CROSSTALK BETWEEN CRP AND FICOLINS REGULATES INNATE IMMUNITY 1

TABLE OF CONTENTS Page Acknowledgements i Table of Contents ii Summary vii List of Tables ix List of Figures x List of Abbreviations xiv List of Primers xviii Flow Chart xxiii CHAPTER

CROSSTALK BETWEEN CRP AND FICOLINS

REGULATES INNATE IMMUNITY

NUS GRADUATE SCHOOL FOR INTEGRATIVE SCIENCE AND

ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE

2010

ACKNOWLEDGEMENTS

I would like to thank my supervisors, Prof Ding and Prof Ho, for the opportunity and the guidance that they have given to me not only for science but also for life They have been great teachers and I have learnt so much from them I would like to especially thank Prof Ding for her painstaking and dedicated effort in imparting the many important skills that a researcher should possess I would also like to thank Prof Lu Jinhua, who is my thesis advisory member, for his suggestions and guidance to

my research all through the four years

I would like to express my gratitude to my mentors, Dr Ng Miang Lon, for sharing their years of experience and insights on research with me in my first year of phD study, most of which I can never learn from books Special thanks also go to Dr Jason Goh for help with the rFBG expression and purification.  

I would also like to thank Prof Steffen Thiel (University of Aarhus, Denmark)  for providing me ficolin proteins&clones that have been used in this thesis and giving me comments and suggestions about my experimental design and paper drafting; Prof Teizo Fujita (Fukushima Medical University, Japan) for providing L-ficolin and H-ficolin cDNA plasmids; Prof Anna Blom (Lund University, Sweden) for the C4BP protein Dr Cynthia Yingxin He for the help with the realtime imaging; Dr Ganesh Anand for the help with hydrogen deuterium exchange; Dr Yang Lifeng for the help with the computational modelling and Dr Andrew Tan for useful discussion about experimental design It has been a great pleasure to collaborate with Prof Thiagarajan PS and Liu Bing to study the systematic function of C4BP

I would like to express my sincere thanks to the many former and present lab mates, Li Yue, Li Peng, Xiaowei, Nancy, Patricia, Belinda, Agnes, Diana, Sebastian, Siow Ting, Xiaolei, Sun Miao, Zehua, Jianing, Joanne, Guili, Cheryl, Imelda, Ruijuan, Yuan Quan, Peng Jun, Lifeng, Lin Bing, Shirly, Sia Lee, Soon Kok, Marianne, Sash, Porkodi, Cuicui, Rebecca, Zhiwei, Neha, Karthik, Fengting, Glenn, SunYe, Maz and Thuyen I would like to express my gratefulness to many of them for always sharing their thoughts and lending their hands, ears and eyes to my work during my years of confusion and revelations here and to some of them for being such great lunchtime buddies! Special thanks also go

to ficolin group members, who have been always inspiring me and giving me countless suggestions during my phD study

Many thanks also go to Michelle, Denise, and Xianhui, who have taught and helped me with my analysis of the mass spectrometry data; Tong Yan and Xiao Yong who helped me with confocal microscope ; Subha who came to my rescue when I got stuck with a problem in the lab

Most importantly, I would like to thank my family: Dad, Mom, and my hubby, Dong Bo and my parents-in law for all the joy, love and encouragement

I would especially like to thank my husband, Dong Bo for always being there for me, and for always

trusting me

This thesis is dedicated to my Dad and Mom for all the years of love

Thank God for his continuous unfailing love

TABLE OF CONTENTS

Page Acknowledgements i Table of Contents ii Summary vii List of Tables ix

List of Figures x

List of Abbreviations xiv

List of Primers xviii Flow Chart xxiii CHAPTER 1: INTRODUCTION ··· 1

1.1 Immune sentinels for bacteria recognition in human ··· 1

1.1.1 The innate immune system shapes the adaptive immune system ··· 2

1.1.2 Pathogen-associated molecular patterns ··· 5

LPS ··· 5

GlcNAc ··· 8

Phosphocholine ··· 10

1.1.3 The innate immune system uses pattern recognition receptors ··· 12

C-reactive protein ···18

Ficolins ···20

1.1.4 The ancient origin of PRR interactomes ··· 25

1.1.5 Non-self recognitions by human PRRs and the formation of PRR:PRR interactomes 28 1.2 Innate immune responses to combat the pathogens ··· 30

1.2.1 Extracellular responses ··· 32

Complement pathways ···32

Other extracellular innate immune responses: Coagulation & prophenoloxidase activating system ··· 36

1.2.2 Intracellular responses ··· 40

NF-kB activation ···40

Opsonization and phagocytosis ···42

1.3 Infection-inflammation conditions and immune response ··· 46

1.4 Aims and Rationale of experimental approaches ··· 47

CHAPTER 2: MATERIALS AND METHODS ··· 51

2.1 Materials ··· 51

2.1.1 Organisms ··· 51

2.1.2 Biochemicals and enzymes ··· 52

2.1.3 Medium and agar··· 54

2.2 Purification of native serum type ficolins ··· 55

Native L-ficolin ··· 56

Native H-ficolin ··· 56

2.3 Expression and purification of recombinant M-ficolin and FBG ··· 57

2.4 Analysis of the purified proteins ··· 58

2.4.1 Bradford protein assay ··· 58

2.4.2 SDS-PAGE and Western blotting immunodetection ··· 58

2.4.3 Silver staining ··· 59

2.4.4 Mass spectrometry ··· 60

2.5 Simulation of “normal” and “infection-inflammation conditions ··· 60

2.6 In vitro bacterial killing assay ··· 61

2.7 Protein:protein interaction assays ··· 62

2.7.1 ELISA ··· 62

2.7.2 Surface Plasmon Resonance (SPR) ··· 64

2.7.3 Co-immunoprecipitation (Co-IP) ··· 64

2.8 Cell culture and transfection ··· 65

2.8.1 Isolation of primary monocytes from buffy coat ··· 65

2.8.2 Cell culture ··· 65

2.8.3 Transfection by Lipofectamine 2000 ··· 66

2.8.4 Transfection by Nucleofection ··· 66

2.8.5 Transfection by DOTAP ··· 67

2.9 Complement activity assay ··· 67

2.9.1 C4 cleavage assay ··· 67

2.9.2 Phagocytosis assay ··· 68

2.9.3 C3 deposition assay by flow cytometry ··· 69

2.10 Effect of C4BP on the complement pathway under infection- inflammation condition ··· 70

2.10.1 Manipulation of C4BP level in the serum ··· 70

2.10.2 Complement measurement by pull-down with GlcNAc- and PC-beads ··· 71

2.11 Functional study of CRP:M-ficolin complex formation ··· 71

2.11.1 PAMP stimulation ··· 71

2.11.2 RNA extraction ··· 72

2.11.3 Reverse Transcription PCR ··· 73

2.11.4 Meaurement of cytokine production ··· 74

2.12 Localization of M-ficolin ··· 74

2.12.1 Cell surface protein extraction ··· 74

2.12.2 Immunofluoresence localization of M-ficolin by GFP labeling ··· 75

2.12.3 Immunofluoresence localization of M-ficolin by antibody staining ··· 75

2.12.4 Flow cytometric detection of M-ficolin ··· 75

2.13 Assay of NF- κB activity assay mediated by M-ficolin ··· 76

2.13.1 Dual luciferase assay ··· 76

2.13.2 Electrophoretic Mobility Shift Assay (EMSA) ··· 77

2.13.3 Testing the specificity of NF-κB activation by inhibitors ··· 77

2.14 Screening for interaction partner of M-ficolin ··· 78

2.14.1 Amplification and purification of human leukocyte double-stranded cDNA library 78 2.14.2 Cloning of bait genes into pGBKT7 ··· 78

2.14.3 Yeast-two hybrid screening assay ··· 79

2.15 In vivo protein interaction assay ··· 81

2.15.1 In situ proximity ligation assay (PLA) ··· 81

2.15.2 Co-localization assay of M-ficolin and GPCR43 ··· 82

2.15.3 Yeast three hybrid to confirm the formation of ternary complex between M-ficolin, CRP and GPCR43 ··· 83

2.16 Characterization of binding sites between CRP and M-ficolin ··· 84

2.16.1 Hydrogen deuterium exchange mass spectrometry (HDMS) ··· 84

2.16.2 Computational prediction of binding sites between CRP and M-ficolin ··· 87

Molecular Dynamics simulation ···87

Zdock and Rdock ···88

2.16.3 Site-directed mutagenesis ··· 88

CHAPTER 3: RESULTS ··· 90

3.1 Characteristics of endogenous CRP levels in healthy and patient sera and purified CRP proteins ··· 90

3.2 Purity of the three purified ficolins ··· 93

3.2.1 Purity of the purified native L-, H- ficolins ··· 93

3.2.2 Purify of the expressed and purified M-ficolin and FBG domains of L- and M- ficolins··· 94

3.3 Definition of the “normal” and “infection-inflammation conditions” ··· 95

3.4 CRP interacts with L- and M-ficolins but not H-ficolin ··· 96

3.5 Characterization of CRP:L-ficolin ··· 99

3.5.1 The CRP binding region is delineated to FBG domain of the L-ficolin ··· 99

3.5.2 CRP and L-ficolin interaction is pH- and calcium- sensitive ··· 100

3.5.3 Infection-inflammation triggers CRP:L-ficolin interaction ··· 103

3.6 Functional significance of CRP:L-ficolin interaction ··· 105

3.6.1 CRP:L-ficolin triggers two autonomous amplification pathways ··· 105

3.6.2 CRP:L-ficolin upregulates opsonization and phagocytosis ··· 106

3.6.3 CRP:L-ficolin interaction increases C3 deposition to enhance killing of P aerogninosa ···109

3.6.4 CRP:L-ficolin crosstalk integrates the classical and lectin complement pathways to enhance antimicrobial activity ··· 112

3.6.5 Synergism between CRP:L-ficolin under infection-inflammation condition enhances bacterial killing ··· 114

3.7 The differential inhibitory effect of C4BP on the lectin pathway and classical pathway ··· 119

3.8 Characterization of CRP:M- ficolin ··· 123

3.8.1 Infection-inflammation condition enhanced CRP:M-ficolin binding affinity by 100-fold ··· 123

3.8.2 CRP interacts with M-ficolin via FBG domain ··· 124

3.8.3 CRP and M-ficolin interaction is pH- and calcium- sensitive ··· 125

3.9 M-ficolin activates signal transduction in the immune cells ··· 128

3.9.1 Secreted M-ficolin associates with the immune cell membrane ··· 128

3.9.2 M-ficolin mediates NF-κB activation ··· 131

3.9.3 M-ficolin is localized to the cell membrane by association with GPCR43 ··· 136

3.9.4 The M-ficolin association with GPCR43 is physiologically relevant ··· 141

3.10 CRP collaborates with M-ficolin to regulate IL-8 secretion ··· 142

3.10.1 CRP, M-ficolin and GPCR43 form a ternary complex ··· 143

3.10.2 CRP regulates M-ficolin-mediated IL-8 secretion ··· 145

3.11 The molecular mechanisms underlying the pH- and calcium- sensitive formation of CRP:M-ficolin interaction ··· 147

3.11.1 Identification of binding interfaces between M-ficolin:CRP under infection- inflammation condition ··· 148

3.11.2 Infection-inflammation condition of low pH and calcium expands M-ficolin structure and enhances its interaction with CRP ··· 154

3.11.3 Computational modeling of pH- and calcium- dependent CRP:M-ficolin interaction ··· 160

3.11.4 Localization of the exact binding sites of CRP on M-ficolin ··· 163

3.11.5 The biological implications of the pH- and calcium- sensitive interaction between CRP and M-ficolin ··· 167

3.11.6 M-ficolin on monocytes attracts and induces monocyte clustering, regulated by CRP ··· 171

3.12 CRP does not interact with H-ficolin ··· 174

CHAPTER 4: DISCUSSION ··· 176

4.1 The functional divergence of L- and M-ficolins in evolution ··· 177

4.2 CRP:L-ficolin interaction connects the classical and lectin complement pathways and boost the antimicrobial activity ··· 179

4.3 M-ficolin connects the extracellular surveillance to the intracellular signal transduction ··· 182

4.4 Molecular basis for anti- and pro-inflammatory roles of CRP through its interaction with M-ficolin ··· 186

CHAPTER 5: GENERAL CONCLUSION AND FUTURE PERSPECTIVES ·· 189

5.1 Conclusion ··· 189

5.2 Future perspectives ··· 194

SUMMARY

Early detection and efficient removal of virulent pathogens are fundamental to host survival Although C-reactive protein (CRP) and ficolins have long been known to independently initiate the classical and lectin complement pathways respectively under physiological condition, how they function under pathophysiological condition remains poorly understood This thesis reports that a defined local “infection-inflammation condition” induced a 100-fold increase in the interaction between CRP and L-ficolin This leads to communication between the classical and lectin pathways from which two amplification events emerged Assays for C4 deposition, phagocytosis, and protein competition have consistently proven the functional significance of the amplification pathways in boosting the complement-mediated antimicrobial activity This was again

supported by the effective killing of P aeruginosa in the plasma under defined local

infection-inflammation condition, where powerful antimicrobial activity is provoked by CRP:L-ficolin interactions Therefore, we conclude that the local infection-inflammation

condition triggers a strong CRP:L-ficolin interaction, eliciting autonomous

complement-amplification pathways which co-exist with and reinforce the classical and lectin pathways Similar to L-ficolin, the M-ficolin was found to interact with CRP in a pH- and calcium-dependent manner However, their biological consequences are divergent We found that M-ficolin, overcomes its lack of membrane-anchor domain by docking constitutively onto a monocyte transmembrane receptor, GPCR43, to form a pathogen sensor-cum-signal transducer On encountering microbial invaders, the M-

ficolin:GPCR43 complex activates the NF-κB cascade to upregulate IL-8 production We

showed that mild acidosis occurring at the local site of infection triggers a strong

interaction between the CRP and the M-ficolin:GPCR43 complex This ternary complex

curtails IL-8 production, thus, preventing immune over-activation Our finding implies a possible mechanism which the host employs to expand its repertoire of immune function-cum-regulation tactics by promiscuous protein-protein networking To understand the

detailed mechanism of low pH- and low calcium- triggered CRP:M-ficolins interaction,

we delineated the precise binding interface between M-ficolin and CRP We found that the flexible C-terminus of the fibrinogen-like (FBG) domain of M-ficolin undergoes dramatic conformational change under acidosis and hypocalcaemia, which exposes

unique motifs to augment its interaction with CRP In silico analyses indicate that in

contrast to normal condition, under infection-inflammation condition, the relocation of CRP binding site to the conserved pathogen sugar-ligand binding pocket and a

simultaneous 100-fold increase in the affinity of M-ficolin:CRP complex might diverge

the M-ficolin from pathogen recognition This conformational change possibly helps to restore homeostasis Therefore, infection-induced microenvironment perturbations act as

a molecular switch to transform the FBG domain conformation and regulate its function Overall, we have demonstrated that both the L- and M- ficolins interact with CRP to send the extracellular environmental cues into the cell to elicit intracellular immune response This explains the intrinsic necessity to have two different ficolin isoforms, the L- and M- ficolins, each with high homology in our human body Our findings provide new molecular insights into the host immune response to infection under infection-inflammation conditions Our precise delineation of the interaction interface between

CRP and M-ficolin will be useful for the future development of immunomodulators (492

1.2 The tissue distribution, ligand spectrum and functions of

different ficolin isoforms in different species 24

CHAPTER 3

3.1 The potential interaction partners of M-ficolin screened from

3.4 Parameters for computational simulation and docking analysis 162

LIST OF FIGURES

Figure No Title Page

CHAPTER 1

1.1 The course of a typical acute infection cleared by immune reaction 4

1.2 Schematic diagram of the cell wall of Gram-neagative bacteria and

1.3 Schematic diagram of the LPS induced immune signal transduction 8

1.4 Chemical structure of GlcNAc, a critical component of PAMPs 9

1.5 Schematic and chemical structure of phosphatidylcholine 12

1.6 The schematic picture of the structures of collectin and ficolins 14

1.7 Molecular structure of human pentameric calcium-binding CRP 20

1.8 Structural and sequence analysis of ficolins 21

1.9 Summary of the PRR:PRR interactomes in horseshoe crab 27

1.10 Cascade of innate immune response to combat the invading

1.11 The three distinct pathways of complement activation 35

1.12 Induction of prophenoloxidase (proPO) cascade in invertebrate

1.13 Schematic representation of an activation of Fcγ receptor pair 44

1.14 Receptor and signaling interactions during phagocytosis of microbes 45

CHAPTER 2

2.1 BD Matchmaker™ Two-Hybrid System 3 Vector map of bait vector

2.2 Schematic picture of yeast two hybrid screening process 80

2.3 An overview of Proximity Ligation assay 82

2.4 The schematic picture of the three-hybrid system 84

2.5 The concept and experimental procedure of hydrogen-deuterium exchange

CHAPTER 3

3.1 The CRP level in the blood of patients diagnosed with infection

compared to normal healthy individuals 91

3.3 SDS PAGE (under reducing conditions) to detect the purified native

3.4 Stable expression of rL-FBG, rM-FBG, M-ficolin-His and M-ficolin

and by HEK293T followed by purification and subsequently analyzed

3.8 Infection-inflammation triggers CRP and L-ficolin to form complex

3.9 Downstream functional analysis of amplification pathways 1 and 2

3.10 The phagocytosis assay of the opsonized beads generated in

amplification pathways 1 and 2 under infection-inflammation

3.11 The connection of the classical pathway and lectin pathway as a

3.12 Crosstalk between CRP and ficolins generated more C3 deposition

on the P aeruginosa under the infection-inflammation condition 111 3.13 Co-existence of the amplification pathways and the classical and

3.14 Real-time observation of the bacterial killing effect of serum under

normal (pH 7.4, 2.5 mM calcium) or infection-inflammation condition

3.19 Dose-dependent binding of rM-FBG to CRP was shown by ELISA 124

3.20 SPR analysis of and the binding of rM-FBG to CRP 125

3.21 CRP and M-ficolin interaction is pH and calcium sensitive 127

3.23 Detection the expression of M-ficolin in primary monocytes, U937,

3.24 Localization of M-ficolin in HEK293 and COS-1 cells after transfection

3.25 The localization of M-ficolin (MFL, red) in primary monocytes was

tracked by anti-M-ficolin with or without permeation with

3.26 Detection of M-ficolin on the surface of the monocytes 131

3.27 Dose-dependent binding of M-ficolin to the membrane extract of PBMCs

3.28 M-ficolin mediates IL-8 secretion upon PAMP/sugar stimulation 134

3.29 IL8 expression in wildtype and M-ficolin- U937 cells when stimulated

with 10 ng/ml PGN, LTA, LA, ReLPS and LPS 134 3.30 RANTES secretion by monocytes stimulated with 100 mM GlcNAc,

3.31 Effect of FBS on the expression of IL-8 135

3.32 M-ficolin mediates IL-8 upregulation through NF-κB pathway 135

3.33 Yeast-two hybrid to identify that GPCR43 is the potential interacting

3.34 PLA to identify the in situ interaction between GPCR43 and M-

ficolin in co-transfected HEK 293 cells and purified PBMCs 140 3.35 Co-localization of M-ficolin-GFP (green) and GPCR43-m-

Cherry (red) in HEK 293 cells by fluorescence microscopy 140 3.36 Delineation of the interaction domains of M-ficolin on GPCR43

3.37 The collaborative effect of M-ficolin and GPCR43 on the NF-κB

activation in HEK293 cells upon GlcNAc stimulation 142 3.38 Identification of the ternary complex between CRP, M-ficolin

3.39 PLA to identify the interactions of GPCR43:M-ficolin,

GPCR43:CRP and CRP:M-ficolin in PBMCs at pH 7.4 and pH 6.5 144 3.40 The effects of CRP-depleted or CRP-containing FBS on GlcNAc

-induced IL-8 secretion at pH 7.4 and 6.5 146 3.41 The effect of CRP on regulating the expression of IL-8 in wildtype

3.42 HDMS kinetic curves for deuterium incorporation of individual

peptide fragments for rM-FBG 152

3.44 HDMS kinetic curves for deuterium incorporation of individual

3.46 HDMS kinetic curves for deuterium incorporation of individual

3.47 Schematic illustration of the positions of the pH and calcium

sensitive regions on FBG at pH 6.5 and pH 7.4 identified by HDMS 157 3.48 The pH sensitive regions are highlighted (brown and red) in the crystal

3.49 The calcium sensitive regions are highlighted (purple color) in the

3.50 pH-sensitive and calcium-sensitive regions are highlighted on the

primary sequence of rM-FBG (M-ficolin115–M-ficolin326) 160 3.51 Simulated structures of FBG under physiological and

3.52 Computational docking model of rM-FBG (red); CRP (blue) at

physiological and pathophysiological conditions, optimized

3.53 Location of the possible critical binding sites on M-ficolin that might

regulate its pH and calcium sensitive interaction with CRP 166 3.54 ELISA to test the binding affinity between the FBG mutants

3.55 CRP inhibited the pathogen recognition of M-ficolin 170

3.56 Sequence alignment of M-ficolin homologues (from 284-305), with

3.57 Real-time observation of the directional movement of primary

monocytes towards the area of high concentration of pathogens and the trapping of bacteria amongst the cell cluster 173 3.58 Enumeration of bacteria attached to the cell surface at

5.1 A model to illustrate the mechanism for L- and M-ficolin-mediated

signal transduction via their interaction with CRP 193

MALDI-TOF Matrix-assisted laser desorption ionization-Time of flight

MASP Mannose Binding Lectin (MBL)-associated serine

protease

NHS N-hydroxylsuccinimide

PC Phosphocholine

PEG Polyethylene Glycol

ReLPS Lipopolysaccharide that is truncated to the “e” portion of

R-polysaccharide Core-polysaccharide

v/v Volume/volume

w/v Weight/volume

YPDA Yeast extract, peptone, dextrose, adenine

PACT25122D AGTGAACTTGCGGGG

TTTT TCA GTA TCT ACG A

Reverse primer for library construction

Reverse primer for M-ficolin with BamH1 restriction site at the end (for cloning into EGFP-N3 vector)

CCAGGCGGCAGCCTG

T

Forward primer of L-ficolin with EcoRI side at the end Sequence starting from the first amino acid after the secretion peptide

BamHILFBGF CGGGATCCTACCGCG

TACCTGCAAGGACCT

Forward primer for L-ficolin with BamHI restriction site at the end EcoR1LFBGR CCGGAATTCCGGCAG

Forward site-directed mutagenesis primer for mutating Lys 259 into Ala in M-ficolin

M _ lys259R CACATCATTGTCTTGG

TCTGCGGTGGAGAAGAAGTTGTTG

Reverse site-directed mutagenesis primer for mutating Lys 259 into Ala in M-ficolin

M _ phe274F CTTCGAATTGTGCTGA

GAAGGCCCAGGGAGCCTGGTGGTAC

Forward site-directed mutagenesis primer for mutating Phe 259 into Ala in M-ficolin

M _ phe274R GTACCACCAGGCTCC

CTGGGCCTTCTCAGCACAATTCGAAG

Reverse site-directed mutagenesis primer for mutating Phe 259 into Ala in M-ficolin

M _ gln275F GAATTGTGCTGAGAA

GTTCGCGGGAGCCTGGTGGTACGCC

Forward site-directed mutagenesis primer for mutating Gln 259 into Ala in M-ficolin

M _ gln275R GGCGTACCACCAGGC

TCCCGCGAACTTCTCAGCACAATTC

Reverse site-directed mutagenesis primer for mutating Gln 259 into Ala in M-ficolin

M _ his284F GGTGGTACGCCGACT

GTGCTGCTTCAAACCTCAATGG

Forward site-directed mutagenesis primer for mutating Gln 259 into Ala in M-ficolin

M _ his284R CCATTGAGGTTTGAA

GCAGCACAGTCGGCGTACCACC

Reverse site-directed mutagenesis primer for mutating His 284 into Ala in M-ficolin

M _ leu293F CCTCAATGGTCTCTAC

GCCATGGGACCCCATGAG

Forward site-directed mutagenesis primer for mutating Leu 293 into Ala in M-ficolin

M _ leu293R CTCATGGGGTCCCAT

GGCGTAGAGACCATTGAGG

Reverse site-directed mutagenesis primer for mutating Leu 293 into Ala in M-ficolin

Yeast two hybrid

GGGCCACAGCT

Reverse primer for cloning CRP into pGADT7and pGBKT7 with Sma1 restriction site at the end of the primer

GGACAGAGCTGT

Forward primer for cloning L-ficolin into pGADT7and pGBKT7 with EcoR1 restriction site at the end of the primer

8BamLFCNBR CGGGATCCCTCACTA

GGCAGGTCGCACCTTCAT

Reverse primer for cloning L-ficolin into pGBKT7 with BamH1 restriction site at the end of the primer

9NdeHFCNF GGAATTCCATATGGA Forward primer for cloning H-ficolin

GCTGTTGTG

Forward primer for cloning CRP into pGADT7with EcoR1 restriction site at the end of the primer

13BamCRPAR CGGGATCCTTATCAG

GGCCACAGCT

Reverse primer for cloning CRP into pGADT7 with BamH1 restriction site at the end of the primer

14MFL-pcDNA-F(BamH1)

CGGGATCCACATGATGGAGCTGAGTGGAG

Forward primer for cloning M-ficolin into pcDNA 3.1 with BamH1 restriction site at the end of the primer

15MFL-pcDNA-R(Xba1)

GCTCTAGAGGCGGGCCGCACCTTCATCTCT

Reverse primer for cloning M-ficolin into pcDNA 3.1 with Xba1 restriction site at the end of the primer

Yeast three hybrid

Reverse primer for pBridge vector Primer binding sites localize at 827-843 pBridge-MCS2-

F

TATGACGTGCCTGACTATGCCAGC

Forward primer for pBridge vector upstream of MCS2 cloning site

pBridge-MCS2-R

GCAACACCTGGCAATTCCTTACCT

Reverse primer for pBridge vector downstream of MCS2 cloning site MFL-97-

EcoRI(F)

CCGGAATTCTGTCCAGAGGTGAAGGTGGTG

MFL into pBridge MCS 1, forward primer

MFL-97-EcoRI(R)

CGCGGATCCGCTAGGCGGGCCGCACCTTCA

MFL into pBridge MCS 2, forward primer

MFL-981-BglII(R)

GAAGATCTCTAGGCGGGCCGCACCTTCAT

MFL into pBridge MCS 2, reverse primer

CRP-55-EcoRI(F)

CCGGAATTCCAGACAGACATGTCGAGGAAG

CRP into pBridge MCS 1, forward primer

CRP-675-BamHI(R)

CGCGGATCCGTCAGGGCCACAGCTGGGGTT

CRP into pBridge MCS 2, forward primer

CRP-675-BglII(R)

GAAGATCTTCAGGGCCACAGCTGGGGTTT

CRP into pBridge MCS 2, reverse primer

VECTOR OR ANCHOR PRIMERS

Forward primer for colony screening of pGADT7-cDNA clones

pGAD-nt2049r GTATCGATGCCCACC

CTCTAGAGGCCGAGGCGGCCGACA

Reverse primer for colony screening of pGADTy-cDNA clones

FLOW CHART

Chapter 1 Introduction

CHAPTER 1: INTRODUCTION

1.1 Innate Immune sentinels for pathogen recognition in human

Infectious diseases caused by a broad range of pathogenic microbial agents can be

overwhelming and sometimes fatal to the host (Eisen et al 2003; Seelen et al 2005)

Therefore, in the constant war between metazoans and invading pathogens, timely and accurate recognition of pathogen by various formidable defense strategies developed in the human body during evolution is crucial and fundamental to our survival To achieve this, an ominipotent defense system, which is broadly categorized as innate or adaptive immunity, to discriminate between self and non-self has evolved Our integrated immune systems represent a highly effective arsenal of weapons awaiting any intruder Innate immunity, speculated to predate the adative immune response and a teleologically ancient system of microbial recognition

(Medzhitov et al 1997), rapidly acts on the intruding pathogenic microbes by its

combinatorial usage of a constant number of germ-line-encoded receptors known as the pattern recognition receptors (PRRs) to recognize structural components of

microorganisms (Medzhitov et al 1997) Therefore, it constitues a major pillar in

immune recognition and defense against a wide spectrum of microbial pathogens On the other hand, the adaptive immune system is only present in vertebrates and cartilaginous fish and relies on the clonal expansion of the selected antigen-specific

effector cells for gene rearrangement (Medzhitov et al 2000) The adaptive immunity

usually responds slower than the innate immunity, although it is commonly believed that stronger attacks against the invading microorganisms are mounted during the activation of adaptive immunity Over all, the innate immunity and the adaptive immunity integrated into an intact sophisticated host immune system where innate immunity serves as a rapid and efficient frontline defense strategy

1.1.1 The innate immune system shapes the adaptive immune system

The adaptive immune system employs a wide range of molecules for its activities These include secreted and circulating antibodies, antigen specific B cell receptors and T cell receptors These molecules are normally synthesized by and reside within the cytoplasm and are presented on the surface of T lymphocytes and B lymphocytes

(Takeda et al 2003) When the bacteria invade, short peptides generated from the

bacterial protein by the macrophages are displayed on the surface of macrophage and

B cells by associating with major histocompatibility complex Various membrane bound T cell receptors with single specificity recognize a specific peptide epitope contained within the complex of the antigen and major histocompatibility complex

(Medzhitov et al 2000) and stimulate the B cells which may further differentiate into

plasma cells The stimulated B cells will secret soluble forms of immunoglobulins

recognizing and binding to the specific antigens and activate the classical complement pathway Ligand binding of B cell receptors or T cell receptors leads to the initiation of signal transduction pathways and expression of cytokines, chemokines and adhesion molecules to boost the immune response

The adaptive immune system is only triggered when an infection eludes or overwhelms the innate defense mechanisms and generates a threshold dose of antigen

(Medzhitov et al 2000) (Figure 1.1) Recent research has shown that the adaptive

immune system is not adequate and not independent of the innate immune system But rather, it rides on recognition signals from the innate immune system as an input

to tailor its development In fact, the adaptive immune system also utilizes the effector apparatus of the innate immune system as part of its ammunition towards invaders (Carroll 2004) When bacteria invade, the innate immune system is immediately activated When the pathogen inoculum size exceeds the minimum limit dose of the antigen required for an adaptive response, the adaptive immune system is initiated to form the immunological memory At this stage, the pathogen continues to grow, retarded only by responses of the innate and non-adaptive immune system After 4-7 days, effector cells and molecules of the adaptive response start to clear the infection When the infection is cleared and the dose of antigen falls below the immune response threshold, the immune response ceases, but antibody, residual

effector cells, and also immunological memory provide lasting protection against

reinfection in most cases (Medzhitov et al 2000) (Figure 1.1) Although the response

of the adaptive immune system can specifically recognize and target diverse antigens, its initiation is delayed compared to the innate immune system due to the clonal selection and amplification In contrast, the innate immune system provides an immediate defense against intruders and activate the adaptive immune system through the processes such as the antigen presentation Such messages are further relayed to the innate and adaptive mechanisms, thereby, indicating that innate immune defense occupies the influential position in shaping adaptive immunity

Figure 1.1: The course of a typical acute infection cleared by immune reaction Innate

immune system is activated before the dapative immune system when the level of antigen is lower than the threshold level of antigen to activate the adaptive immune response The figure was adapted and modified from Medzhitov and Janeway (2000)

1.1.2 Pathogen-associated molecular patterns (PAMPs)

PAMPs, which are conserved microbial structures, such as lipopolysaccharide (LPS)

of Gram negative bacteria, lipoteichoic acids (LTA) of Gram positive bacteria and β-1,3-glucans of fungi, are uniquely displayed as patterns on the surface of the microbes (Beutler 2004) Bacterial LPS, which is displayed on the outer membrane of

a bacterium, represents a major PAMP Other PAMPs include bacterial flagellin, peptidoglycan (PGN) and nucleic acids such as double stranded RNA and single stranded RNA or unmethylated CpG motifs released by viruses These PAMPs can be specifically recognized by the host immune sensing proteins, which elicit host immune responses

LPS

Bacterial LPS is a large molecule consisting of a phosphorylated glucosamine-containing glycolipid base known as lipid A, which embeds into the

bacterial outer membrane via its acyl-chains (Figure 1.2A) The LPS contains a

polysaccharide chain of variable length, joined by a covalent bond to the lipid A

moiety (Figure 1.2B) The polysaccharide component is subdivided into a core region

and an O-polysaccharide region The core polysaccharide consists of a short chain of sugars, such as N-acetylglucosamine (GlcNAc) attached to one of the glucosamine of

the lipid A moiety The core region is further divided into the outer and inner core due

to the different sugars associated with these regions and is known to show moderate and low structural variability, respectively The O-polysaccharide consists of a chain

of repeating units of oligosaccharide and respresents the most variable region while the lipid A components of LPS is the relatively conserved region

Figure 1.2: Schematic diagram of the cell wall of Gram-neagative bacteria and the chemical structure of LPS (A) The Gram-negative bacteria consist of two lipid bilayer

membrane separated by a periplasmic space The LPS locates on the outer membrane of the

cell wall (B) LPS is composed of O-specific chain, core and Lipid A The GlcNAc residues in

LPS structure were boxed The pictures are adapted from http://phagetherapylightandshade.blogspot.com/2009/08/gram-negative-and-gram-positive-cell

A

B

Being discovered as endogenous toxins of pathogenic bacteria, LPS is released from the outer leaflet of the cell wall of Gram-negative bacteria, and they were earlier named endotoxins The LPS has its immunostimulatory potency of inducing the complex clinical syndrome of Gram-negative sepsis when the initial host response to an infection becomes dysregulated, representing the most prominent activity The acute inflammatory host response is attributable to the lipid anchor of the lipid A moiety Sepsis syndromes such as fever, hypotension, respiratory and renal failure, and intravascular disseminated coagulation will ensue Septic shock prevails with casualties if not controlled in a timely and proper manner Many responsive elements of LPS in the host, such as TLR4, C-type lectins, were identified to participate in various inflammatory responses, such as complement activation which triggers immune cells to interact with a variety of serum proteins Therefore, once the host detects the LPS, it will immediately initiate and amplify the immune response to combat the invading pathogens TLR4, which is a crucial cell surface sensor for LPS was identified by two groups of researchers searching for the genes responsible for the hypo-responsiveness to LPS in two mouse strains, C3H/HeJ and C57BL10/ScCr

(Poltorak et al 1998; Qureshi et al 1999) This also leads to the discovery of the

bridging molecules between LPS and TLR4 termed MD2 and CD14 (Figure 1.3)

GlcNAc

Glucosamine is the most abundant naturally occurring amino sugar present in PGN and in a variety of complex polysaccharides which constitute the blood group The acetylated form of glucosamine is called N-acetylglucosamine (GlcNAc) that is the

basic structural unit presented on the surface of the invading pathogens (Figure 1.4)

As a moiety of many PAMPs such as PGN, LPS and chitin, GlcNAc functions as the typical ligand of many different innate immunity components such as MBL, and ficolins L-, H- isoforms Due to the lack of the basic orientation, the binding of GlcNAc itself to the lectins such as ficolins only occurs at higher concentrations

(Garlatti et al 2007) to activate the complement and other immune responses and

elicit a proinflammatory function

Figure 1.3: Schematic diagram of the LPS induced immune signal transduction (adapted

from Z L S Brookes_et al ,2009 with modification).

GlcNAc is also naturally occurring and it is synthesized by virtually all cells

It influences various physiological properties GlcNAc synthesized by normal cells is encrypted within its membrane bilayer and facing inwards of the cell until pathophysiological conditions prevail where GlcNAc landscape is everted and exposed For example, during tissue injury and apoptosis, GlcNAc is exposed extracellularly which induces the complement activation and phagocytosis Recently, 2–20 mM GlcNAc has been proposed for the treatment of autoimmune diseases such

as osteoarthritis and multiple sclerosis (Felson et al 2000; Reginster et al 2001)

This is based on its reported suppressive effects on the activity of antibodies and on unprimed T cell response by interfering with functions of antigen presenting cells in the mouse model Along the lines of autoimmune therapy, another recent study reported improvement in 75% of children with treatment-resistant autoimmune

Figure 1.4: Chemical structure of GlcNAc, a critical component of PAMPs (adapted from

Low et al (2007) and http://upload.wikimedia.org /wikipedia/commons/f/f2/GlcNac.gif with

modification)

inflammatory bowel disease who received a two year course of GlcNAc However, it

is argued that additional studies will be required to assess the full potential of this therapeutic approach, particularly, the potential risks of this treatment

Phosphatidylcholine

Phosphatidylcholines (PC) which is the most abundant phospholipid ubiquitously present in different organisms, represents a primal class of substances in both prokaryotes and eukaryotes It is found on the exoplasmic or outer leaflet of the majority of eukaryotic cell membrane serving as the key building block of membrane bilayers, as well as an integral component of the circulating blood lipoproteins PC is

a phospholipid composed of a phosphate group, 2 fatty acids, and choline (Figure 1.5,

left panel) The monomer of PC is very hydrophobic therefore the aqueous

monomeric solubilities of PC are extremely low The most distinquishing physical characteristics between simple phospholipids and phosphatidylcholine are the choline head and the polyunsaturated essential fatty acid chains that make up the tail As an important component of the cell membrane, PC, which can be ingested and broken down into choline, glycerol free fatty acids, and the phosphate group, plays important homeostatic function by regulating the membrane fluidity in a healthy organism PC deficiency due to altered nutrition, leads to apoptosis, especially in hippocampal

neurons (Zweigner et al 2004) Compared to the eukaryotic cells, although many prokaryotes lack PC, it can be found in significant amounts in membranes of rather diverse bacteria, including pathogenic Neisseria meningitidis, commensal Neisseria,

Pseudomonas aeruginosa, Mycoplasma fermentans, Streptococcus pneumoniae, Streptococcus oralis and Actinobacillus actinomycetemcomitans. It is reported that based on genomic data,

more than 10% of all bacteria (Sohlenkamp et al 2003) were found to possess PC,

which provides a recognition motif for the host defense proteins to elicit the immune

responses (Figure 1.5, right panel) The C-reactive protein (CRP) was shown to bind

S pneumoniae via the phosphorylcholine moiety The binding of PC to CRP is a

calcium-dependent with a dissociation constant (Kd) of ~300 nM by isothermal titration calorimetry Therefore, PC represents a typical ligand of CRP which can initiate the phagocytosis process and the complement activation via classical pathway

Figure 1.5: Schematic and chemical structure of phosphatidylcholine PC (the chemical

structure, on the left panel) can be recognized by CD36, CRP and antibodies to activate cells surface receptors and induce intracellular signal transduction (right panel) Adapted from http://www.columbia.edu/cu/biology/courses/c2005/purves6/figure03-21.jpg

1.1.3 The innate immune system uses pattern recognition receptors

The significance of the innate immune system is highlighted by the fact that recurrent infection in the individuals with genetic defects in the innate immune system

increased, despite harboring a fully intact adaptive system (Eisen et al 2003; Seelen

et al 2005). Compared to the adaptive immune system, the innate immune system

is the front-line host defense The innate immune system employs a limited number of ready-to-use germline-encoded immune recognition proteins, termed as pattern recognition receptors (PRRs) to recognize PAMPs, such as LPS of Gram negative bacteria, LTA of Gram positive bacteria and β-1,3-glucans of fungi, uniquely

displayed as patterns on the surface of the microbes (Medzhitov et al 1997) It has

also been reported that many PRRs such as ficolins and mannose-binding lectins also specificially binds to small sugar moeities such as GlcNAc, GalNAc, sialic acid or mannan However, it is noteworthy that the PRRs can discriminate how the small sugar moiety is conjugated to the bigger molecule (for example, GlcNAc-LPS and GlcNAc-BSA) It was found that siglecs which recognize sialylated structures can differentially discriminate amoung specific linkages [a(2-3), a(2-6) or a(2-8)] by

which the sialic acid structures are linked to the underlying glycan structure (Crocker

et al 2007) Therefore, due to the lack of a clustered pattern that would normally be

present if it were displayed in situ on PAMPs and/or on pathogens, higher

concentration of free sugar molecules was required for them to be recoginized by PRRs

Once released or exposed to the host, PAMPs are usually sensed by PRRs and activate innate immune response to protect the host from invading microbes PRRs can be categorized into the soluble PRRs and membrane associated PRRs One big family of soluble PRRs in human plasma is the C-type lectins, which are

calcium-dependent, including collectins (Robinson et al 2006) and ficolins (Holmskov et al 2003) Collectins and ficolins, present in plasma and on mucosal

surfaces, are humoral molecules of the innate immune system, which recognize PAMPs Most of the collectin monomers tend to multimerize to increase the avidity

of the attachment of these PRRs to microbial surfaces where the PAMPs (selected terminal monosaccharides) are clustered Three major collectins, namely mannose-binding lectin (MBL), surfactant protein A (SP-A) and surfactant protein D

(SP-D) were demonstrated to play critical roles in innate immunity (Willment et al

2008) MBL, mainly synthesized in the liver, circulates in the human serum and it can

recognize diverse microorganisms, including bacteria and fungi (Ip et al 2009) SP-A

and SP-D, which also recognize a variety of microorganisms including fungi, are synthesized and secreted predominantly in the lung by alveolar type II cells and

non-ciliated bronchial epithelial cells (Holmskov et al 2003) Although collectins and

ficolins have structurally similar carbohydrate-recognition domains attached to the collagen-like domain, they make use of different carbohydrate-recognition domains: C-type lectin domains for the collectins and fibrinogen-like domains (FBG) for the

ficolins (Holmskov et al 2003) for their pathogen recognition (Figure 1.6)

Figure 1.6: The schematic picture of the structures of collectin and ficolins Both of them

contain the collagen-like domain and carbohydrate recognition domain (C-type lectin

While microbial recognition by the soluble PRRs such as MBL activates the lectin-mediated complement pathways in humans, there are more membrane bound

PRRs identified than the plasma PRRs, including the scavenger receptors (Dempsey

et al 2003), complement receptor 3 (Dempsey et al 2003), lactosylceramide

(Robinson et al 2006), Dectin-1 (Brown et al 2005), Dectin-2 (Willment et al 2008) and the Toll-like receptors (TLRs) (Netea et al 2008) The scavenger receptors,

which are expressed by myeloid and some endothelial cells, cover a heterogeneous

group of molecules that recognize glucans of fungi (Mukhopadhyay et al 2004),

modified low-density lipoproteins, selected polyanionic ligands and various microbes

(Peiser et al 2002) The complement receptor 3 is a heterodimeric integrin receptor

that is expressed on myeloid cells, NK cells and some lymphocytes It is made up of the CD11 and CD18 chains, and functions as a cellular adhesion molecule and as a phagocytic receptor for fungi and other pathogens (Ehlers 2000) A carbohydrate binding site located in the C-terminus of CD11 is involved in β-glucan recognition

(Brown et al 2005) Similarly, lactosylceramide, a glycosphingolipid comprising a

hydrophobic ceramide lipid and a hydrophilic sugar moiety, present in many cell types, recognizes numerous microbes (Karlsson 1989) and β-glucans (Zimmerman et

al 1998) Its interaction with β-glucans boosts neutrophil oxidative burst and

antimicrobial functions (Wakshull et al 1999) Dectin-1 is a type II transmembrane