product of ORF102L and the plasmid pGEX-6P1 were digested by BamHI and EcoRI restriction enzymes (NEB) A 20 μL enzyme digestion reaction consists of 2 μL of 10X BSA buffer, 0.2 μL of appropriate reaction buffer, 1 μL of each restriction enzyme, 1 μg of DNA and ddH2O added The mixtures was incubated at 37 oC for 2 hours Digested ORF102L was purified using QIAquick PCR purification kit

The digested vector pGEX-6P were dephosphorylated by treating with 5 units of calf intestinal phosphatase ( NEB) at 37 oC for 1 hour All reactions were terminated by incubation at 85 oC for

20 mins Desired digested vectors were then excised from the agarose gel and purified using QIAquick gel extraction kit

Ligation and transformation

A ligation reaction contained 2 μL of 10X T4 ligase buffer, 1 μL of T4 ligase (20000 U/ μL), dephosphorylated PCR products and pGEX-6P-1 vector at ratio of 1: 3 and ddH2O added to a final volume of 20 μL The mixture was incubated at room temperature for 30 min to 2 hours and ready to be transformed into competent cells

100 μL of competent cells DH5α were thawed on ice for 20 min After heat shock at 42 oC for 60 sec, the cells were kept on ice for an additional 2 min 800 μL LB medium was added to the cells The mixture was gently inverted and incubated in a 37 oC shaker for 45 min The cells were then plated onto LB 100 μg/mL Amp agar plate and incubated at 37 oC for overnight

Screening and plasmid miniprep

Clones grew on selected plates were picked up and inoculated in 3 ml LB 100 μg/mL Amp medium at 37 oC for overnight

The inserts of ORF102L were amplified using Tag PCR kit (NEB) PCR was carried out as manufacturer’s instruction The PCR products were separated on a 1.2% agarose gel The positive clones, which showed the specific band with correct size on the gel, were selected for plasmid preparation using QIAprep spin mini prep kit

Cycle Sequencing reaction

Cycle sequencing reaction was performed based on the standard protocol supplied by Applied Biosystems with minor modifications Concentration of the recombinant plasmid has been determined The sense and anti-sense sequencing primers are 5'-

respectively A 20 μL cycle sequencing reaction contained 4 μL of 5X sequencing buffer, 3.2 pmol of primer, 2 μL of Terminator Ready Reaction Mix (BigDyeTM v3.1), 300 – 400 ng recombinant plasmids and ddH2O added The cycle sequencing PCR started with (i) initial denature at 95 oC for 2 mins; (ii) 27 cycles of 96 oC for 30 sec, 50 oC for 15 sec and 60 oC for 4 mins; (iii) final extension at 72 oC for 15 mins

The products of the cycle sequencing PCR were separatedly transformed to 15 ml eppendorf tubes and precipitated for 15 min standing at room temperature with 80 μL of ethanol/ sodium acetate solution (see appendix) DNA were pelleted after spun down at maximal speed for 20 min To remove any trace of uncorporated dye and salts, DNA pellets were washed with 500 μL

of 70% ethanol, kept for 15 min at room temperature, and spun down again at maximal speed for 5 min The supernatant was decanted and the washing step was repeated one more time The tubes were inverted and dried overnight at room temperature

Sequence determination

Each cycle sequencing product was dissolved in 12 μL Hi-Di formamide and mixed with quick vortex The tubes containing dissolved DNA fragments were transferred to a 95- well sample plate for PCR plate and covered with a transparent stick tape Heated at 95oC for 2 mins, the plate was placed into a 96- well rack and quickly centrifuged to bring the samples to the bottom

of the wells Prior to sequencing, the plate was placed on ice for 4 oC The sequencing was

carried out with ABI PRISMTM 3100 Genetic Analyzer

2.2.8 Protein expression and purification

Protein expression

The full length DNA coding sequence of SGIV UBL was amplified by PCR from the purified SGIV genomic DNA and cloned into vector pGEX-6P-1 The sequence was verified by DNA

sequencing The construct was transformed into E.coli BL-21 (DE3) for protein expression.

A single colony was inoculated in 10 mL of LB containing 100 μg/mL Amp at 37 oC for overnight with shaking (220 rmp/min) The overnight culture was transferred into 1 L of LB containing 100 μg/mL Amp, cultured at 37 oC for 3-4 hours until the O.D600~ 0.6- 0.8 The protein expression of SGIV UBL was induced by 0.2 mM IPTG (see appendix) After 16 hours (overnight) culture at 18 oC, the cells were harvested by centrifugation at 6000 rpm for 30 min and kept on ice for immediate purification or stored at – 20 oC or – 80 oC

Protein purification

SGIV UBL was purified under native conditions by Glutathione Sepharose 4B chromatography following the manufacturer’s protocol (Amersham Biosciences) The cells were lysed by sonication followed by centrifugation at 18, 000 rpm at 4 oC for 1 hour The supernatant was filtered through 0.22 μm membrane and loaded onto Glutathione Sepharose 4B beads ,which had been equilibrated with the lysis buffer After incubation at 4 oC for 2 hours, the SGIV UBL-bound resin was extensively washed with at least 30 volumes of ice-cold 1X PBS GST tag was removed by on-column cleavage using Precission enzyme (Amersham), 40 μL of enzyme was added for 1 mL of Glutathion beads The GST-cleaved SGIV UBL was further purified using

SuperdexTM30 column (Amersham) The purified protein was collected in buffer containing 20

mM Tris pH 7.5, 150 mM NaCl, then concentrated to 10 mg/mL, quick- frozen by liquid nitrogen and stored in aliquots at – 80 oC.

2.2.9 SDS- PAGE

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was performed following Laemmli’s method (Laemmli, 1970) Discontinuous SDS-PAGE with a stacking gel ( 0.125 M Tris-HCl pH 6.8, 0.1 % SDS and 5 % acrylamide/Bis solution) and separating gel (0.375 M Tris-HCl pH 8.8, 0.1 % SDS and 15 % acrylamide/Bis solution) was performed in 1X SDS running buffer (20 mM Tris Base, 200 mM glycine, 0.1 % SDS) at 70 volts for 30 min followed by 200 volts After running, the gel was stained in Coomassive staining buffer (20 % methanol, 10 % acetic acid and 0.1 % Coomassive Brilliant Blue R-250) for 30-60 min, and then destained with a destaining solution (20 % methanol, 10 % acetic acid)

2.2.10 Mass Spectrometry

Protein was desalted using desalting column (Invitrogen) and subjected to MALDI-TOF mass spectrometry (Protein and Proteomics Centre, Deparment of Biological Sciences, National University of Singapore) to verify the molecular mass of SGIV UBL

2.2.11 Western blot

The protein samples were separated on 10% to 15% SDS-PAGE gel and transfer onto a nitrocellulose membrane (Amersham) in blotting buffer (3.205g Tris base, 14.25g glycine and 200ml methanol per liter) at 30 Voltage overnight The blotted membrane was then blocked in

3% BSA in TBST (20mM Tris pH 7.4, 154 mM NaCl, 0.1% Tween 20) for 1hr, washed 3 X 10 min with TBST The membranes were incubated with the primary antibody for 1 hour, washed with 3X10 min TBST, treated with the secondary antibody for 1hour, washed 3 X 10 min with TBST After that, the membrane was immersed in mixture of peroxide solution and luminol enhancer solution (Pierce) for 5 min and ready for film exposure and image development.

2.2.12 In vitro ubiquitination assay

The ubiquitination assay kit was purchased from Boston Biochem The conjugation kit (Catalog

no K960) consists of ubiquitin solution, ATP- containing energy buffer and purified conjugation enzymes E1, E2s and E3s from HeLa cell cytoplasmic extract fraction II in buffer 50mM HEPES, pH 8.0, 0.5mM DTT This fraction also contains de-ubiquitin enzymes and ubquitin C-terminal hydrolases (UCH) enzyme Addition of Ubiquitin aldehyde (Catalog no U-201) is necessary to block the hydrolysis of poly-ubiquitin chains on subtrate proteins in vitro and thus enhances poly-ubiquitin chain accumulation Substrate in this experiment is lysozyme (Boston Biochem, Catalog no SP-100)

Ubiquitin conjugation of SGIV ubiquitin-like protein was performed according to the standard protocol provided by supplier but with some slight modifications Briefly, 40ul of conjugation enzyme components, 7ul of 10X energy solution, , 5uM of Ubiquitin aldehyde and 150uM of purified recombinant (GST-cleaved) SGIV ubiquitin like protein were mixed and topped up to final volume of 69ul with 50mM HEPES buffer (pH 7.6) The positive control assay was added with 150uM of kit supplied ubiquitin In the two negative controls, ubiquitin was replaced by water and ATP was absent from the ubiquitination reaction

The mixtures were incubated for 5 mins at 37○C to allow for inhibition of Ubiquitin C-terminal hydrolyses The conjugation reaction was initiated by the addition of 1ul of 0.05mg/ml lysozyme substrate The assays were incubated for 4 hours at 37○C then quenched with 10mM EDTA

2.2.13 Protein sample preparation for NMR experiment

Isotopic materials: (15NH4)2SO4 and 13C Glucose for nitrogen and glucose source respectively were all purchased from Cambridge Isotope Laboratories Inc

E coli BL-21 cells containing recombinant plasmids of pGEX-6P-1/SGIV ORF102L were

grown on a LB agar plate with Ampicillin A single colony was inoculated in 100 μL LB 100 μg/ml Ampicilline at 37 oC for 8 to 10 hours 50 μL of this culture was then inoculated in 100 ml M9 medium at 37 oC for overnight All 100 ml of this overnight culture was transferred to 1 L of M9 media and cultured until the OD600~ 0.8 The cultured was induced with 0.2 mM ITPG at 18

oC for overnight The processes of protein purification was similar as described in Chapter 3 (3.2.5.2)

The purified protein was concentrated to 1.2 mM in 20 mM sodium dihydrogen phosphate (NaH2PO4), pH 5.2 (90% H2O/ 10% D2O or 100% D2O ) for NMR experiments

2.2.14 NMR experiments

1H, 15N, and 13C NMR data collection was obtained by a 800 MHz Avance spectrometer (Bruker ) or a 500 MHz Avance spectrometer (Bruker) at 298K The NMR experiments for backbone assignment included 15N-edited heteronuclear single quantum coherence spectroscopy (HSQC), HNCACB and CBCA (CO)NH