Isolation and characterization of allergens from curvularia lunata 3

CHAPTER 3: CLONING, EXPRESSION AND IMMUNOLOGICAL CHARACTERIZATION OF THE RECOMBINANT Curvularia lunata PUTATIVE ALLERGENS... 3.1 INTRODUCTION In order to further understand and establ

CHAPTER 3:

CLONING, EXPRESSION AND IMMUNOLOGICAL

CHARACTERIZATION OF THE RECOMBINANT

Curvularia lunata PUTATIVE ALLERGENS

3.1 INTRODUCTION

In order to further understand and establish the allergenicity of the various putative

allergens of Curvularia lunata, immunological characterization of the putative

allergens was performed The first and foremost step towards the characterization of these allergens involved generating the recombinant proteins for these putative allergens As some of the ESTs already had a full-length putative allergen (as per BLAST X alignment), the sequences were sub-cloned and expressed For the ESTs which possessed truncated allergen sequences (generally on the 5` end), the rapid Amplification of cDNA Ends (RACE) strategy was used These putative allergen genes were cloned, expressed and a purified recombinant protein was obtained These proteins were then further used for characterization to confirm the allergenicity of these recombinants

3.2.1 Cloning and Expression of the isolated putative C lunata allergens

3.2.1.1 General analysis of the C lunata putative allergens

Various putatively allergenic C lunata sequences as isolated earlier were further

analyzed in order to ascertain whether the obtained sequences (from the ESTs) were the full-length open reading frames or truncated A total of 14 different types of

allergens were obtained Out of these, 7 contained full-length open reading frames The full-length of the open reading frames was confirmed by comparing with known allergens using BLASTX alignments and also by checking for the Start/Stop codons The initiation sites were predicted by checking for the Kozak consensus sequence

(Kozak, 1984) For the rest of the sequences which were not full-length, RACE

strategy was utilized

3.2.1.2 RACE amplification of the truncated putative allergen sequences

For the remaining 7 truncated sequences, SMARTTM RACE cDNA amplification kit (BD Bioscience) was used as per the manufacturer’s protocol An overview of the RACE procedure is given in Figure 3.1 The figure is taken from the SMART RACE cDNA amplification kit (K1811-1) user manual Finally, all the DNA sequence of all the sequences was confirmed three times in order to get the exact sequence

The sequences which were supposed to be used for further characterization were submitted to NCBI and were also given allergen names as per the International Union

of Immunological Societies (IUIS) – Allergen Nomenclature Subcommitee nomenclature system Since Cur l 1 and Cur l 2 are already published, the allergens were named accordingly, i.e Cur l 3 and so on

Cloning/expression of the allergens was done using commercially available bacterial expression kits due to their diverse, rapid and inexpensive nature as well as the ease of having a broad selection of fusion proteins, affinity purification tags Moreover, protein yields for the bacterial expression systems are higher as compared to other expression systems available The pET expression system (Novagen) was chosen due

to its higher protein expression yields, specificity, inducibility, increased solubility and overall stability of the proteins Moreover, there is a hexa-histidine tag which can be used for Nickel based affinity chromatographic purification (Figure 3.2)

Figure 3.1: Overview of the SMART RACE procedure [Taken from SMART

RACE cDNA amplification kit (K1811-1) user manual]

Total RNA was used for the RACE amplification of the Curvularia lunata allergens

Moreover, this vector involves ligation independent cloning (LIC) technology which bypasses the traditional digestion/ligation steps A simple annealing of the inserts (with overhangs generated via PCR) to the vector is used Furthermore, enterokinase (Ek) can be used to remove the fusion protein Hence the vector is called pET32

Ek/LIC vector

Ligation independent cloning was carried out using the pET expression system (Novagen) as per the manufacturer’s protocol Briefly, total RNA was reversed transcribed with the iScript cDNA Synthesis Kit (Bio-Rad Laboratories) Signal peptide sequence if present was removed from the full-length allergen sequence, Prediction of the signal peptide cleavage site was based on the (-3-1) rule (von Heijne,

1986) and was achieved using the Signal P software version 1.1 (Nielsen et al., 1997)

Primers for polymerase chain reaction (PCR) amplification were designed according to the 3’ and 5’ ends of the respective open reading frames Each primer pair however had a 5’- GAC GAC GAC AAG ATX-3’ and 5’-GAG GAG AAG CCC GGT-3’ overhangs respectively at the sense and anti-sense ends, rendering them compatible for pET32a vector annealing The list of specific primers used is given in Table 3.1

PCR amplification was performed using Expand Long Template PCR System (Roche Diagnostics) possessing proofreading activity A 50µl reaction consisted of 0.5µl of each primer (100µM), 5µl of Expand Long Template Buffer 1, 2µl of dNTP (10µM), 3µl of cDNA and 1µl of Expand Long Template Enzyme mix containing the thermostable DNA polymerases Taq and Tgo Thermocycling conditions consisted of

an initial denaturation at 94ºC for 10 min, followed by 30-35 cycles starting with 94ºC for 10s, 50-53ºC for 30s and 68°C for 1 min if the insert size is less than 1kb, and an

Figure 3.2: Schematic diagram of the pET32Ek/LIC vector showing locations of various solubility as well as affinity tags (Taken from www.emdbiosciences.com)

Figure 3.3: Strategy used for directional cloning using pET32Ek/LIC vector (Taken from www.emdbiosciences.com)

Table 3.1: Sequences of the primers used for the cloning of C lunata allergen

sequences into pET32Ek/LIC vector

The sequence of the forward primer (F) is shown first, followed by that of the reverse primer (R)

Each forward primer has a 5’- GACGACGACAAGATX-3’ and each reverse primer has 5’-GAGGAGAAGCCCGGT-3’ overhangs on the 5` as well as 3` ends respectively for proper annealing with the pET32/EkLIC vector

R: 5`- GAGGAGAAGCCCGGTCTACAACTCGTCGTGGTCCTGGG - 3` F: 5`- GACGACGACAAGATCCACGAGGCTGAGAACGCCGT - 3`

Cur l 7

R: 5`- GAGGAGAAGCCCGGTCTACAACTCGTCGTGGTCCTGGG - 3` F: 5’- GACGACGACAAGATGCGCTCGCTCGGCCAG - 3`

additional 1min for every 1kb increase in insert size The final extension was done at 68ºC for 4-7 min, depending on insert size Agarose gel electrophoresis was further carried out on 1% agarose in tris-acetate-EDTA (TAE) buffer (40mM Tris-acetate, 1mM EDTA, pH 8) The required product was recovered after gel electrophoresis with QIAquick Gel Extraction Kit (QIAGEN), as per manufacturer’s instructions The GeneRuler™ 1kb DNA Ladder (MBI Fermentas) was loaded as a standard for comparison All DNA quantification was done using the SmartSpec™ Plus Spectrophotometer (Bio-Rad Laboratories) To confirm the identity of the amplicon, DNA sequencing was performed as explained earlier

Single stranded overhangs complementary to the pET32 Ek/LIC vector were generated

on the extended specific insert by the 3´→ 5´ exonuclease activity of T4 DNA polymerase (Novagen) in the presence of dATP (Promega) The exonuclease removes nucleotides from the PCR product obtained from the previous section until it encounters an adenosine residue, after which the exonuclease activity is counteracted

by the 3
5´ polymerase activity of the same enzyme (Figure 3.3) For the T4 DNA polymerase treatment, the amount (µl) of the purified PCR product to be added was calculated using the formulae: [{(Number of base pairs of the insert x 650)/5000} x {1/2(concentration of the DNA in µg/ml)}] This calculated amount of the product was added to a sterile tube containing 10x T4 DNA Polymerase buffer, 0.5µl of dATP (50mM), 0.2µl of T4 DNA Polymerase (2.5 units/ml) and topped up to 10µl with nuclease-free water The tube was then incubated at 22°C for 30min, followed by 75°C for 20 min

The Ek/LIC vector containing the specific non-complementary single-stranded overhangs (allowing directional cloning without restriction enzymes) was annealed to the previously generated T4 polymerase treated product Briefly, 0.5µl of the vector to 1µl of the product was incubated for 5 min at 22°C followed by the addition of 0.5µl

of 25mM EDTA The annealing was allowed to occur at room temperature for 1-2h, and the products were stored at 4°C until further use

The annealed insert-vector plasmids (1 µl) were then transformed, using a heat shock treatment (40 min on ice, 90s at 42°C, 2 min on ice) into 50µl of DH5α competent cells This mix was then incubated with 900µl of LB broth at 37°C for 45 min with constant shaking at 200 rpm After incubation, the broth was centrifuged at 13,000 rpm for 15s and 900µl of LB broth was removed and the remaining broth was resuspended and plated on LB agar containing ampicillin (100µg/ml) plates Plates were then incubated for 16 h at 37°C and the transformants were selected

The transformant colonies were then picked and suspended in 6µl of sterile water, out

of which 1µl was used as the template in the PCR A ten-reaction master mix consisted

of 10µl of 10X Buffer, 2µl of primers specific for the Ek/LIC Vector, 2µl of dNTP (10µM), 6µl of 25mM MgCl2 and 1µl of Taq Polymerase was topped up to 90µl with autoclaved water The cycling conditions were set at 95ºC for 5 min, followed by 35 cycles of denaturation (94ºC for 30s), annealing (50ºC for 30s) and extension (72ºC for 1min if the insert size was less than 1kb, and an additional 1 min for every 1kb increase in size) Final extension was carried out at 72ºC for 4-7 min After PCR, agarose gel electrophoresis was performed to confirm the size of the insert in the transformants

The transformant colonies showing proper sized insert was inoculated overnight in LB broth containing 100µg/ml of ampicillin and were incubated at 37°C at 230 rpm overnight Plasmid extraction was then carried out using the QIAprep Spin Miniprep Kit (QIAGEN) and sequenced to confirm the inserts

Upon confirmation of the size and sequence of the allergen inserts, the extracted

plasmids were transformed into BL21 E.coli cells (same as that of DH5α)

Transformants were checked for size and glycerol stocks of the transformants with correct insert were prepared and stored in -80°C for future use

Transformant colonies having correct allergen insert were inoculated into 5ml of LB broth containing 100µg/ml of ampicillin and incubated at 37°C at 230 rpm overnight From the grown starter culture, 2ml was added to 200ml of LB broth containing ampicillin (100µg/ml) and incubated at 230 rpm for 2.5 h at 37°C Protein expression was induced with 200µl of 0.5M isopropyl 1-thio-β-Dgalactoside (IPTG) The culture was then incubated at 230 rpm for either 4 h at 37°C or overnight at 22°C After incubation, the supernatant was discarded after centrifugation at 3800 rpm at 4°C for

10 min and the cell pellet was resuspended with 20ml of binding buffer (40mM imidazole, 4M NaCl, 160mM Tris-HCl, pH7.9) containing 6M of urea The cells were lysed by sonication and the debris was removed by centrifugation at 13,000rpm for 15 min The expressed recombinant proteins using pET32-Ek/LIC possessed an N-terminal fusion protein that contained three tags [thioredoxin tag (109 aa), His•Tag (6 aa) and S•Tag (15 aa)], adding approximately 17.3 kDa to the existing molecular mass

of the recombinant protein

3.2.1.6 Purification of the putative allergens

As the amount of the expressed protein was generally 10-fold higher in the pellet compared to the supernatant, 6M urea was used to solubilize the proteins The

supernatant after sonication was purified by affinity column chromatography, as

described in the pET System Manual (Novagen), using Ni-NTA His•Bind Resin

(Novagen) and Ni-NTA columns (Bio-Rad Laboratories, Inc) Briefly, the supernatant was incubated overnight with Ni-NTA resin (precharged with 40 mM NiSO4) Protein purification and elution of his-tagged proteins were achieved using an imidazole gradient (40 mM- 4M) Quantification of the protein was done on the SmartSpec™ Plus Spectrophotometer (Bio-Rad Laboratories), with Bio-Rad Protein Assay (Bio-Rad Laboratories), with bovine serum albumin (BSA) as a standard as explained earlier The quality of the expressed recombinant proteins was analyzed by denaturing SDS-PAGE (12%) Apart from the deduced size of the protein (from the calculated deduced molecular weight), about 17.4 kDa of the N-terminal fusion protein (due to the

thioredoxin, his and S tags with some linking sequences) as explained earlier was also present A few kDa differences between the calculated and the predicted molecular weight of the recombinant proteins is commonly observed These variations might be caused due to unusually high or low amounts of charged amino acids which cause

anomalous migration on the SDS PAGE (Takano et al., 1988) Generally, negatively

charged proteins tend to migrate faster towards the positive end whilst the positively charged proteins tend to move slower than the average speed The proteins with the correct sized distinct band were used for further experiments

3.2.2 Confirmation of allergenicity for the generated recombinants

3.2.2.1 Patient Sera

All the C lunata recombinant proteins (as well as C lunata total extract) were tested

on various populations in order to confer allergenicity to the putative allergens The populations were selected based on geographical location of the patients as well as atopy to specific allergen types All the experiments were performed as blind without any prior information on the atopy of the populations Detailed information regarding patients was not disclosed by the collaborators because of the patients` consent

First of all, the putative allergens were tested on the local population For this study, a total of 152 fungal atopic Singaporean patients` sera were tested These patients were prescreened by skin-prick testing (SPT) as well as intra-dermal testing (IDT) using

crude extracts of Aspergillus fumigatus, Alternaria alternata, Candida albicans and Cladosporium herbarum for allergenicity Total 76 patients (57 IDT positive, 10 SPT

positive and 9 SPT/IDT positive) and 76 controls (SPT/IDT negative) were used

Further, to test whether C lunata allergens showed reactions to the patients from other

populations of the world (as well as differential atopy to various allergen types) of the world, IgE binding studies over various populations were initiated The first study involved screening of atopic (asthma or rhinitis positive) dust-mite reactive Italian population A total of 171 (90 females and 81males) patients` sera were tested Out of

171 sera tested, eleven (6 female and 5 male) sera were control sera Average age of the patients tested was 22 years (26 years for females and 19 years for males)

In the second study, asthmatic as well as control sera from Colombian population were used (Courtesy: Dr Louis Carabolla, Cartagena, COLOMBIA) A total of 128 (118

asthmatic as well as 10 control) sera were used for the following study

A third study was conducted over a small group of atopic Indian patients (Courtesy:

Dr A.B Singh, Institute of Genomics & Integrative Biology, New Delhi) showing positive reactions to fungi and house dust mite extracts (on SPT) A total of 17 patients` (3 dust mite/fungal positive, 6 dust mite positive and 8 fungal positive) sera were used

3.2.2.2 Total protein extraction of Curvularia lunata

As described earlier, Curvularia lunata was cultured, harvested and lyophilized The

lyophilized fungus (100mg – 150mg) was grounded to powder with liquid nitrogen and then resuspended in 2ml of 1x PBS (16g NaCl, 0.4g KCl, 2.88g Na2HPO4.2H2O, and 8g KH2PO4) After 2h incubation at 4°C, the cell debris was removed by centrifugation at 4,500rpm for 15min The supernatant containing the protein was collected and stored at -20°C Quantification was done as indicated earlier Working stock of the protein extract was stored at 4°C in order to protect them from exposure to moisture and degradation process Although storage at -20°C may be a better alternative, the repeated freeze-thawing would have encouraged protein degradation Hence, only stocks meant for long-term storage were kept at -20°C

3.2.2.3 Standardization of the proteins for Dot-blot immunoassay

Based on the quantification done on the SmartSpec™ Plus Spectrophotometer Rad Laboratories, Inc), the proteins were diluted to 0.25mg/ml Diluted proteins were then filled in a 384-well plate Around 125ng of each protein was then dotted on to a nitrocellulose membrane (Bio-Rad Laboratories) using the VP 386 Replicator (VP-Scientific) and allowed to dry overnight The membrane was then stained with amido

(Bio-black (0.1% amido (Bio-black, 40% methanol, 1% acetic acid) for 3min, washed twice with water for 3min each, and destained with 25% 2-propanol and 10% acetic acid The membrane was analysed manually for uniformity of the colour intensity which indicates similar protein quantity BSA, diluted to 0.25mg/ml, was used as a control The protein concentrations were then adjusted accordingly so as to get all the dots of same intensity

3.2.2.4 Dot-blot Immunoassay

As discussed earlier, around 125ng of each protein was dotted onto a nitrocellulose membrane The membranes were then blocked with cold 0.1% PBS-T (0.1% (v/v) Tween 20) for an hour followed by three washes of 15 min, 7 min and 7 min duration each with cold 0.05% PBS-T (0.05% (v/v) Tween 20) Following blocking, individual membranes were incubated separately with 150uL of sera (diluted 1:1 (v/v) in PBS) overnight at 4°C After removal of the sera, the membranes were washed as before and incubated with 500uL of alkaline phosphatase-conjugated goat anti-human IgE (Sigma) (diluted 1:1000 (v/v) in 0.05% PBS-T) at room temperature for 2.5h followed

by the three washes Detection of the bond anti-human IgE was achieved by the addition of 1.5ml of the color substrate [33µl of NBT (50 mg/ml nitroblue tetrazolium salt in 70% (v/v) dimethylformamide) (Promega) and 16.5µl of BCIP (50 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate in 100% dimethylformamide) (Promega) in 5ml

of alkaline phosphatase buffer [100 mM Tris-HCl (pH 9.0), 150 mM NaCl, 1 mM MgCl2] The color development process was allowed to occur at room temperature for about 1h following which the reaction was quenched by rinsing the membranes with distilled water

Steps were taken to ensure that the amount of proteins transferred to the membranes were consistent, which would then allow comparison in the later stages Two conditions were strictly monitored Firstly, the replicator was used in such a way that equal amounts of proteins were transferred each time, both within and between the membranes and secondly, the proteins were maintained at equal concentrations The first factor was ensured by first dotting the membranes with 0.25mg/mL of BSA The membranes were then stained and analyzed with amido black, which indicates the amount of protein transferred to the membrane This step was repeated until the standard deviation and covariance of the intensity of the stain within and between membranes stayed consistently below 5% The concentrations of the proteins were confirmed by staining the test proteins on the membranes with amido black The concentrations of proteins which differed in color intensities were adjusted accordingly, until all the proteins gave similar intensity

The protein samples were transferred onto the membranes in duplicates Each membrane contained several controls Negative controls like PBS (used as a control for fungal extracts), elution buffer used in the purification of the recombinants as well

as the pET32 fusion protein (with all the three earlier mentioned tags) were used Serial dilutions of human IgE were used as a positive control (Dilutions from 150 IU till 9.375 IU) The sera were screened in batches Each batch was screened with at least 2 blanks, in which the membranes were incubated with 0.1% PBS-T instead of

patient sera Apart from C lunata recombinant proteins and C lunata total extract, extracts of Aspergillus fumigatus as well as Penicillium citrinum were also used As

P.citrinum and A.fumigatus are known allergenic fungi, they were used in order to compare the reaction intensities of C lunata recombinants as well as crude extract

3.2.2.5 Analyses of the Dot-blot Immunoassays

The developed membranes were blotted dry, scanned and the color intensity was analyzed using MicroImageTM for WindowsTM v4.0 (Olympus)

The readings obtained by the software were further processed in several steps Firstly, the difference between 255 (the maximum value of a digital color image pixel), and the average of the duplicate readings was found The allergen background was calculated as the difference between the readings of the blank membrane’s test sample and that of the tag (empty vector protein with the thioredoxin tag; as thioredoxin itself

is a known allergen) to remove reactions to the fusion protein (if any) The serum background referred to the reading of the working membrane’s buffer in which the test sample was diluted The final reading was taken as the difference of the reading of the test sample and the sum of both; the allergen and the serum background Classification

of the positive and negative sera was done based on the standard deviation (SD) values Any readings below 2SD of the control were considered as negative reactions This roughly corresponds to the reaction intensity of 20

3.3.1 Cloning and Expression of the isolated putative C lunata allergens

3.3.1.1 RACE amplification of the truncated putative allergen sequences

Out of the 14 different allergen types, 7 allergens were already found to be present as full-length in the ESTs For the remaining 7 truncated sequences, RACE amplification