Evaluation of the role of autophagy in fungal development and pathogenesis 2

The following Atg proteins are specifically essential for the induction of the Cvt pathway: Atg11 is important for PAS organization Kim et al., 2001; Suzuki and Ohsumi, 2007.. ATG26 enc

CHAPTER I: INTRODUCTION

1.1 General introduction of autophagy

1.1.1 Process and classification of autophagy

Autophagy is a cellular mechanism for bulk degradation of long-lived cytosolic or short-lived damaged proteins and organelles within vacuoles/lysosomes Autophagy is induced in response to environmental stress or developmental signals during cellular

differentiation (Besteiro et al., 2006; Liu et al., 2005; Noda and Ohsumi, 1998; Lucarre et al., 2003b; Pinan-Lucarre et al., 2005) Take non-selective

Pinan-macroautophagy as example, when autophagy is induced, cytoplasmic constituents, including organelles, are sequestered by a unique membrane called the phagophore or isolation membrane The complete sequestration by the elongating phagophore results

in formation of the autophagosome, a double-membraned organelle (300-900 nm in diameter) In the next step, autophagosomes fuse with lysosomes (in metazoan cells)

or vacuoles (in yeast and plant cells) Once macromolecules have been degraded in the lysosome/vacuole, monomeric units (e.g., amino acids) are exported to the cytosol for reuse

Besides macroautophagy, non-selective autophagy includes microautophagy, which

involves the direct engulfment of cytoplasm at the surface of the vacuole (Noda et al.,

1995) Eukaryotic cells also exert a highly selective process to deliver specific

cytosolic proteins into the vacuole, which is called cytoplasm-to-vacuole targeting

(Cvt) pathway (Scott et al., 1997) A selective autopahgy that is specific for cytosolic

glycogen was identified in new-born animals and was named as glycogen autophagy Autophagy can also target specific organelles for degradation, such as ER

(reticulophagy) (Bernales et al., 2007) mitochondria (mitophagy) (Tolkovsky, 2009) and peroxisomes (pexophagy) (Sakai et al., 2006) (Figure 1)

1.1.1.1 Glycogen autophagy

In newborn animals, a well-defined role for autophagy is the breakdown of

intracellular glycogen reserves within autophagic vacuoles, namely glycogen

autophagy, which is a strategy to cope with a sudden demand for ample energy substrates to confront metabolic requirements, before gluconeogenesis is initiated

(Kotoulas et al., 2004, 2006) Glycogen autophagy can be induced by glucagons, and

be suppressed by insulin, which abolishes glucagon secretion (Kalamidas and

Kotoulas, 2000b; Kotoulas et al., 2006) Glucagon action is activated by the cAMP /

protein kinase A (which in turn activates glycogen autophagy) and suppressed by phosphoinositides / mTOR pathways (which in turn surpresses glycogen autophagy)

(Kalamidas et al., 1994; Kotoulas et al., 2004) That glycogen autophagy can be

induced by rapamycin in newborn rat hepatocytes also suggests a TOR-dependent regulation on glycogen autophagy (Kalamidas and Kotoulas, 2000a, b)

are topologically and mechanistically similar and share most of the Atg (autophagy-

Figure 1 Schematic diagram of selective and non-selective autophagy Depending

on the specificity of the cargos, autophagy can be a selective or a nonselective process During nonselective autophagy, a portion of the cytoplasm is sequestered into a

double-membrane autophagosome, which then fuses with the vacuole

(macroautophagy) A biosynthetic cytoplasm to vacuole targeting (Cvt) pathway in yeast also shares similar morphological features and viewed as a selective type of autophagy.In contrast, the specific degradation of peroxisomes in certain conditions can be achieved by a macro- or microautophagy-like mode, termed macropexophagy and micropexophagy, respectively The specific degradation of mitochondria, termed mitophagy also takes place

related) components (Hutchins and Klionsky, 2001) The Cvt pathway was identified

in the unicellular yeasts (Baba et al., 1997), however, its existence in higher

eukaryotes, including filamentous fungi, remains controversial

1.1.1.3 Pexophagy

Peroxisomes are single membrane-bound organelles in which lipid catabolism and

hydrogen peroxide detoxification occurs In Pichia pastoris, a species of

methylotrophic yeast, peroxisome biogenesis is induced by growth on oleate, amine

or methanol P pastoris has two alcohol oxidase (AOX)-encoding genes which allow

it to use methanol as a carbon and energy source The Aox protein resides in the peroxisomes and is induced along with the peroxisome biogenesis Glucose or ethanol can suppress Aox expression and simultaneously induce pexophagy: the autophagic degradation of peroxisomes (for glucose, micropexophagy is induced whereas ethanol

triggers macropexophagy) (Farre et al., 2007; Tuttle and Dunn, 1995)

1.1.2 Molecular basis of autophagy

Autophagy was first identified by TEM imaging in S cerevisiae and later studied extensively in the budding yeast and in animal cells Thus far, 32 ATG genes have

been characterized, which has led to a better understanding of the genetic and

molecular regulation of autophagy (Kabeya et al., 2007; Klionsky et al., 2003),

particularly the formation of autophagy-associated vesicular compartments, such as preautophagosomal structures (PAS), autophagosomes (cytosolic), and autophagic

bodies (vacuolar) (Suzuki et al., 2001) Among the 32 ATG genes, 18 encode proteins involved in autophagosome formation They are ATG1–10, ATG12–14, ATG16–18, ATG29, and ATG31 (Kabeya et al., 2007; Klionsky et al., 2003; Klionsky, 2005, 2007;

Suzuki and Ohsumi, 2007) Atg1-Atg13 complex is required for autophagy induction

(Funakoshi et al., 1997; Kamada et al., 2000) Atg17, Atg29 and Atg31 function together to form the scaffold for PAS organization (Cheong et al., 2005; Kabeya et al., 2007; Kawamata et al., 2005) Two unique ubiquitin-like conjugation systems, Atg8–

phosphatidylethanolamine (Atg8–PE) and Atg12–Atg5, are involved in the biogenesis

of autophagic vesicles (Ohsumi, 2001) Atg7 and Atg10 act as E1 ubiquitin-activating enzyme and E2 ubiquitin-conjugating enzyme, respectively, in Atg12-Atg5

conjugation system (Kim et al., 1999; Mizushima et al., 1998; Shintani et al., 1999)

Atg12-Atg5 conjugate binds another protein, Atg16, to form a multimeric complex

that is functionally important for autophagy (Mizushima et al., 1999) In Atg8-PE

conjugation system, the cysteine protease Atg4 proteolytically removes a C-terminal arginine residue of Atg8, exposing a glycine that is now accessible to the E1-like Atg7, and another E2-like enzyme, Atg3, and eventually conjugated to PE through an

amide bond (Ichimura et al., 2000) Atg6, Atg14 and several Vps proteins form PtdIns

3-kinase complex I that regulates membrane organization during autophagy and the

Cvt pathway (Kihara et al., 2001) Atg18 is recruited to the PAS in a manner that is

dependent on PtdIns 3-kinase complex I and is required for both autophagy and the

Cvt pathway (Guan et al., 2001) Atg9 cycles between the PAS and the additional structures/organelles (Suzuki et al., 2001) Atg2, Atg18, and PtdIns 3-kinase complex

I components are necessary for the retrieval of Atg9 (Shintani et al., 2001), which is triggered by Atg1-Atg13 complex (Reggiori et al., 2004)

The following Atg proteins are specifically essential for the induction of the Cvt

pathway: Atg11 is important for PAS organization (Kim et al., 2001; Suzuki and

Ohsumi, 2007) Atg19 is the cargo receptor protein involved in the Cvt pathway

(Scott et al., 2001) Atg20 and Atg24 bind PtdIns(3)P and belong to the sorting nexin family that functions in protein trafficking from the Golgi to the endosome (Hettema

et al., 2003); and are involved in the Cvt pathway in S cerevisiae (Nice DC et al.,

2002) Like Atg18, Atg21 and Atg27 are also recruited to the PAS in PtdIns 3-kinase complex I-dependent manner Atg21 and Atg27 are primarily required for the Cvt

pathway (Stromhaug et al., 2004; Wurmser and Emr, 2002) Atg23 is needed for Cvt

vesicle completion, and like Atg9, shows punctate localization which includes

localization to the PAS (Tucker et al., 2003)

Following the delivery to the vacuole, the outer membrane of the autophagosome is fused with the vacuolar membrane, which is mediated by the SNARE complex

(Suzuki and Ohsumi, 2007; Wang et al., 2003) Subsequently, the degradation of

autophagic body is dependent on two resident vacuolar proteases, Pep4 and Prb1, and

the acidification of the vacuole (Nakamura et al., 1997; Takeshige et al., 1992) In

addition to these factors, the transmembrane protein Atg15 is also required for lysis

(Epple et al., 2001) Atg22 was identified as a putative amino acid effluxe r(Yang et al., 2006; Yang et al., 2007) that cooperates with other vacuolar permeases, such as

Avt3 and Avt4, independent of these functions, in exporting the monomeric units (e.g amino acids) derived from macromolecule degradation

Some ATG genes are species-specific and only required for some selective autophagy ATG25 encodes a novel coiled-coil protein involved in macropexophagy in

Hansenula polymorpha (Monastyrska et al., 2005) ATG26 encodes a

UDP-glycosyltransferase that is essential for the selective autophagy of large (average peroxisome area > 0.10 µm2) peroxosomes in Pichia pastoris, while not required for

pexophagy in S cerevisiae (Monastyrska et al., 2005; Nazarko et al., 2007) Atg28 is important for both micro- and macropexophagy in P pastoris (Stasyk et al., 2006) Atg30 is essential for pexophagy in P pastoris, regardless of the size of the

peroxisomes or the inducer of the peroxisome biogenesis (Farre et al., 2008) Atg32 is

a membrane-anchored protein that is required for selective targeting of mitochondria

for autophagic degradation in S cerevisiae (Kanki et al., 2009)

1.1.3 Physiological function of autophagy

Although well conserved in eukaryotes, autophagy plays pleiotropic roles including protein / carbohydrate / iron metabolism, cellular development, death or survival, and clearance of invasive pathogens, etc (Codogno and Meijer, 2005; Gannage and Munz,

2009; Kurz et al., 2008; Mizushima, 2005) Rapid progress has been made in research

in the past decade and the biological functions of autophagy in various organisms are detailed here

1.1.3.1 Yeasts

Autophagy-deficient mutants were isolated and characterized in the budding yeast S cerevisiae (Tsukada and Ohsumi, 1993) These mutants showed defects at different

step of autophagy Autophagy-defective budding yeast lost viability during nitrogen

starvation and the homozygous diploids with atg mutation failed to sporulate

Increased pseudohyphal growth was commonly observed in several

autophagy-defective yeast (Cutler et al., 2001; Ma et al., 2007; Tsukada and Ohsumi, 1993)

In contrast, autophagy has been less studied in the fission yeast Schizosaccharomyces pombe A recent report showed that autophagy regulates sexual differentiation in S pombe (Mukaiyama et al., 2009)

1.1.3.2 Filamentous fungi

In Podospora anserina, autophagy is essential for sexual differentiation and cell death

by incompatibility It remains controversial whether autophagy executes a

programmed cell death function or acts as a pro-survival response in P anserina (Dementhon et al., 2003; Dementhon et al., 2004; Pinan-Lucarre et al., 2003a; Pinan- Lucarre et al., 2005) It was initially thought that autophagy triggers cell death during incompatible interactions for it is induced when cells of unlike genotypes fuse in P anserina (Dementhon et al., 2004; Pinan-Lucarre et al., 2003a) However, a recent

study suggests that autophagy serves a pro-survival role during incompatibility, as

loss of autophagy results in accelerated cell death (Pinan-Lucarre et al., 2005)

Autophagy-deficient mutants of M oryzae are non-pathogenic and show highly reduced asexual development (Deng et al., 2009b; Liu et al., 2007b; Veneault-

Fourrey et al., 2006) Autophagy has been proposed to be essential for cell death of

the conidial cells to ensure the successful penetration of the host cuticle

(Veneault-Fourrey et al., 2006) Autophagy is also involved in lipid body turnover and thus is suggested to be essential for turgor generation and appressorium function (Liu et al., 2007b) Similarly, infection structures/appressoria from a CLK1-deletion (an ortholog

of ATG1) mutant in Colletotrichum lindemuthianum, are unable to penetrate the host cuticle (Dufresne et al., 1998) However, Colletotrichum gloeosporioides, with a related infection strategy as M oryzae, does not require autophagic cell death for

successful infection (Nesher et al., 2008) Autophagy is required for the

differentiation of aerial hyphae and in conidial germination in Aspergillus oryzae (Kikuma et al., 2006)

In contrast to its function in fungi mentioned previously, autophagy plays little or no

role in the differentiation of the dimorphic yeast Candida albicans within the host tissue (Palmer et al., 2007) The atg9∆ mutant in C albicans remains unaffected for

yeast-hypha or chlamydospore differentiation, though it shows specific defects in autophagy and the Cvt pathway

1.1.3.3 Plants

In plants, autophagy has been shown to be induced to deal with abiotic stresses

including nutrient starvation (Bassham, 2009), oxidative stress (Xiong et al., 2007a; Xiong et al., 2007b), high salt and osmotic stress conditions (Liu et al., 2009;

Slavikova S et al., 2008) Autophagy contributes to programmed cell death in the unicellular green alga Micrasterias denticulata in response to the biotic and abiotic stress (Affenzeller et al., 2009) Autophagy is also necessary for the proper regulation

of hypersensitive response (programmed cell death) during the plant innate immune

response during pathogen invasion (Hofius et al., 2009) Recent studies showed that

autophagy is involved in various aspects of plant development, including pollen

germination (Harrison-Lowe and Olsen, 2008) and leaf senescence in Arabidopsis thaliana (Wada et al., 2009), and number-control of fertile florets in wheat (Ghiglione

et al., 2008)

1.3.3.4 Animals

Programmed cell death (PCD) occurs during Drosophila melanogaster development

Autophagy genes are induced in dying salivary glands and are essential for the PCD Autophagic PCD is likely regulated by apoptopsis genes and members of the Rho, Rac, and Rab families of small guanosine triphosphatases (GTPases) (Baehrecke, 2003; Martin and Baehrecke, 2004) Likewise, autophagy is essential for promoting cell death in specific cell types during early stages of embryonic development in

mammals (Shimizu et al., 2004; Yu et al., 2004)

Autophagy also plays a key role in host defense against viral and intracellular

bacterial pathogens in animals Overexpression of mammalian Beclin 1 / ATG6 promotes immunity against Sindbis virus infection in mice (Liang et al., 1998)

Induction of autophagy by starvation or rapamycin treatment promotes the

degradation of Mycobacterium tuberculosis within phagolysosomes (Liu and Modlin, 2008; Vergne et al., 2006) Herpes simplex virus (HSV) infection induces autophagy

in mammalian cells (Talloczy et al., 2002; Talloczy et al., 2006) Similarly, the autophagy gene ATG5 is required to degrade invasive group A Streptococcus

(Nakagawa et al., 2004; Takeshita et al., 2008; Yoshimori, 2006)

Recently, the autophagy pathway has emerged as another crucial cellular defence system (in addition to the ubiquitin-proteasome system) against toxic build-up of

misfolded proteins (Chin et al., 2010; Matsuda and Tanaka, 2009) Recent studies

showed that the Parkinson's disease (PD)-linked E3 ligase, parkin, regulates specific induction of autophagy for selective clearance of misfolded and aggregated proteins during proteotoxic stress Dysfunction of Parkin promotes neurodegenerative diseases

including PD (Chin et al., 2010)

1.2 General introduction of endosomal system

1.2.1 Classification and cellular role of endosomes

Endosomes are membrane-bound compartments inside eukaryotic cells They

represent a major sorting compartment of the endomembrane system that integrates vesicular traffic from different sources and sorts cargo for different destinations Endosomes comprise of three different classes: early endosomes, late endosomes and recycling endosomes, and differ in morphology and cargo specificity (Mellman, 1996) Early endosomes consist of a dynamic tubular-vesicular network (vesicles up to 1 µm

in diameter with connected tubules of approx 50 nm diameter) and contain RAB5 and RAB4, with Transferrin and its receptor and EEA1 as markers (Hopkins and

Trowbridge, 1983) Late endosomes are also known as MVBs (multiple vesicular bodies) and are mainly spherical, lack tubules, and contain many closely-packed lumenal vesicles Their markers include RAB7 and RAB9 and mannose 6-phosphate

receptors (MPRs) (Russell et al., 2006) Recycling endosomes are concentrated at the

microtubule organizing center and consist mainly of a tubular network, with RAB11

as a resident marker (Ullrich et al., 1996)

Endomembrane trafficking via endosomes largely involves transport vesicules, so endosomes employ different adaptor proteins and coats to accommodate their multiple functions For example, retromer, one coat/adapter combination (composed of Vps35, Vps26, Vps29, Vps17 and Vps5), mediates recycling of sorting receptors back to the

Golgi apparatus (Hettema et al., 2003) The Endosomal Sorting Complex Required

for Transport (ESCRT) represents another set of coat/adapter combination that is needed for sorting of transmembrane cargo to the vacuole (Hurley, 2008)

Besides being the hub of endomembrane trafficking and protein sorting, the

endosomal system is an essential site for signal transduction, because accumulation of activated receptors and certain signaling components localize exclusively to the endosomes Recent studies in budding yeast revealed that the Gα subunit Gpa1 is present at the endosome, where it interacts directly with both Vps34

(phosphatidylinositol 3-kinase, PI3K) and Vps15 (resembling a Gβ subunit) and stimulates increased production of phosphatidylinositol 3-phosphate (PI3P), and thus

regulates pheromone signaling (Heenan et al., 2009; Slessareva and Dohlman, 2006; Slessareva et al., 2006) In this scenario, assembly and function of G protein subunits

occur at the endosome rather than at the plasma membrane Besides G protein

signaling, Ras/MAPK pathway can also take place at the intracellular membranes,

including endosomes, rather than solely at the plasma membrane (Fehrenbacher et al.,

2009; Mor and Philips, 2006)

As mentioned earlier, Atg6, Atg14 and several Vps proteins form PtdIns 3-kinase (PI3K) complex I that regulates membrane organization during autophagy and the Cvt

pathway (Kihara et al., 2001) These Vps proteins are Vps34 and Vps15 on

endosomes The PI3K Vps34 and its product PI3P on the endosomes are required for

autophagosome formation in yeast (Slessareva et al., 2006) Furthermore, coat protein

complex I (COPI), required for ER-golgi transport and maintenance of

endosomal/lysosomal function, and the ESCRTs localized to the endosomes, are both required for autophagy (Rusten and Stenmark, 2009; Tooze and Razi, 2009) There is some evidence that autophagosomes fuse with early endosomes, which may allow delivery of proton pumps and LAMPs (to acidify the autophagosomes), and

subsequently fuse with late endosomes to get MPRs and thus get directed towards

lysosomes for fusion (Razi et al., 2009) Therefore in multiple steps, endosomal

proteins/complex participate and regulate the autophagy pathway

1.2.2 Physiological function of endosomes

Disruption of endosomal sorting and vesicular trafficking can lead to various

biological consequences In yeast, failure to recycle lysosomal hydrolases receptors, e.g Vps10, results in mislocaliztion of soluble lysosomal hydrolases and thus

attenuated lysosomal degradation (Cooper and Stevens, 1996) Loss of retrieval transport of a vesicle SNAP (Soluble NSF Attachment Protein) REceptor (v-SNARE), Snc1, to trans-golgi network (TGN), may account for defective prospore membrane

(PSM) formation and reduces spore wall layer deposits in yeast (Morishita et al.,

2007) In humans, mucolipidosis (ML) II/III and Niemann-Pick type C1 (NPC1) disease are rare but fatal lysosomal storage disorders caused by defects in endosomal

sorting (Dierks et al., 2009) ML II and the less severe ML III result from deficiencies

of the Golgi enzyme N-acetylglucosamine 1-phosphotransferase leading to a global defect of lysosome biogenesis In such patients, newly synthesized lysosomal proteins are not equipped with the critical lysosomal trafficking marker mannose 6-phosphate, thus escaping from lysosomal sorting at the TGN (Zarghooni and Dittakavi, 2009) NPC1 disease results from NPC1 protein deficiency, which causes lysosomal

accumulation of a broad range of lipids (Kaufmann and Krise, 2008) The NPC 1 protein mainly localizes to late endosomes and is essential for cholesterol

redistribution from endocytosed low density lipoprotein (LDL) to cellular membranes

(Karten et al., 2009) To summarize, endosomal sorting ensures a proper distribution

and maintence of intracellular membrane compartments and their resident proteins in eukaryotic cells

Endosomes also play a role in cellular signaling The G protein signaling occurring on the endosome, executed by Gpa1, Vps34 and Vps15, ensures the yeast responsive to

the pheromone and triggers mating (Slessareva et al., 2006) Vps34 activation by

TOR signal, and the subsequent PI3P production, is critical for autophagy induction

and completion and thus amplifies stress-response (Chang et al., 2009; Gunther et al.,

2005) Disruption of vesicular fusion with late endosomes can impair transcriptional

activation by Gcn4, a global regulator of amino acid biosynthetic genes, in S

cerevisiae, indicating that late endosomes (MVBs) are also likely venues for signal amplification and transduction (Zhang et al., 2008) Notch signaling in Drosophila melanogaster requires endocytosis of the Notch receptor and proteolytic cleavage of

its membrane-anchored domain on the endosome Endocytosis defective mutants displayed developmental abnormalities related to defects in Notch signaling (Fortini and Bilder, 2009) Neurotrophin signaling to sensory nerves in animals is mediated by receptor tyrosine kinases (RTKs) signaling pathway, in which neurotrophins stimulate endocytosis of TrkA in axon terminals and endosomes carrying TrkA to the cell body and activate ERK5 and ERK1/2 pathway induce transcriptional events that promote neuronal growth Disruption of this process enhances lysosomal degradation of TrkA

and thus attenuates gene expression and neurite outgrowth (Bronfman et al., 2007; Wan et al., 2008) Although long regarded as a site for vesicle trafficking and receptor

recycling, the endosomal system is now emerging as an important platform for signal integration and transduction

1.3 Magnaporthe oryzae, the rice blast pathogen

1.3.1 Life cycle of Magnaporthe oryzae

Rice blast disease, caused by the ascomycete Magnaporthe oryzae, is the most

important fungal disease of rice world wide Blast disease is caused exclusively by the

asexual conidiospores of Magnaporthe (Ou, 1985) Asexual reproduction in M oryzae

involves the production of aerial conidiophores followed by the formation of conidia During vegetative growth, mycelia differentiate into aerial hyphae that grow

perpendicular into the air from the vegetative mycelial mat (Lee et al., 2006) Upon

photo-induction some aerial hyphae convert to conidiophores, which are composed of

a stalk with a bulbous swelling at its tip Conidiogenesis in M oryzae is holoblastic

(Cole, 1986), with the apex of the conidiophore swelling to produce the first conidium, followed by the formation of a septum to delimit the conidium The active apical tip moves to the side to produce the next conidium, until three to five conidia are borne sympodially on a mature conidiophore A mature conidium is pyriform and composed

of three cells each containing a nucleus derived from a common mother nucleus (Cole,

1986) M.oryzae conidia are dispersed by air and provide the inoculum for multiple

cycles of infection on the host plant The polycyclic nature of the disease makes

conidiation a key determinant of disease severity (Teng PS et al., 1991)

Upon germination, a conidium differentiates into an appressorium, a dome-shaped structure at the tip of germ tube, which is utilized to enter and colonize the host

(Gilbert et al., 1996; Lee and Dean, 1993) Cytoplasm of the conidia streams into the

nascent appressorium; cells of conidia eventually die and a high hydrodynamic turgor

is generated in the appressorium to facilitate mechanical breach of host surface (Wang

et al., 2005) Once the fungus successfully colonizes its host, it initiates conidiation

within and continues subsequent rounds of pathogenic life cycle (Talbot, 1995)

General schematic representation of the M oryzae life cycle is depicted in Figure 2

1.3.2 Genetic and biochemical regulation of M oryzae conidiogenesis and

pathogenesis

The signaling of the onset of conidiation is poorly understood Thus far, the only

known environmental requirement for M.oryzae conidiation under normal conditions

is exposure of the growing colony to light Recently, light has been shown to exert a

complex regulation on asexual development in M oryzae: blue light (470 nm) acts as

a repressor of asexual development, whereas both blue light and red light (670 nm)

are involved in spore release behavior (Lee et al., 2006)

Apart from environmental cues, some endogenous regulators of asexual development have been identified genetically Using chemical and insertional mutagenesis (Shi and

Leung, 1995), six mutations (designated as con1-, con2-,con4-, con5-, con6- and con7-) have been uncovered with altered conidiogenesis and spore morphology in Magnaporthe Although the epistatic relationship between the CON loci has been deduced (Shi et al., 1998), only CON7 has been cloned and studied functionally (Odenbach et al., 2007) con7 deletion mutant shows reduced conidiation and

produces aberrant conidia (Shi et al., 1998) A recent study found that Con7 is a

transcription factor that regulates several genes essential for conidia formation and

interestingly also controls some transcripts (such as PTH11) important for

appressorium development (Odenbach et al., 2007) Studies on asexual development

in Aspergillus nidulans revealed that the heterotrimeric G-protein signaling is

important for conidiation and that FluG, a small diffusible factor that induces

Figure 2 Schematic representation of Magnaporthe life cycle Magnaporthe

mycelia grow vegetatively, and some of them grow perpendicularly into the air to form aerial hyphae Upon light induction, portion of the aerial hyphae differentiate into conidiophore, recognized by the swelling at its tip in morphology The swelling structure outgrows to form a spindle-shaped, three-nucleared conidium (the asexual spore) and finally delineated by a septum from the stalk After the first conidium is formed, 2-3 more conidia will be formed sympodially per stalk Magnaporthe spreads via conidia When landed on non-host surface, the conidia germinate and grow into mycelia When landed on suitable host surface, conidia germinate and form a dome-shaped structure, the appressorium, at the tip of germ tube Huge turgor is generated within the appressorium and facilitates host surface penetration When managed to colonize the host successful, Magnaporthe initiates the next round of its life cycle by forming conidia again

conidiation, acts interdependently with a Regulator of G-protein Signaling (RGS; FlbA), in conidiophore development (Lee and Adams, 1996) Rgs1, the flbA ortholog

in M.oryzae, is also involved in conidiogenesis, through its interaction with the G subunit MagB (Liu et al., 2007a) Deletion of MAGB locus or a point-mutation that relieves it of Rgs1p regulation, leads to a complete loss of conidiation in M.oyrzae (Fang and Dean, 2000; Liu et al., 2007a) In contrast to the function of Aspergillus

flbA, which has a positive role in activating conidiogenesis, Rgs1p negatively

regulates conidiogenesis in M.oryzae (Liu et al., 2007a) It still remains to be

elucidated how conidiogenesis and the G protein / cAMP- dependent signaling is

controlled mechanistically in M.oryzae

M oryzae conidia attach to the repellent rice surface by releasing an adhesive or mucilage from a compartment in the spore apex, and start to germinate (Hamer et al.,

1988) The germ tube is normally the site and developmental stage in which

perception of the host surface occurs (Beckerman and Ebbole, 1996) Hardness and hydrophobicity are both essential for germ tube extension and differentiation into appressorium The perception of a suitable extracellular signal is mediated by a

putative membrane-bound sensor or receptor, encoded by the PTH11 gene

Pth11-deficient strains are non-pathogenic due to a defect in appressorium differentiation

(DeZwaan et al., 1999) Both the cAMP-dependent signaling pathway and the MAP

kinase cascades are required for appressorium development Deletion of the genes encoding the components in either pathway compromised proper appressorium formation and function (Adachi and Hamer, 1998; Choi and Dean, 1997; Dean, 1997;

Mitchell and Dean, 1995; Tucker and Talbot, 2001; Xu and Hamer, 1996; Xu et al.,

1998; Xu, 2000) Peroxisomal lipid metabolism is essential for the synthesis of

melanin layer in the appressorium, and thus required for M.oryzae pathogenesis

(Ramos-Pamplona and Naqvi, 2006)

1.4 Carbohydrate metabolism and fungal sporulation / pathogenicity

In S cerevisiae, there are two distinct enzymes that are responsible for glycogen

degradation One of them is Gph1, a glycogen phosphorylase, acting in the cytoplasm

to release G1P (glucose 1-phosphate) from glycogen (Hwang et al., 1989) The other

one is Sga1, a vacuolar glucosidase that produces glucose directly from glycogen (Colonna and Magee, 1978; Yamashita and Fukui, 1985) The vacuolar glucose can easily diffuse into the cytoplasm, where it is converted into G6P (glucose 6-phosphate) (Nordlie, 1985) G6P is an important intermediate that can directly participate in glycolysis for ATP production, or convert into G1P to participate in glycogen

synthesis for cellular construction or storage (Jeremy Mark Berg et al., 2002)

Intracellular G6P and G1P levels can modulate Ca2+ homeostasis and thus lead to

significant biological consequences(Aiello et al., 2002) In S cerevisiae, Gph1 is responsible for glycogen degradation during stationary stage (Hwang et al., 1989)

while Sga1-catalyzed glycogen breakdown is sporulation-specific (Colonna and

Magee, 1978) The carbohydrate metabolism in S cerevisiae is subject to regulation

through cAMP (Wingender-Drissen and Becker, 1983), the protein kinases Snf1 and

Pho85 (Wang et al., 2001), and the TOR signalling pathway (Francois and Parrou,

glycogen is quickly degraded (Thines et al., 2000) In M oryzae glycogen

mobilization also appears to be regulated by the cAMP response pathway (Thines et al., 2000) Gph1 and Sga1 are also present in M.oryzae and their activities are

conserved

1.5 Aims and objectives of this study

Conidiation is an important step in M oryzae pathogenic life cycle It provides

suitable inoculum for the pathogen and determines the severity of the disease

However, the genetic and biochemical control of the onset of conidiation, and the regulation of proper morphogenesis during this stage, are poorly understood

Autophagy is a conserved catabolic process in eukaryotic organisms Autophagy plays pleiotropic roles, given particular biological context In this study, I set out to investigate: 1) intrinsic inducter/regulator of Magnaporthe conidiogenesis; 2) possible role of nutrient utilization and/or starvation stimulation during Magnaporthe asexual development; 3) role of autophagy in nutrient catabolism; 4) pleiotropic functions of autophagy during Magnaporthe conidiogenesis and pathogenicity

1.6 Significance of this study

The autophagy gene MgATG8 (hereafter referred as ATG8) was identified in a

forward genetic screen in M oryzae Characterization of atg8∆ mutant reveals that

autophagy is required during asexual development and pathogenesis of M oryzae We found that both nonselective and selective macroautophagy are defective in atg8∆

mutant, among which delievery and hydrolysis of one specific cargo, glycogen, via

macroautophagy, plays an important role in M.oryzae conidiation In Magnaporthe,

cytoplasmic glycogen is wrapped and delivered into the vacuole, and thus escapes

degradation by Gph1 in the cytosol Vacuolar glycogen hydrolysis is triggered by conidiation and catalyzed by Sga1, to provide glucose or other important intermediate product(s) for proper conidiation Thus, this study provides a mechanism by which temporal and spatial regulation of nutrients and membrane dynamics is achieved to control cellular differentiation in an important fungal pathogen of crop plants

CHAPTER II MATERIALS AND METHODS

2.1 Strains, reagents and genetic methods

2.1.1 Magnaporth oryzae strains

M oryzae strains used in this study and their relevant genotype are listed in Table 1

2.1.2 Media and growth conditions

Media used for vegetative growth and conidiation are Complete medium (CM, per liter: Yeast Extract 6 g, Casein Hydrolysate 6 g, Sucrose 10 g, Agar 20 g) or Prune-agar medium(PA, per liter: Prune Juice 40 mL, Lactose 5 g, Yeast Extract 1 g, Agar

20 g) Carbohydrate-supplemented Prune-agar medium for assessing conidiation in

atg8∆ contained lactose (5 g/L) and one of the following sugars: sucrose, glucose, lactose, galactose, or maltose at 10 g/L Minimal medium (MM, per liter: NaNO3 6 g, KCl 0.5 g, MgSO4 0.5 g, KH2PO4 1.5 g, glucose 10 g, trace elements 0.1% (v/v), pH 6.5) and MM-N (for nitrogen starvartion, same composition as MM only lacking NaNO3) are used for inducing autophagy in Magnaporthe Magnaporthe

transformation was carried out by Agrobacterium T-DNA-mediated transformation

for specific replacement of the target genes or random insertions into the genome

To assess the growth and colony characteristics, Magnaporthe isolates were cultivated

on CM agar or PA medium, at 28 °C for a week For quantitative analysis of

conidiation, colonies were cultivated on PA medium in the dark for 2 days, followed

by a 4-day growth cycle under constant illumination at room temperature The surface

of the colonies was then scraped with inoculation loops in the presence of water and the fungal

Table 1 Magnaporthe oryzae strains used in this study

ATG8 complementation ATG8-bar +

/ atg8∆::hph +

GFP-SRL ; pex14∆ GFP-SRL-bar + / pex14∆::hph + This study

GFP-SRL ; PEX1461-361 GFP-SRL-bar + / pex14∆::hph + / PEX1461-361-ilv1 + This study

GFP-SRL; PEX141-258 GFP-SRL-bar + / pex14∆::hph + / PEX141-258-ilv1 + This study

biomass harvested in Falcon™ Conical Tubes (BD Biosciences) The suspension was vortexed thoroughly to ensure maximum detachment of conidia from mycelia, and then filtered through two layers of Miracloth (Calbiochem) Conidia thus collected were washed twice with and finally resuspended in sterile water Conidia production

in a given colony was quantified using a hemocytometer and reported as the total number of conidia present per unit area of the colony [conidia (x 102/cm2)] Two-day old liquid CM-grown mycelia were ground in liquid nitrogen for the isolation of nucleic acids Mycelia used for total protein extraction were obtained by growing the relevant strains in liquid CM for 2-3 days, with gentle shaking, followed by growth in

MM or MM-N for about 16 hours

2.2 Molecular methods

2.2.1 Plasmid vectors for targeted deletion, genetic complementation, and RFP and GFP tagging

Gene-deletion mutants were created using the standard one-step homolog

recombination strategy in M oryzae Genomic DNA fragments (about 1 kb each) representing the 5' and 3' franking sequence of each locus were amplified by PCR, ligated sequentially so as to flank the HPH1 (hygromycin phosphotransferase gene) cassette in pFGL44, or the BAR (bialaphos resistance gene) cassette in pFGL97, or ILV1 (sulfonylurea resistant gene) cassette in pFGL385, respectively The primers

used for the amplification of the 5’ or 3’ flanking sequences are given in Table 2 (the enzyme sites chosen for accommodating the fragments into the vector are underlined)

For genetic complementation of atg8∆, the complete M oryzae ATG8 locus was PCR- amplified as a 3.4 Kb BamHI-XhoI fragment and cloned into the corresponding sites

in pFGL97 with resistance to bialaphos or ammonium gluphosinate (Cluzeau Labo, CA14030000) as a fungal selectable marker The primers used for the amplification of

the ATG8 genomic fragment are given in Table 2

For overexpression of GPH1, the genomic copy of GPH1 coding sequence, along

with its native promoter (about 1 Kb upstream) was amplified by PCR with the primer pair listed in Table 2 The fragment was ligated to pFGL44 and randomly inserted

into the genome of the wild-type strain Transformants with multiple copies of GPH1 (examined by Southern blot) were selected for checking the overexpression of GPH1

(by reverse transcriptase PCR) and further characterization

For expression of RFP-ATG8, the promoter fragment of the ATG8 gene was PCR amplified from genomic DNA from the wild-type strain, and the RFP ORF was amplified with pDSRED monomeric N1 (Clontech, USA) as template The ATG8 complementation construct was digested with PstI and XcaI (both unique sites within the ATG8 locus) to remove the fragment spanning approximately last 500 bp of the promoter and first 72 bp of the coding sequence of ATG8 The resultant vector was then ligated with the PCR-amplified ATG8 promoter (digested with PstI and NdeI) and the RFP ORF (digested with NdeI and XcaI) in one step, so that the newly created plasmid contained an in-frame insertion of RFP ORF at the translational start site within the ATG8 coding sequence while retaining the requisite native regulatory

sequences This plasmid was named as pRFP-ATG8 and introduced as a single-copy

insertion in the atg8∆ strain For ATG8-RFP construct, the 1 Kb fragment just

proximal to the translation stop codon in ATG8 and the RFP coding sequence were amplified respectively and ligated into the KpnI-BamHI sites of the vector pFGL44

Table 2 Oligonucleotide primers used in this study Restriction enzyme sites introduced for cloning purposes are underlined

Gene (Locus) Description Enzyme

KpnI NdeI PstI

-

NdeI BamHI

5’ -GAGAGTGAGGTACCTCGCCCCGCTTCACAGCATCGG-3’ 5’-GAGAGTGCATATGCTCGACTTCCTCAAACAGGT-3’

5’- GAGACTGTTCTGCAGTCTGTCGACGCGGAGTGGATAC-3’ 5’-TAGGGGAGACACA ACCGCAGTA-3’

For RFP ORF:

5’-GAGAGTGCATATGGACAACACCGAG GACGTC-3’

5’-GAGAGTGGGATCCCTACTGGGAGCCGGAGTGGC-3’

N-terminal tagging with RFP

-

NdeI NdeI

Genetic complementation

BamHI XhoI

5’-GAGAGTGAGGATCCTCGGGTTACTTTGTCAGGCCAT-3’ 5’-GAGAGTGACTCGAGTACCTGTCACGAACGCG CGGAA-3’

5’- GAGAGTGTTAAGCTTTCAATGTTACTCTTTGTTTCAC -3’ 5’-GTTTTAACTGCAGAGGAAGAAG-3’

5’- GAGTGAGAATTCGTTATAGTCGTGCGGCCCCGGC-3’

5’-GAGAGTGAGGTACCGGGCGTATATTGGACCGCTAAC-3’ 5’-GAGACTGTTCTGCAGGGTGTAGATGGATCAAGGGGCT-3’ 5’-GAGTGTTAAGCTTGCTGGGCGGGCTTGCTGGGTCG-3’

C-terminal tagging with GFP

XhoI NcoI PstI HindIII

5’-GAGTGACTCGAGCACCTGACAACGCTCGCGGCCG-3’

3’

5’-GAGTGACCCCATGGGTAATGAAACCGCAACCAAAGTTTCCCC-5’-GAGACTGTTCTGCAGTGAGGTCGAGGTTCTTTGTACA-3’ 5’-GAGAGTGTTAAGCTTGTTATAGTCGTGCGGCCCCGGC-3’

genomic DNA encoding AA45-

655 tagging with GFP at C- or N-terminal

EcoRV EcoRV

5’-GAGTGAGATATCTCCCTTGCAAGACGTGCCAATG-3’

3’

5’-GAGTGAGATATCTCATAATGAAACCGCAACCAAAGTTTCCCC-ATG20

(MGG_12832.6)

Deletion construct HindIII

PstI BamHI SacI

5’-GAGAGTGTTAAGCTTGCCGGGGCAACATCTTGTTGCG-3’ 5’-GAGACTGTTCTGCAGGATGGAGCCGCACGGAGCTTAG-3’ 5’-GAGAGTGAGGATCCGTACCGCCGCTACGTGAGAGCG-3’

5’-GAGAGTGTTAAGCTTTCGACGTGCGTTGGAAGACGGG-3’ 5’-GAGACTGTTCTGCAGGTCTAGGCTAGGTCAATTACGC-3’ 5’-GAGAGTGAGGTACCACCGCACATTGGCCGTTCCGAT-3’

5’-GAGTGAGAATTCCCGCCCGCCCTGTGACAATG-3’

cDNA encoding AA61-361

PstI

BamHI

GAGTGACTGCAGCAACAAGATCTTGTTCTCATATCAGCACAAAGAATGAGTGATAGAGAATAATTCAGATTAATCTGCCGCGGTATGCCGGCCGCTTACTCGGCACCAC-3’

5’-5’-GAGTGAGGATCCCTAGCTTGACGCAGGCGGGGTTGCTG-3’

genomic DNA encoding AA1-258

PstI BamHI

5’-GAGTGACTGCAGCAACAAGATCTTGTTTCTCATATCAG-3’ 5’-GAGAGTGAGGATCCCTATGGTGTGGCGGGTCCAGTCATC-3’

The 1 Kb ATG8 fragment immediately downstream of the stop codon was amplified and ligated to flank the HPH1 cassette on pFGL44 (PstI-HindIII) The resultant

pATG8-RFP was transformed into the wild-type Magnaporthe strain to specifically

replace the ATG8 gene with the ATG8-RFP allele For SGA1-GFP construct, GFP coding sequence along with TrpC terminator was released from the plasmid (pFC2- ORF, GFP) by digestion with NcoI and XbaI The 1 Kb fragment just proximal to the translation stop codon in SGA1 was amplified ligated with GFP-TrpC term fragment into pFGL44 in one step The 1 Kb SGA1 fragment immediately downstream of the stop codon was amplified and ligated to flank the HPH1 cassette The plasmid

carrying SGA1-GFP was transformed into Magnaporthe wild-type strain to

specifically replace the SGA1 gene with the SGA1-GFP allele For GFP-tagging of the truncated Sga1, the plasmid carrying GFP under control of MPG1 promoter, (pFC2- ORF, GFP), was digested with BamHI and then end-filled with Klenow enzyme and

ligated in frame to the Sga146-655 coding sequence at the N-terminus The SpeI-XbaI

fragment from this plasmid, containing the MPG1 promoter-GFP-SGA146-655-TrpC

terminator was released and then ligated to pFGL44 and transformed into the wild

type or an atg8∆ strain, respectively For ATG20-GFP construct, the 1 Kb fragment

just proximal to the translation stop codon was in-frame fused with GFP coding

sequence, which was PCR amplified using plasmid pFC2 as template and the fused

fragment was ligated to one side of ILV1 resistance cassette on pFGL385 The 1 Kb

fragment immediately downstream of the stop codon was ligated to the other side of

ILV1 resistance cassette on pFGL385 This construct was introduced into the type M oryzae for C-terminal tagging of ATG20 with GFP For SNC1-GFP construct,

wild-the 1 Kb fragment just proximal to wild-the translation stop codon was fused in-frame with

GFP coding sequence, which was released from the plasmid pFC2, and the fused

fragment was ligated to one side of BAR resistance cassette on pFGL97 The 1 Kb

fragment immediately downstream of the stop codon was ligated to the other side of

BAR resistance cassette on pFGL97 This construct was introduced into the wild-type

M oryzae to tag GFP at the C-terminal of SNC1 gene in its locus The primers used

for RFP and GFP tagging were listed in Table 2

All the plasmid vectors created for gene deletion, genetic complementation, and RFP and GFP tagging are given in Table 3 (specifying the backbone vector chosen and the corresponding fungal selection marker)

2.2.2 DNA techniques

2.2.2.1 DNA extraction

The DNA samples from PCR amplification or enzyme digestion were mixed with 6X DNA loading buffer (50% sucrose, 10% SDS and 0.2% orange G), and loaded into preset agarose gel (1%, containing 0.1 µg/mL ethidium bromide, BioRad, Cat.161-0433) wells After elctrophoresis the size of the nucleic acid bands were compared to that of a 1 kb DNA marker (NEB, Cat.N3232S) The desire bands were excised with sterile razor blades and DNA purification performed by using Extract II kit

(Nucleospin, Cat.740609.250)

2.2.2.2 Recombinant DNA techniques

Restriction and modifying enzymes were from New England Biolabs or Roche Diagnostics and used according to the manufacturer’s instructions

Table 3 Plasmids used in this study

Name Plasmid description

pFGL44 pCAMBIA1300, removing HPH from XhoI site and re-ligating into SalI site

pFGL97 pCAMBIA, removing HPH from XhoI site and re-ligating into BAR BamHI-PstI site

pFGL385 pCAMBIA, removing HPH from XhoI site and re-ligating ILV1 into KpnI-XbaI site

pFGL392 pFGL44, HPH franking with ATG8 5’- and 3’- sequences

pFGL447 pFGL44, HPH franking with 1 Kb fragment just proximal to the translation stop codon of ATG8 in-frame fused with

RFP ORF, and 1 Kb fragment immediately downstream of the stop codon of ATG8

pFGL454 pFGL97 with the fragment containing RFP-ATG8 with ATG8 native promoter and terminator

pFGL455 pFGL97 with the fragment containing genomic locus of ATG8 with its native promoter and terminator

pFGL461 pFGL44, BAR franking with GPH1 5’- and 3’- sequences

pFGL477 pFGL44, HPH franking with SGA1 5’- and 3’- sequences

pFGL479 pFGL97, BAR franking with ATG8 5’- and 3’- sequences

pFGL532 pFGL97, GPH1 with its native promoter and terminator

pFGL536 pFGL44, HPH franking with ATG20 5’- and 3’- sequences

pFGL538 pFGL44, HPH franking with ATG26 5’- and 3’- sequences

pFGL554 pFGL44, HPH franking with PEX14 5’- and 3’- sequences

pFGL555 pFGL385, cDNA encoding PEX14(AA61-361) with PEX14 promoter and TrpC terminator

pFGL556 pFGL385, genomic DNA encoding PEX14(AA1-258) with PEX14 promoter and TrpC terminator

pFGL562 pFGL44, HPH franking with GSK3 5’- and 3’- sequences

pFGL564 pFGL44, HPH franking with GCS1 5’- and 3’- sequences

pFGL567 pFGL44, HPH franking with 1 Kb fragment just proximal to the translation stop codon of SGA1 in-frame fused with

GFP ORF, and 1 Kb fragment immediately downstream of the stop codon of SGA1

pFGL569 pFGL44, fragment containing GFP-SGA1 (AA45-655) with MPG1 promoter and TrpC terminator

Restriction digestion of DNA was carried out at the optimal temeperature using recommended buffers DNA ligation was carried out at room temperature for 45 min

or at 16℃ overnight For plasmid extraction from E coli, the high-speed mini kit

from Geneaid (Cat.PD300) was used The recombinant DNA was examined by nucleotide sequencing (non-radioactive) using the ABI Prism Big Dye terminator method (PE-Applied Biosystems)

2.2.2.3 Genomic DNA extraction from Magnaporthe

The following protocols was used to extract Magnaporthe genomic DNA:

1 Magnaporthe mycelia were allowed to grow in liquid CM with 60 µg/mL

Streptomycin and 100 µg/mL Ampicillin for 2-3 days

2 Mycelia were harvested and ground to a fine powder with liquid nitrogen

3 Genomic DNA was extracted with MasterPure™ Yeast DNA Purification Kit (Epicentre, Cat.MPY03010) following the manufacturer’s instructions

3 The gel was treated with depurination solution (250 mM HCl) for 12 min

Depurination solution was discarded and the gel rinsed with distilled water

4 The gel was soaked in denaturation solution (0.5 N NaOH, 1.5 M NaCl) for 45 min with gentle shaking The denaturation solution was discarded and the gel rinsed with distilled water

5 The gel was covered with neutralization solution for 45 min

6 DNA in the gel was transferred to a Hybond-ECL (Amsterdam) nylon membrane (pre-wet in distilled water and soaked in 10X SSC for 10 min) by setting up a

capillary blot transfer overnight

7 DNA was crosslinked using UV stratalinker 2400 (Stratagene)

8 Prehybridization was done on the membrane for 1 hr at 42 ºC

9 Probe labeling was performed by using the kit from Amersham Briefly, 10 µl DNA (10 ng/µl) was denatured for 5 min in a boiling water bath, and immediately cooled down on ice for 5 min Equivalent volume of labeling reagent was mixed with DNA thoroughly The same volume of glutaraldehyde solution was then mixed thoroughly to the above mixture and incubated at 37 ºC for 10 min

10 Labeled DNA was added to prehybridization buffer and mixed gently to final concentration at 10 ng/mL Hybridization was performed at 42ºC for 6 h to overnight with gentle agitation

11 The membrane was washed with washing buffer I (0.5 X SSC, pH 7.0, 0.4% SDS) twice, with 10 min per wash, at 55ºC The membrane was then washed with washing buffer II (2 X SSC, pH 7.0) twice, with 5 min per wash, at RT

12 Equal volume (3 mL each) of detection reagent 1 and 2 were mixed and added to the blot Pour the mixed detection reagents onto the blot Incubated for 2 min at RT, and excess detection solution drained off

13 The blot was then exposed to the X-ray film for 5 min to 1 h

14 The X-ray film was then developed

2.2.3 RNA technique

2.2.3.1 RNA extraction

1 Magnaporthe mycelia were allowed to grow in liquid CM with 60 µg/mL

Streptomycin and 100 µg/mL Ampicillin for 2-3 days

2 Mycelia were harvested and ground with liquid nitrogen

3 Total RNA was extracted with Qiagen RNeasy mini Kit (Cat.74904) following the manufacturer’s instructions

2.2.3.2 Reverse transcriptase PCR

1 AMV reverse transcriptase (Roche Diagnostics) was used to synthesize cDNA from

2 µg of total RNA

2 RT-PCR products were amplified using primers designed (Table 2)

3 To serve as a loading control, TUBULIN (MGG_00604.6) was amplified from the

synthesized cDNA (Primers in Table 2)

2.2.3.3 Quantitative Real-time PCR (qRT-PCR)

1 AMV reverse transcriptase was used to synthesize cDNA from 2 mg of total RNA Following the reverse-transcription, DEPC-treated H2O is added to the samples to bring the cDNA concentration to 20 ng/µl

2 A real-time PCR reaction mixture was 10 µl Following mixtures were prepared in each optical tube: 5 µl SYBR Green mix (2x; ABI), 1 µl cDNA, 1 µl primer pair mix (5 pmol/mL), 3 µl H2O

4 ABI Prism SDS 7900HT was used to run the real-time PCR program The

comparative Ct method (or ∆Ct) was used to assess relative changes in mRNA levels

between the wild-type Magnaporthe colonies at different stages of life cycle

2.2.4 Bacterial transformations

2.2.4.1 Transformation of E.coli by heat shock method

1 100-200 µl E.coli competent cells were thawed on ice

2 10µl of DNA was mixed with the cells

3 Cells were heat shocked at 42 ºC for 90 sec and chilled on ice for 2 min

4 Cells were recovered in 1 mL of LB (per liter: Bacto-Tryptone 10 g, Bacto-yeast extract 5 g, NaCl 10 g, pH 7.0) medium for 45 min, at 37 ºC with 250 rpm shaking

5 Cells were peleted and plated on LB agar medium with Kanamycin or Ampicillin and incubated at 37 ºC overnight

2.2.4.2 Electroporation of Agrobacterim (AGL1 strain)

1 Frozen AGL1 competent cells (50 µl aliquots) were thawed on ice

2 1-2 µl of DNA was mixed with the cells

3 Electroporation with Bio-Rad MicroPulser® at 1.8 kV for 4.5-5 msec

4 Cells were allowed torecover in 1 mL of LB liquid medium for 45 min, at 28 ºC with shaking at 250 rpm

5 Cells were collected by centrifugation and plated on LB agar medium with Kanamycin and incubated at 28 ºC for 2 days

2.2.5 Agrobacterium-mediated transformation of Magnaporthe

1 AGL1 (with appropriate plasmid) grown overnight in LB medium containing 100

µg/mL kanamycin at 28 ºC with gentle shaking