Mechanisms in dendrite pruning of drosophila dendritic arborization neurons

32 3.3 Mical regulates dendrite pruning of dendritic arborization neurons in Drosophila .... Among various types of neuronal remodeling, selective removal of dendrite branches, so called

MECHANISMS UNDERLYING DENDRITE PRUNING OF

DROSOPHILA DENDRITIC ARBORIZATION NEURONS

GU YING

(B Sci., Sichuan University)

A THESIS SUBMITTED FOR THE DEGREE

OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES

NATIONAL UNIVERSITY OF SINGAPORE

2009

To my parents and grandparents

Acknowledgement

I am heartily thankful to my supervisor, Dr Fengwei Yu, whose encouragement, guidance and support enabled me to explore any possibilities in my research work His great enthusiasm in science is always stimulating to me I am also grateful to Assoc Prof Boon Chuan Low for his willingness to co-supervise me from the very beginning of my study and support on my work

I also would like to thank my graduate committee members, Prof William Chia,

Dr Suresh Jeuthasan, Dr Sudipto Roy and Dr Yih Cherng Liou for their support and

advice

I gratefully thank all people in Yu’s group for providing a motivating, enthusiastic and critical atmosphere for my work, especially Daniel Kirilly for his willingness to share his bright thoughts with me and assistance in various ways

Many thanks also go to Dr Hongyan Wang and her group for their discussion, in particular to Hongyan, Nick Bogard and Wei Leong Chew for their constructive comments on this thesis

I owe my deepest gratitude to Dr Arash Bashirullah (UW-Madison), Prof Alex Kolodkin (HHMI, Johns Hopkins University) and a broader fly community for their generosity in sharing reagents and flies

My gratitude also goes to the supporting staffs and my friends at Temasek Life Sciences Laboratory for their sincere help And lastly, my parents and grandparents, for their love

Table of Contents

Acknowledgement iii

Table of Contents iv

Summary vii

List of Publications viii

List of Tables ix

List of Figures x

List of Abbreviations xii

Chapter One: Literature Review 1

1.1 Introduction 1

1.2 Neuronal pruning 2

1.2.1 Developmental pruning in vertebrates 3

1.2.1.1 Trophic-factor dependent axon pruning 3

1.2.1.2 Axon guidance molecules in developmental axon pruning 4

1.2.1.3 Developmental dendrite pruning in vertebrates 5

1.2.2 Two systems in Drosophila to study developmentally occurring neuronal remodeling 6

1.3 Mechanisms in regulating neuronal pruning in Drosophila 9

1.3.1 Transcriptional regulation of neuronal pruning during metamorphosis 9

1.3.2 Ubiquitin-proteasome System 14

1.3.3 Caspase and neuronal pruning 15

1.3.4 IKK-related kinase IK2, cytoskeleton and dendrite severing 16

1.4 Aim of this study 16

Chapter Two: Materials and Methods 18

2.1 Fly Strains 18

2.2 Genetic mapping 19

2.3 Microscopy and image acquisition and quantification 19

2.4 MARCM labeling 20

2.5 Fluorescence in situ Hybridization 21

2.5.1 Primer design for DNA template 21

2.5.2 In vitro transcription of the probe 21

2.5.3 In situ hybridization 22

2.6 Immunohistochemistry 23

2.7 DNA manipulations 23

2.7.1 Escherichia coli culture and transformation 23

2.7.2 Molecular cloning 24

2.7.3 DNA sequencing 24

2.7.4 Genomic DNA extraction 25

2.7.5 mical promoter-lacZ reporter plasmid constructs 26

2.7.6 Mical domain deletion plasmid constructs 27

2.7.7 Mical single domain plasmid constructs 28

2.8 Preparation of whole animal lysates, SDS-PAGE and western blot 29

Chapter Three: Results 31

3.1 Dendrite remodeling of ddaC neurons during metamorphosis 31

3.2 Forward genetic screen for novel players in ddaC dendrite pruning 32

3.3 Mical regulates dendrite pruning of dendritic arborization neurons in Drosophila 35

3.3.1 Mical is affected in l(3)15256 with strong dendrite severing defects 35

3.3.2 Mical promotes dendrite severing of ddaCs 36

3.3.3 Cell-autonomous function of Mical for dendrite severing 38

3.3.4 Time-course analysis of EcR and Mical in dendrite severing 41

3.3.5 Temporal expression pattern of EcR-B1 and Mical 43

3.3.6 Identification of ecdysone response element(s) in the mical regulatory region ………48

3.3.7 Mical does not affect EcR-B1 expression 54

3.3.8 Mical is a crucial factor downstream of EcR-B1 to promote dendrite severing 56

3.3.9 Mical and EcR-B1 are insufficient at early stage to cause premature pruning 58

3.3.10 Functional analysis of Mical domains in dendrite severing 60

3.3.11 Cytoskeleton rearrangement in mical 15256 during dendrite pruning 64

3.4 Dronc and Mical regulate different cellular responses to EcR-B1 68

3.4.1 Dronc is not required for dendrite severing of ddaCs 68

3.4.2 Mical is not required for cell death of apoptotic neurons 73

3.5 Plexin/Semaphorin pathway is not required for ddaC dendrite pruning 73

3.6 Candidate gene analysis in dendrite pruning 77

Chapter Four: Discussions 80

4.1 Questions about the developmentally regulated neuronal remodeling in Drosophila 80

4.2 Developmental regulation of Mical expression during dendrite pruning 81

4.3 Mical or Dronc in regulating dendrite severing 84

4.4 How Mical regulates dendrite pruning and future directions 85

Chapter Five: Conclusions 91

Bibliography 93

Appendix i 104

Appendix ii 105 

Summary The capability of neurons to remodel existing neuronal projections and connections confers great flexibility in response to activity-dependent processes, developmental regulated alterations, neuronal diseases and post-injury recoveries Although a wide range

of events lead to neuronal remodeling, the underlying mechanisms remain elusive Among various types of neuronal remodeling, selective removal of dendrite branches, so

called dendrite pruning, of Drosophila dendritic arborization (da) neurons occurs during

metamorphosis, a developmental process that transforms a ‘worm-like’ larva into an adult fruit fly To understand the mechanisms that regulate dendrite pruning of these peripheral neurons, a forward genetic screen was carried out and identified Mical (Molecule interacting with CasL) as a novel factor that promotes severing of dendrites at the initial stage of dendrite pruning Further studies suggest that destabilization of cytoskeleton molecules, such as microtubules and actins, is suppressed in remodeling da neurons devoid of Mical Mical functions in da neuron pruning downstream of the steroid nuclear hormone receptor complex EcR-B1/Ultraspirical during the larval-pupal transition;

whereas Dronc (Drosophila Nedd2-like caspase) mediates cell-death of apoptotic da

neurons and clearance of dendrite debris

List of Publications

Kirilly D*, Gu Y*, Huang Y, Wu Z, Bashirullah A, Low BC, Kolodkin AL, Wang H, Yu

F (2009) A novel pathway composed of Sox14 and Mical governs severing of dendrites during pruning Nature Neuroscience 12: 1497‐1505 (*as co-first author)

List of Tables

Table 1 Summary in mapping results of mutant lines with dendrite pruning defects… 34

List of Figures

Figure 1 Drosophila dendritic arborization (da) neuron as a model system to study

dendrite remodeling during metamorphosis 10 

Figure 2 Dendrite pruning defects of 15 EMS-induced mutant lines 33 

Figure 3 Mical is required for dendrite severing of ddaCs 37 

Figure 4 Cell-autonomous function of Mical for dendrite severing 40 

Figure 5 Time-course analysis of ddaC pruning behavior in wt, EcR-B1 DN , usp RNAi and mical mutant 42 

Figure 6 Time-course analysis of class I neuron ddaD/E pruning behavior in wt, EcR-B1 DN and mical mutant 44 

Figure 7 Mical expression in ddaCs is dependent on EcR-B1/Usp 47 

Figure 8 Ecdysone-responsive elements in the mical regulatory region 51 

Figure 9 Activation of ecdysone-responsive elements of the mical regulatory region in MB γ neurons 53 

Figure 10 EcR-B1 expression is not affected by Mical 55 

Figure 11 Mical promotes dendrite severing downstream of EcR-B1 57 

Figure 12 Overexpression of EcR-B1 or Mical by itself is not sufficient to cause precocious pruning 59 

Figure 13 Mical domain analysis with deletion constructs in mical mutant ddaCs 61 

Figure 14 Mical domain analysis with deletion constructs in wt ddaCs 63 

Figure 15 Mical domain analysis with single domain constructs in wt ddaCs 65 

Figure 16 Cytoskeleton markers in mical 15256 66 

Figure 17 Dronc is not required for dendrite severing with Mical 71 

Figure 18 Dronc is required for apoptotic neuron cell death but not for remodeling neuron pruning 72 

Figure 19 Mical is not required for cell death of apoptotic neuron during metamorphosis 74 

Figure 20 Mical partners in axon guidance are not required for ddaC dendrite pruning 76 

Figure 21 Candidate genes for dendrite pruning 78 

List of Abbreviations

APF after puparium formation

APP amyloid precursor protein

BDNF brain-deprived neurotrophic factor

EcRE ecdysone response element

eL3 early 3rd instar larva

EMS ethyl methanesulfonate

FISH fluorescent in situ hybridization

GAP GTPase-activating proteins

Grb4 growth factor receptor-bound protein 4

RGC retinal ganglion cells

TGF-β transforming growth factor-β

Tv thoracic ventral neuronsecrectory cells

UPS ubiquitin-proteasome system

VNC ventral nerve cord

wL3 wandering 3rd instar larva

β-gal β-galactosidase

Chapter One: Literature Review

1.1 Introduction

Neurons are highly diversified cells with delicate morphology After birth, neurons extend axons and dendrites from soma to form contacts with the extracellular environment, surrounding neurons and non-neuronal cells These extensions (dendrites and axons) and connections (synapses) of each neuron, together with those

of millions of others, build up the overall neuronal circuits of the nervous system However, after the initial setup of neuronal territory, neurons more or less keep a certain degree of plasticity and retain the ability to remodel their dendrites, axons or synapses The occurrence of neuronal remodeling can be activity-dependent (Hebbar and Fernandes, 2004; Tessier & Broadie, 2008, 2009) or developmentally programmed (Reviewed by Williams and Truman, 2005b) Alternatively, remodeling can be induced by external forces, i.e injuries and neuronal disorders/diseases (Reviewed by Luo and O’Leary, 2005; Saxena and Caroni, 2007) The mechanisms underlying neuronal remodeling likewise inherit such diversity It can be either controlled by genetically programmed intrinsic machinery or induced by external inputs Therefore, it is a challenge to understand the relevance of the intrinsic machinery and extrinsic machinery of neuronal remodeling since bathing in an environment created by neighboring cells, neurons are constantly exposed to a variety

of extracellular stimuli/signals, which nevertheless interact with the intrinsic machinery to refine neuronal morphology Due to the diverse reasons for neuronal remodeling and the complexity of neuronal circuits, our understanding of neuronal remodeling is poor Here we mainly focus on the studies of one type of neuronal remodeling, neuronal pruning

1.2 Neuronal pruning

Neuronal pruning, in which the existing dendrite/axon branches are selectively degraded without cell death is a fundamental mechanism to sculpt the nervous system during animal development The removal of existing neuronal processes can be achieved either by retraction (Bagri, et al., 2003) or local degeneration (Watts et al., 2003), or both (Williams and Truman, 2005a; Koirala and Ko, 2004) The scale of pruning is generally determined by the relative length of pruned processes The small scale events usually involve the elimination of synapse or short neuron branches; while the large-scale pruning, also known as the stereotyped pruning (Bagri et al., 2003), mediates an extensive removal of entire neuronal projections Another feature

of the stereotyped pruning is that its occurrence is highly predictable and is precisely controlled by temporal and spatial cues during neuronal development

It is well-known that destabilization of the cytoskeleton, for example, microtubules, occurs in nearly all types of pruning process being described Furthermore, several cytoskeleton regulators, such as the small GTPase RhoA and its downstream effector Rho kinase (Rok), as well as the myosin regulatory chain and its negative regulator p190RhoGAP (Billuart et al., 2001), have been shown to compromise the axon

stability in vivo However, due to the pleiotropic function of small GTPases in axon

growth (Billuart et al., 2001; Ng et al., 2002; Ng and Luo 2004), little is known about how localized activation of these molecules is achieved and what upstream signaling pathways are, which control neuronal pruning in a precise manner that confines it to certain types of neurons and developmental time points However, difficulties in

identifying, recording and manipulating such a dynamic process in vivo impede us

from understanding the underlying mechanisms of developmental pruning

1.2.1 Developmental pruning in vertebrates

1.2.1.1 Trophic-factor dependent axon pruning

Recent studies of the developmental axon pruning in mammals have shed light on the mechanism underlying this process Neuronal culture and gene knock-out animals were utilized for some of these studies It has been proposed that neuron trophic-

factors may be involved in axon pruning in vivo The study by Singh, et al revealed

an axon-competition mechanism in the sympathetic neurons of the superior cervical ganglion (SCG) in that the activity-dependent secretion of brain-deprived neurotrophic factor (BDNF) from the winning axons binds to the p75 neurotrophin receptor (p75NTR) on the losing axons to cause pruning of the latter ones by suppressing TrkA-mediated signaling that is essential for axonal maintenance (Singh,

et al., 2008) In pursuit of local signals that trigger axon pruning after factor withdrawal, the study done by Nikolaev, et al proposed that the shedding of cell- surface molecule β-amyloid precursor protein (APP) from axon shafts after trophic-factor deprivation leads to its binding to the death receptor 6 (DR6) and thereby triggers axon pruning (Nikolaev, et al, 2009) They further demonstrated that distinct caspases are required for neuron apoptosis and axon pruning Activation of caspase 3 is highly enriched in the cell body of dying neurons, and its inhibition only protects neuronal death but not axon pruning While activation of caspase 6 by trophic deprivation occurs in a punctate pattern in axons and its inhibition protects against

neurotrophic-axon degeneration (Nikolaev, et al, 2009) To support the in vitro data, they further analyzed the pruning of retinal axons in DR6 -/- mice During the development of the retinotopic map of mouse superior colliculus (SC), retinal ganglion cells (RGC) initially send exuberant axon projection into the posterior region of the SC and overshoot their future termination zone in anterior SC These temporal RGC axons are

subsequently pruned to generate a more refined map with focused projection into the termination zone (McLaughlin et al., 2003; Luo and O’Leary, 2005; Nikolaev, et al,

2009) However, in DR6 -/- mice RGC axons and arbors are present in areas far from the termination zone, suggesting a defect of axon pruning in these neurons

1.2.1.2 Axon guidance molecules in developmental axon pruning

Further progress in understanding developmental axon pruning comes from the identification of several molecules previously known to mediate axon guidance In vertebrates, hippocampal mossy fibers, projecting from granule cells of the dentate gyrus, form two distinct axon bundles, the supra- and infra-pyramidal bundles (SPB and IPB) SPB travels above the CA3 pyramidal cell layer and makes synaptic contacts with the apical dendrites of pyramidal cells; while IPB extends below the CA3 pyramidal cell layer earlier in development and is later shortened/pruned (Bagri

et al., 2003; Liu et al., 2005) Axon guidance receptor Plexin-A3, together with Neuropilin-2, has been shown to cell-autonomously mediate the stereotypical axon pruning of IPB mossy fibers Its ligand Sema3F is expressed in cells along the axon track and potentially functions as the extracellular signal to initiate axon retraction at

a certain developmental time point (Bagri et al., 2003; Liu et al., 2005) The dependence of axon pruning on Plexins is not restricted in the hippocampal mossy fibers but has also been studied in the elimination of axon collaterals during the refinement of subcortical processes arising from layer V cortical neurons During early development, layer V cortical pyramidal neurons in motor and visual regions of the neocortex send nearly identical corticospinal tract (CST) axon branches to the spinal cord, superior colliculus (SC) and inferior colliculus (IC) Later on, motor neurons prune their axons from SC and IC, whereas visual neurons prune their axons

from IC and the spinal cord (Low et al., 2008) Surprisingly, Plexin-A3, -A4, and Neuronpilin-2 selectively regulate the visual but not motor CST axon pruning (Low et al., 2008), indicating cell-type specific reliance on the Plexin signaling

Besides Plexins, the ephrin family of axon guidance molecules was proposed to

mediate axon pruning in vitro nearly one decade ago (Gao et al., 1999) However, direct in vivo evidence comes from a recent study in the pruning of hippocampal

mossy fiber Xu and Henkemeyer, 2009 showed that the murine EphrinB3 (EB3) functions as a receptor; and upon tyrosine phosphorylation EB3 signals through an SH2 (Src homology 2)/SH3 (Src homology 3) domain containing adaptor protein Grb4 (growth factor receptor-bound protein 4) to mediate IPB axon retraction and the EphrinB receptor (EphB) molecules serve as the ligands in CA3 postsynaptic pyramidal neurons to stimulate the EB3 reverse signaling (Xu and Henkemeyer, 2009) However, although Plexins/Semaphorins and Ephrins have been known for a while to function as axon guidance molecules steering axon growth direction by collapsing growth cones, several important questions still remain For example, whether the axon pruning observed in either hippocampal mossy fiber or CST axons

is due to axon retraction or local degeneration is still an open question

1.2.1.3 Developmental dendrite pruning in vertebrates

Since an early study of the superior cervical ganglion neruons suggested that dendritic morphology is constantly changing in adult mice (Purves et al., 1986), previous investigations of dendrite remodeling have been mainly focused on activity-dependent changes of dendritic spines instead of large-scale dendrite pruning during animal development However, recent studies revealed that the dendritic differentiation of

cerebellar Purkinje cells (PC) in rats involves two successive phasesof development including both regressive and growth events (Sotelo and Dusart, 2009) And retraction

of the primitive dendritic tree during the early regressive phase requires specific

(Boukhtouche et al., 2006) Further studies also identified SCLIP, a microtubule destabilizingfactor of Stathmin family phosphoproteins, as a crucial factor regulating

PC dendrite retraction and inhibition of SCLIP accelerates the retraction of the primitive process (Poulain, et al., 2008)

1.2.2 Two systems in Drosophila to study developmentally occurring neuronal

remodeling

Besides the mammalian models mentioned earlier, the Drosophila nervous system has

also proven to be an appealing model to study neuronal remodeling with higher

resolution In Drosophila, a single neuron can be labeled (Lee and Luo, 2001) and its morphological changes during development can be traced in real time in vivo

imaging Moreover, easy genetic manipulation in the fruit fly confers a great advantage in dissecting the mechanisms of neuronal remodeling

One fascinating phenomenon of Drosophila life cycle is that the insect goes through a

complete change of its body plans Within the life cycle, there are two distinct stages

of development: the larval stage and the adult stage At the larval stage, the animal takes the form of a worm-like creature, only capable of feeding and crawling; however, when the animal reaches its adult stage, it develops the ability of flying and looks like a ‘fruit fly’ as revealed by its well-known name To achieve this transformation, it is crucial for the animal to go through a developmental process called metamorphosis, during which many larval tissues degenerate and most adult-

specific tissues or structures are generated from clusters of progenitor cells and the imaginal discs (Bodenstein, 1965) Tissues undergoing histolysis during the early stages of metamorphosis include the larval midgut, muscles and salivary gland (Jiang

et al., 1997); and they are eliminated mainly through programmed cell death (Jiang et al., 1997) or autophagy pathways (Baehrecke, 2003) Cell death also occurs in many neurons of the larval nervous system (Weeks and Levine, 1990) However, a major difference between the nervous system and other tissues is that some groups of functional neurons born at the embryonic or larval stages survive through metamorphosis and accommodate drastic changes of surrounding tissues It is conceivable that these neurons need to eliminate larval connections which are no longer adapted to the adult environment and re-establish new ones which are integrated into the functional adult neural circuits This remodeling process happens

extensively in the nervous system of Drosophila (Truman, 1990), thus making it the

mostly well-described system we know which undergo remodeling during metamorphosis Remodeling neurons that have been discovered so far belong to different functional groups, such as the olfactory projection neurons (PNs) that relay odor stimuli information in the olfactory circuit (Marin et al., 2005) and the thoracic ventral neurosecrectory cells (Tv) of the neurohemal organ (Brown et al., 2006)

Besides these two types of remodeling neurons, in Drosophila, there are another two

well-established systems to study the developmentally programmed neuronal remodeling; one being the axon remodeling of the mushroom body (MB) γ neuron in the central nervous system (CNS) (Lee et al., 2000), and the other being the dendrite remodeling of the dendritic arborization (da) neuron in the peripheral nervous system (PNS) (Williams and Truman, 2005a; Kuo et al., 2005)

The MBs in the central brain of Drosophila are essential for learning and memory

During the larval stages, the axon of γ neurons in MB bifurcates after the peduncle and extends one branch dorsally and another medially (Lee et al., 1999) However, during the larval to pupal transition, these two bifurcated axon branches become destabilized and undergo local degeneration (Watts et al., 2003) Their axonal debris

is removed by glia-mediated phagocytosis within the first 24 h of pupal stage (Awasaki and Ito, 2004; Awasaki et al., 2006; Watts et al., 2004) Subsequently, the shortened axons are able to re-grow only medially during late pupal stages and adopt their adult-specific form, distinct from their larval counterparts (Lee et al., 2000) Because this process involves rather big changes in the overall axon structure, as well

as the number of neurons, it is referred to as the large-scale remodeling

Large-scale remodeling of neurites also occur in the fly PNS In contrast to the CNS γ neurons that prune both their axons and dendrites, da neurons selectively prune their dendrites with only minor changes at their axon terminals (Kuo et al., 2005) da neurons are located peripherally between the epidermal layer and the muscle tissue

layer and contain a single axon and multiple dendrites The axon projects ventrally to

the ventral nerve cord (VNC) where it slightly branches out to form axon terminals, while dendrites elaborate mostly two-dimensionally underneath the epidermis Based

on the complexity of the larval dendritic morphology, da neurons are subdivided into four classes, namely Class I, II III and IV (Gruber et al., 2002, 2003a, 2003b; Fig 1B) However, besides the differences in dendrite morphologies, the different classes also

acquire distinct cell fates In Drosophila larval PNS, a large number of neurons

undergo apoptosis during metamorphosis For instance, within the dorsal da neuron cluster, only ddaC (Class IV), ddaD and ddaE (Class I) can survive to the adult stage,

while ddaA, ddaF (Class III) and ddaB (Class II) die within the first 4-6 h after puparium formation (APF) (Fig 1A) For those surviving neurons, their larval dendrites undergo the remodeling process, including severing, fragmentation and clearance (Williams and Truman, 2005a; Fig 1D)

Although γ neurons and da neurons selectively remodel their axons or dendrites, previous studies revealed that some intrinsic mechanisms are shared between both systems For instance, the transcriptional regulation mediated by ecdysone signaling has been shown to control the axon/dendrite pruning events in fly CNS and PNS; and some components of the protein degradation machinery, the ubiquitin-proteasome system (UPS), were identified to be involved in axon pruning of γ neurons as well as dendrite pruning of da neurons

1.3 Mechanisms in regulating neuronal pruning in Drosophila

1.3.1 Transcriptional regulation of neuronal pruning during metamorphosis

It is reasonable to think that neuron pruning, as a part of the cellular processes of metamorphosis, shares some common mechanisms with the rest of other processes occurring during metamorphosis One potential candidate mechanism is the steroid hormone-mediated signaling which regulates the transcriptional level control of many processes during metamorphosis The steroid hormone 20-hydroxyecdysone (referred

to as ‘ecdysone’ hereafter) is the major hormone that elicits metamorphosis in

Drosophila It acts through a nuclear receptor heterodimer complex composed of the

steroid hormone ecdysone receptor (EcR) and its co-receptor Ultraspiracle (Usp), the

Drosophila ortholog of Retinoid X receptor (RXR) (Thomas et al., 1993; Yao et al.,

Figure 1 Drosophila dendritic arborization (da) neuron as a model system to study

dendrite remodeling during metamorphosis

(A) Live confocal image of the dorsal da neuron cluster, visualized by the expression of

mCD8-GFP driven by Gal4 109(2)80 Labeled in red are neurons capable of survival to the adult stage, labeled in blue are neurons undergoing apoptosis during metamorphosis

(B) Distinct larval dendritic morphology of the dorsal da neurons ddaD and E belongs to Class I; ddaB, Class II; ddaA and ddaF, Class III; ddaC, Class IV

(C) Live confocal images of ddaC neuron in the time-course study during dendrite pruning Dendrite branches of ddaCs are removed from the soma (pointed by arrow heads) within the first 18 h of metamorphosis By 8 h APF, most primary dendrites are severed from the soma

at the proximal region Severed dendrites indicated by empty arrow heads show signs of beading and fragmentation By 18h APF, the pruning process is completed with only the soma and the axon remained intact and all fragmented dendrites cleared The re-grown dendritic arbor of ddaCs at 96 h APF shows little resemblance to its WP counterpart

(D) A diagram of dendrite pruning process Dorsal is up Anterior is left Scale bar, 50 µm

1992; Reviewed by Kozlova and Thummel, 2000) Previous studies indicated that ecdysone and ecdysone-mediated transcriptional responses are responsible for

programmed cell death of the larval midgut (Jiang et al., 1997) In Drosophila CNS

programmed cell death is also ecdysone-dependent (Robinow et al., 1993) Not surprisingly, EcRs were found to be required for neuronal remodeling, as well as for

other processes during metamorphosis (Schubiger et al., 1998) However, the EcR gene in Drosophila encodes three isoforms (Koelle et al., 1991) EcR-A, EcR-B1 and

EcR-B2 share common DNA- and ligand-binding domains but differ in the variable A/B domain located at the N-terminus (Talbot et al., 1993) To determine which isoform(s) is specific for mediating neuronal remodeling, several experimental approaches were used First, an immunochemistry study with the isoform-specific antibody revealed that the major isoform expressed in the remodeling neurons is EcR-

B1 (Truman et al., 1994) Secondly the phenotypic analysis of isoform-specific EcR

mutants suggested that EcR-B1/B2 control the remodeling of the nervous system (Schubiger et al., 1998) Thirdly the ability of EcR-B1/B2 to restore normal neuronal

pruning in EcR mutant strongly supported the specific role of EcR-B1/B2 during

neuronal remodeling (Schubiger et al., 2003; Lee et al., 2000)

In the transcriptional regulation of dendrite pruning in da neurons, the same B1/Usp complex is utilized, indicating a common upstream transcriptional control for both dendrite pruning (Kuo et al., 2005) and axon pruning (Lee et al., 2000) Interfering with ecdysone signaling by the neuronal overexpression of the dominant negative form of EcR-B1 (EcR-B1DN) can abolish the dendrite pruning process, by preventing the destabilization of dendritic microtubules and the severing of dendrites

Loss of usp function also leads to dendrite pruning defects, similar to those of

EcR-B1DN overexpression (Kuo et al., 2005) Since EcR initiates a series of transcriptional

events in response to the ecdysone pulse at the larval-pupal transition, it is likely that the alterations in the transcriptional profile in remodeling neurons confer certain competence on these neurons to undergo pruning Thus, it is very interesting to understand the downstream targets of EcR-B1 in the context of remodeling neurons The well-known primary response genes after ecdysone induction include transcription factors Broad-complex (BR-C), E74 and E75 (Burtis et al., 1990; Fletcher and Thummel, 1995; Segraves and Hogness, 1990; Thummel et al., 1990) However, the genetic analysis of these genes in MB remodeling suggested that they are not required for axon pruning (Lee et al., 2000) Therefore, other attempts need to

be made to identify downsteam targets of EcR-B1 in remodeling γ neurons For example, Hoopfer et al carried out a genome-wide analysis of neuron remodeling using microarray and identified several groups of genes that are induced or suppressed

by ecdysone in MB neurons Identified genes include transcriptional regulators, cytoskeleton-binding proteins and components of the programmed cell death machinery, autophagy as well as the ubiquitin-proteasome system (Hoopfer et al., 2008) Some of these genes are bona fide targets of ecdysone signaling as supported

by previous studies, such as BR-C and E74, although neither is essential for axon pruning (Lee et al., 2000; Hoopfer et al., 2008) However, some components of the UPS were indeed found to be required for axon pruning of MBs in other studies and will be described in later sections

Further studies in the MB γ neurons identifed two novel complexes that modulate axon pruning by regulating EcR-B1 expression One is TGF-β (transforming growth factor-β) signaling Loss of function in components of TGF-β signaling, such as

baboon (type I receptor for dActivin) and the downstream transcriptional effector dSmad2, leads to down-regulation of EcR-B1 expression, thereby causing strong axon

pruning defects in MB γ neurons, which can be rescued by overexpression of EcR-B1, but not EcR-A or EcR-B2 (Zheng et al., 2003) Therefore, TGF-β signaling was suggested to pattern tissue-specific responses to steroid hormones by regulating expression of specific steroid hormone receptor (Zheng et al., 2003) The other complex that controls EcR-B1 expression in MB γ neurons is Cohesin, a tripartite protein complex composed of a pair of SMC (Structural Maintenance of Chromosome) proteins and an α kleisin protein, Rad21 (Schuldiner et al., 2008; Pauli

et al., 2008) The function of Cohesin is previously known to regulate the segregation

of sister-chromatid during the metaphase-anaphase transition Surprisingly, intricate experiments performed by these two research groups proved that the post-mitotic function of the Cohesin complex can be separated from its mitotic role, although how

it regulates EcR-B1 expression remains unknown

Above studies provide us some clues on how the developmental pruning is possibly

initiated in vivo in Drosophila and specifically, how neurons acquire their competence

for pruning at the transcriptional level However, more details regarding the cellular responses to ecdysone signaling remain untouched For example, since the same ecdysone signal is responsible for inducing cell apoptosis and neuronal remodeling, what mechanism controls the ‘death’ versus ‘survival’ signal, and how these mechanisms are integrated into ecdysone signaling is still a mystery Moreover, besides the UPS components, no other EcR target genes have been reported to function in dendrite/axon pruning so far These questions will be a focus of our study

in understanding how neuron pruning is achieved

1.3.2 Ubiquitin-proteasome System

The microarray data from the MB neurons provides us insights into the candidate signaling pathways that are downstream of ecdysone signaling, among which is the ubiquitin-proteasome system Many years of studies on the UPS in the nervous system have focused on its role in neurodegenerative diseases (Reviewed by Hernandez et al., 2004), such as Parkinson's disease (reviewed by Giasson and Lee,

2003) In Drosophila, the UPS has also been shown to regulate injury-induced axon

degeneration (Hoopfer et al., 2006) More recently, people have begun to realize the important physiological function of the UPS in normal neuronal development, such as axon growth and guidance (Campbell and Holt, 2001; Myat et al., 2002), synapse growth (Wan et al., 2000), elimination (Ding et al., 2007) and transmission (Speese et al., 2003)

Recent studies in MB γ neurons and the following work done in da neurons indicated

an important mechanism involving the ubiquitin-proteasome system Components in the ubiquitination pathway, such as the E1 ubiquitin activation enzyme Uba1, the E2 ubiquitin conjugating enzyme UbcD1, and subunits of the 19S regulatory particle of proteasome, Mov34 and Rpn6, have been identified as regulators of either axon or dendrite pruning or both Interestingly, UbcD1 is specifically required for dendrite pruning instead of axon pruning, although in the MB neurons UbcD1 in indeed upregulated by ecdysone (Hoopfer et al., 2008), raising questions of whether specificity and redundancy of E2 enzymes may exist Due to the diversity of ubiquitin

E3 ligases in Drosophila, it is not known that how many of them are utilized during

the pruning process More importantly, since the substrate specificity of the UPS is

conferred by the E3 ligase complex, the specific substrate(s) during neuronal pruning remains to be investigated

1.3.3 Caspase and neuronal pruning

Because the initial stages of programmed cell death share some common features with neuronal pruning, such as formation of blebs and restricted local degenerations, it is tempting to hypothesize that caspases, well known for their ability to induce apoptosis, might also be involved in the process of neuronal pruning However, ectopically introducing caspase inhibitor (p35) or removing caspase activators (Grim, Hid, Rpr) in MB γ neurons do not lead to a delay in axon pruning (Watts et al., 2000)

And genetic analysis of genes involved in programmed cell death, such as effete (UbcD1) thread (DIAP1; Drosophila inhibitor of apoptosis protein 1), and Drice (caspase-3 homologue) showed that none of them are required for axon pruning in

MB γ neurons (Hoopfer et al., 2008) However, the hypothesis that activation of Caspases is involved in the degeneration of neural projections is supported by some

recent findings in dendrite pruning of da neurons In Drosophila, there are several

caspases (Dronc,Drice, Dredd, Dcp-1, Decay and Damm) Dronc (Drosophila

Nedd2-like caspase; caspase-9 homologue) is the only initiator or apical caspase encoded in the fly genome Independent studies from two research groups reported that removal

of Dronc in ddaC using different dronc deletion mutants causes either dendrite

severing defects (Kuo et al., 2006) or clearance defects (Williams et al., 2006), supporting the idea that the presence of caspase is required for dendrite pruning

Moreover, DIAP1 gain of function mutation also affects dendrite pruning and DIAP1

degradation in dendrites was proposed to relieve the inhibition on Dronc (Kuo et al., 2006) However, the link that is still missing includes how caspases execute the dendrite severing process and the subsequent phagocytosis and how the DIAP1

activity is locally regulated in dendrites while keeping the soma alive And it is also interesting to know the reason why the reliance of caspase on dendrite pruning versus axon pruning differs

1.3.4 IKK-related kinase IK2, cytoskeleton and dendrite severing

A partial answer to the above question comes from a recent study of IK2, a negative regulator of DIAP1 and a non-canonical member of the IκB kinase family (Kuranaga

et al., 2006) Genetic analysis of IK2 in ddaC dendrite pruning showed that this molecule is both required and sufficient for dendrite severing (Lee et al., 2009) However, since IK2 could also regulate cytoskeleton-based processes, such as F-actin assembly (Oshima et al., 2006) and from Lee and colleagues’ study, IK2 indeed affects the integrity of Tubulin-GFP and Actin-GFP signal during dendrite pruning, it

is possible that besides inhibition of DIAP1, IK2 has a much broader role in dendrite pruning, including cytoskeleton re-organization

In addition to the potential impact of IK2 on cytoskeleton, a molecule named Katanin p60-like 1, isolated from a recent RNAi screen conducted by Lee and colleagues, was reported to have microtubule-severing activity in mediating dendrite pruning of ddaC neuron (Lee et al., 2009) However, it is not known whether overexpression of this microtubule severing factor is sufficient to induce dendrite pruning at an earlier time point

1.4 Aim of this study

Regarding mechanisms that regulate developmental dendrite pruning in Drosophila,

although molecules ranging from transcription factors to protein destruction components have been demonstrated to play important roles, information we obtained

so far is still fragmentary A big gap between transcription factors and cytoskeleton molecules need to be filled with knowledge regarding how transcriptional events lead

to cytoskeleton re-arrangements Therefore, potential cytoskeleton modulators remain

to be discovered In addition, regarding the protein degradation machinery, although a simple hypothesis is that substrates to be degraded could be cytoskeleton molecules, other alternative possibilities still remain For instance, processing of molecules by the UPS or caspase could be required for elimination of inhibitors that repress dendrite pruning Such molecules can be transcriptional repressors or cytoskeleton-binding proteins that maintain cytoskeleton integrity at larval stages Alternatively, the processing of molecules could also lead to the activation of signaling molecules that are crucial for transducing pruning signals To further understand cellular and molecular mechanisms of developmentally programmed dendrite pruning, to quench our curiosity towards the above mentioned questions, we decided to conduct an unbiased forward genetic screen to identify new players and genetic pathways that

confer stringent control of dendrite pruning in Drosophila ddaC neurons

Chapter Two: Materials and Methods

2.1 Fly Strains

The following fly strains were used in this study:

300 independent ethyl methanesulfonate (EMS)-induced third chromosome-linked

pupal-lethal lines l(3) xxx (a gift from Bashirullah, A)

ppk-Gal4 (Ainsley et al ,2003; appendix ii); Gal4 2-21 (Grueber et al., 2003a; appendix

ii); ppk-eGFP (Grueber et al., 2003b); UAS-Dronc C318A (Meier et al., 2000)

mical K583 , mical K1496 , mical I696 mical G56 (Beuchle et al., 2007); Df(3R)swp2 MICAL Mical G to W (Terman et al., 2002); UAS-Mical FL , UAS-Mical N-ter , UAS-HA-∆FM-

,UAS-Mical, UAS-HA-∆CH-,UAS-Mical, UAS-HA-∆LIM-,UAS-Mical, UAS-HA-∆PDZ binding-,UAS-Mical, UAS-Semaphorin-1a EC (kind gifts from Kolodkin, AL)

UAS-PlexinA RNAi (Sweeney et al., 2007), UAS- Semaphorin-1a RNAi (Sweeney et

al., 2007), UAS-Semaphorin-1a Δcyto (Komiyama et al., 2007) are gifts from Luo, L

FRT2A-dronc 9666 , FRT2A-dronc 11510 FRT82B- mical 15256 (this study)

FM-Mical, CH-Mical, LIM-Mical, PRD-Mical, CC+PDZ –Mical (this study)

UAS-HA-mEcRE0-lacZ, mEcRE1-lacZ, mEcRE2-lacZ, mEcRE3-lacZ and mEcRE4-lacZ (this

study)

The RNAi stocks including UAS-EcR RNAi; UAS-usp RNAi; UAS-mical RNAi were obtained from VDRC (Vienna Drosophila RNAi Center, Austria) (Dietzl et al., 2007)

The stocks from the Bloomington stock center are 3rd chromosome deficiency kit,

Df(3R)ED5454, Df(3R)ED5428, Df(3R)ED5438, Df(3L)Exel6083, Df(3R)Exel6155, Df(3R)Exel 6197, Df(4)C3 PlexinA , Semaphorin-1a k13702(P1) , plexinB KG00878 , DCasL NP4466

,FRT19A-mys 1 , FRTG13-Lis1, elav C155 -Gal4 (appendix ii), 201Y-Gal4 (appendix ii), Gal4 109(2)80 (appendix ii), UAS-mCD8GFP, UAS-GFP-α-Tubulin, UAS-Actin-GFP,

EcRE-lacZ, , FRT2A, FRTG13, FRT19A, FRT82B, tub-Gal80, hsFlp

All fly strains were kept at 25°C, fed with cornmeal food supplemented with fresh yeast paste

2.2 Genetic mapping

l(3) xxx was recombined with the multiply marked chromosome-3 known as ‘rucuca’

(Lindsley and Grell, 1968), which carries the recessive markers ru h th st cu sr e ca Recominant chromosomes with or without l(3) xxx were analyzed according to

Greenspan, 2004 to determine the prelimilary cytogenetic location of the mutation

l(3) xxx was further tested for failure to complement thechromosome 3 deficiency kit from Bloomington Stock Center

2.3 Microscopy and image acquisition and quantification

For live imaging of neurons at larval stages, the WP or early pupal stages (<10 h APF), larvae/pupae were washed in PBS several times and then mounted with 90% Glycerol in PBS

For imaging neurons at later pupal stages (>10 h APF), pupal case was firstly removed and followed by immersion with 90% Glycerol in PBS

Images of live or fixed tissue were acquired with the Zeiss Meta510 laser confocal microscope and processed using Photoshop (Adobe Systems, CA, USA)

Quantification of the number of primary and secondary dendrites was manually done

in a 300 µm x 300 µm region of the dorsal dendritic field of ddaCs, originating from the second to fifth abdominal segments Quantification of the length of the longest

dorsal dendrite attached to the soma was done in ImageJ with the NeuronJ plugin by Eric Meijering (University Medical Center Rotterdam, Netherlands) To quantify immunostaining signals in neurons, outlines of somas were marked in ImageJ and the average of pixel intensity within the marked area was measured

Statistical significance was determined using two-tailed student’s t-test We consider

the result to be significant (*) when p< 0.05, (**) when p<0.001

mCD8::GFP/FM7; tubP-Gal80, FRTG13 was used For generating MARCM clones

with X chromosome mutations, tub-Gal80, FRT19A, hsFLP; Gal4 109(2)80 ,

UAS-mCD8::GFP males were crossed with virgin females carrying FRT19A associated

mutation

To generate mosaic clones, embryos were laid on a fresh yeastgrape juice agar plate for 2-3 hr and allowed to develop for 3hr at 25°C before a heat shock A double heat shock scheme was used The heat shock was performed at 38°C for 45 min, followed

by room temperature recovery for 30 min, and a second heat shock at 38°C for 45 min After heat shock embryos were kept at 25°C in a Petri dish with moist filterpaper and fed with fresh yeast paste to third instar larvae GFP-labeled clones were identified by examining living third instarlarvae under a Leica MZFL III fluorescence microscope fitted with a PLANAPO 1x lens

Animals with da neuron clones were marked at the WP stage and dendritic morphology of these neurons were imaged immediately upon puparuim formation After the 1st imaging the animal was recovered and staged in a moist Petri dish chamber at 25°C till 18 h APF for the 2nd imaging

2.5 Fluorescence in situ Hybridization

2.5.1 Primer design for DNA template

To synthesize DNA template for in situ RNA probe, primers were designed to amplify

a 1kb, non-conserved region from the gene coding sequence T7 promoter sequence (TTAATACGACTCACTATAGGGAGA) was added to the 5’ end of either primer to

generate in vitro binding site for T7 RNA polymerase

Primers used:

For mical anti-sense probe, 5’-ATGAGCCGCCAACAC-3’and

5’-TTAATACGACTCACTATAGGGAGAAGTGCGTCTCGTCCT-3’ were used to

PCR 1kb DNA fragment from mical coding sequence as the template for in vitro T7

transcription

For mical sense probe,

TTAATACGACTCACTATAGGGAGAATGAGCCGCCAACAC-3’ and

5’-AGTGCGTCTCGTCCT-3’ were used

2.5.2 In vitro transcription of the probe

300-400ng PCR DNA template, 2μl DIG RNA labeling mix (Roche), 2μl 10X

transcription buffer, 1μl RNase inhibitor (Roche) and 2μl T7 RNA polymerase (Roche) were added into a 1.5ml FRNase-free eppendorf tube Sterile water was added to adjust the final volume to 20μl The reaction was mixed, centrifuged briefly and incubated for 3 hour at 37°C At the end of the incubation 2μl DNaseI, RNase-

free (Roche) was added to the mixture and incubated for 15 min at 37°C to remove the DNA template After DNA digestion, 2.5μl 4M LiCl and 75μl absolute ethanol

were added to precipitate the RNA The solution was mixed and stored at -20°C Before using the RNA probe, the solution was centrifuged for 15 min at 12,000 rpm The pellet was washed with 80% ethanol and dried briefly under vacuum before resuspended in 30μl sterile water

2.5.3 In situ hybridization

Dissected brains were fixed in 4% formaldehyde in PBS for 15 min, and then washed five times with PBS+0.1%Tween20 for 5 min each, followed by a 5 min wash with PBS+0.1%Tween20/hybridization buffer (1:1, v/v) and another 5 min wash with hybridization buffer alone Brains were then transferred to an autoclaved screw cap tube added with 500μl hybridization buffer and prehybridized for 3 hour at 65°C RNA probe was denatured at 95°C for 5 min and 3-5μl was added to hybridization buffer to hybridize brains overnight at 65°C

On the next day, brains were first washed with hybridization buffer for 20 min, followed by a 20 min wash with PBS+0.1%Tween20/hybridization buffer (1:1, v/v) and three washes with PBS+0.1%Tween20 alone, 20min each All wash steps were done at 65°C, except for the last one at room temperature After the final wash, brains were incubated with anti-Digoxingenin-POD, Fab fragments (Roche) and rabbit anti-GFP (Molecular Probes) at 1:200 dilution in PBS+0.1%Tween20 overnight at room temperature

On the third day, after three washes with PBS+0.1%Tween20, brains were incubated with FITC-conjugated goat anti-rabbit IgG (Jackson Laboratories) at 1:200 dilution in PBS+0.1%Tween20 for 90 min , followed by three washes with PBS+0.1%Tween20 and a 30 min incubation with Cy3 tyramide reagent (Perkin Elmer Life Sciences) at

1:50 dilution Finally, brains were washed with PBS+0.1%Tween20 three times and mounted with the VectaShield mounting medium

2.6 Immunohistochemistry

Dissected larval and pupal fillets/brains were fixed in 4% formaldehyde in PBS at room temperature for 30 min Fixed tissues were washed three times with PBS+0.3%Triton-100 (for fillets) or PBS+1%Triton-100 (for brains), 15 min each, followed by blocking in 5% normal goat serum in PBT at room temperature for 1 hr Samples were kept with the primary antibodies at 4°C overnight Primary antibodies were used at a concentration of 1:1000 for rabbit anti-Mical (Terman et al., 2002), 1:20 for mouse anti-EcR-B1 (DSHB, U Iowa), 1:250 for rat anti-HA (Roche) and 1:1000 for rabbit anti-β-gal (Cappel)

On the next day, after the removal of the primary antibody, samples were washed three times with PBT for 30min each, followed by incubation with the secondary antibodies at 4°C overnight Secondary antibodies were Cy3-conjugated goat anti-rabbit IgG (Jackson Laboratories) at 1:500, Cy3-conjugated goat anti-mouse IgG (Jackson Laboratories) at 1:500, and Cy5-conjugated goat anti-Horseradish Peroxidase (HRP) (Jackson Laboratories) at 1:200

On the third day, samples were washed three times with PBT for 30min each before mounting in the VectaShield Mounting Medium

2.7 DNA manipulations

2.7.1 Escherichia coli culture and transformation

E coli strain XL1-Blue was used as host strain for all DNA plasmids amplifications,

unless otherwise mentioned Standard LB liquid medium was used to culture bacteria

at 37°C with vigorous shaking (250 rpm) and LB solid medium were prepared with

LB liquid medium supplemented with 1.5% Bacto®- agar and corresponding antibiotics

Two types of transformation methods were used: heat-shock transformation with incubation on ice, 30 min; followed by heat-shock at 42°C, 30 sec; chilled on ice for another 2 min and followed by recovery at 37°C, 1 h with 250 μl of fresh LB medium with vigorous shaking Subsequently, transformants were plated onto selective LB plates and incubated at 37°C overnight Electroporation was performed using 0.2 mm electroporation cuvettes with Gene pulser-Xcell (BioRad)

2.7.2 Molecular cloning

Standard cloning techniques were performed as described by Sambrook and

colleagues All PCR reactions were carried out using the Expand High Fidelity PCR

System (Roche) with PTC-200 DNA Engine Thermal Cycler (BioRad), unless otherwise mentioned The following thermal profile was used for standard PCR reactions: 94°C, 3 min; [94°C, 15 sec; 55°C, 30 sec; 68°C (>3kb fragment) or 72°C (<3kb fragment), 1 min/kb], 25-30 cycles; 68 or 72°C, 10min

Restriction endonucleases were purchased from New England Biolabs and T4 DNA ligase was from Roche Purification of PCR products, gel extraction and isolation of

plasmid DNA from E.coli were carried out using corresponding kits from Qiagen

2.7.3 DNA sequencing

For plasmid DNA sequencing, 100-150 ng of DNA template was mixed with 1μl forward or reverse sequencing primer (20 ng/μl) and 8 μl of BigDye terminator reaction mixture (ABI PRISM TM Dye terminator Cycle Sequencing Ready Reaction Kit) and topped up with ddH2O to a final volume of 20 μl Sequencing PCR

parameters were as follows: [96°C, 10 sec, 50°C, 5 sec, 60°C, 1 min 30 sec], 25 cycles The reaction product was applied to the ABI PRISM 3100 automated sequencer (Applied Biosystems)

For PCR product sequencing, 10-20 ng per kb of PCR product was used for each reaction

2.7.4 Genomic DNA extraction

15-20 larvae were collected in the 1.5ml eppendorf tube, grinded with the lysis buffer and followed by Phenol/Chloroform extraction Precipitated DNA was resuspended in the TE buffer and used as the template for amplification of exon fragments

Primers used for amplifying mical 15256 and control exons were:

2.7.5 mical promoter-lacZ reporter plasmid constructs

A genomic clone BACR39F04 containing the entire mical genomic region was used

as the template to amplify five overlapping DNA fragments (mEcRE0, 1, 2, 3, 4),

covering around 20kb of the putative mical enhancer and promoter region mEcRE0 fragment was flanked by the EcoR I site at its 5’ end and Not I site at its 3’ end mEcRE1, 2, 3, 4 fragments, 5-6kb each, were flanked with Not I enzyme sites at both

ends These PCR fragments were first inserted into the pGEM-T easy vector

(Promega) by TA cloning and then subcloned into the Not I or EcoR I and Not I

linearized pCaSpeR-hs43-lacZ vector Orientation of inserts was checked by restriction enzyme digestion Plasmids with correct orientation were sequenced and purified with Qiagen Midi Extraction Kit

Primers used were:

mical_EcRE_0_forward: 5’-CACCGAATTCGGCAACGGCTTCGAATTTGGA-3’ mical_EcRE_1_forward: CACCGCGGCCGCATCGACAGCGACTGAGACAA mical_EcRE_0/1_reverse: AAAGCGGCCGCAGGAGAGAGGTTTGGTAGACA

mical_EcRE_2_forward: CACCGCGGCCGCATGAGGCTGCTGATTAGATGG mical_EcRE_2_reverse: AAAGCGGCCGCGCACACTCAACTTACTTGTCTC mical_EcRE_3_forward: CACCGCGGCCGCCACGAGTTCTTCGAATTTCG

mical_EcRE_3_reverse: AAAGCGGCCGCACAGCAAACTGCTCAGCCACT

mical_EcRE_4_forward: CACCGCGGCCGCGCTAAGTAGGTGTTTCTTGTC mical_EcRE_4_reverse: AAAGCGGCCGCTAACTTGCATCTGGTTTCAAC

2.7.6 Mical domain deletion plasmid constructs

QuikChange® Lightning Site-Directed Mutagenesis Kits (Stratagene) was used to generate Mical domain deletion constructs using pcDNA1.1-3HA-Mical plasmid as template Procedures were carried out according to the instruction manual Briefly, to generate single deletion within one plasmid DNA, a set of complementary primers was designed with both ends anneal to the corresponding ends of DNA to be deleted PCR reaction mix was prepared as follows: 5 μl of 10× reaction buffer; 100 ng of plasmid DNA template; 1.25 μl oligonucleotide primer forward (10 μM); 1.25 μl oligonucleotide primer reverse (10 μM); 1 μl of dNTP mix, 1.5 μl of QuikSolution reagent and top up with ddH2O to a final volume of 50 μl 1 μl of QuikChange Lightening DNA polymerase was added before putting into the PTC-200 DNA Engine Thermal Cycler (BioRad) The following thermal profile was used: 95°C, 3 min; [95°C, 20 sec; 60°C , 10 sec; 68°C, 30 sec/kb of plasmid length], 18 cycles;

68°C, 7min After PCR 2 μl of Dpn I restriction enzyme was added directly to each

reaction and incubated at 37°C, 30 min to digest the template DNA plasmid 2 μl of

Dpn I-digestion product was used for heat-shock transformation with XL10-Gold

ultracompetent cells provided by the kit

Primers used for mutagenesis were: